CN111748573B

CN111748573B - Application of IRM1 gene in preparation of preparation for inhibiting plant leaf growth

Info

Publication number: CN111748573B
Application number: CN202010528798.2A
Authority: CN
Inventors: 黄腾波; 张志伟; 王凤攀
Original assignee: Longhua Bio-Industry Innovation Research Institute Of Shenzhen University; Shenzhen University
Current assignee: Longhua Bio-Industry Innovation Research Institute Of Shenzhen University; Shenzhen University
Priority date: 2020-06-11
Filing date: 2020-06-11
Publication date: 2022-08-19
Anticipated expiration: 2040-06-11
Also published as: CN111748573A

Abstract

The invention belongs to the technical field of plant gene regulation and control, and particularly relates to application of an IRM1 gene in preparation of a preparation for inhibiting plant leaf growth. Experiments show that the rosette leaves of the obtained IRM1 mutant arabidopsis thaliana plant with the deletion of the endogenous function are larger than those of a wild arabidopsis thaliana plant by inserting IRM 1T-DNA into the mutant phenotype, so that the IRM1 gene is a gene capable of inhibiting the growth of plant leaves and the division of leaf cells, can be used for preparing a preparation for inhibiting the growth of the plant leaves and the division of the plant cells, achieves the aim of regulating and controlling the sizes of plant leaf organs, and has important significance for further perfecting a molecular mechanism for regulating and controlling the sizes of the plant organs and improving the sizes of crop organs by a genetic means.

Description

Application of IRM1 gene in preparation of preparation for inhibiting plant leaf growth

Technical Field

The invention belongs to the technical field of plant gene regulation, and particularly relates to an application of an IRM1 gene in preparation of a preparation for inhibiting plant leaf cell division, an application of an IRM1 gene in preparation of a preparation for inhibiting plant leaf cell division, a method for promoting plant leaf cell division and a method for promoting plant leaf cell division.

Background

Plant cells, which are essential units constituting a plant body, play an important role in the process of gradually developing a plant from seed germination into a mature individual, and the occurrence and growth of plant organs are closely related to cell division and cell volume expansion. At present, much research is carried out on the development of the leaf of the model plant Arabidopsis thaliana, and the cell division activity is generally considered to be the highest in the early growth and development stage of the leaf of Arabidopsis thaliana. With the progressive development, the cell division activity is weakened, the cells enter a volume expansion stage in a transition way, and finally the leaf stops growing. Therefore, the size of the leaf morphology of Arabidopsis is determined by the cell division activity, the volume expansion rate and the transition period progress of the two. In recent years, the scientific community has made some progress in the mechanism of cell growth and development, and a series of multiple genes that influence organ development by regulating cell growth have been discovered. Regulation of leaf organ size by maintaining cell proliferation, for example, by the GRF gene family and the GRF-INTERACTING FACTOR (GIF) gene; the JAG gene inhibits the formation of zigzag edges of arabidopsis leaves and petals by influencing the cell cycle; SLC/AGO1 gene regulates the division and directional elongation of leaf cells of Arabidopsis thaliana, promotes the formation of cell processes in leaf epidermal cells, and thus inhibits the overgrowth of cells; expression level of TOR gene in leaf cells regulates leaf size and ubiquitin binding proteins DA1 and E3 ubiquitin ligase BIG-brothers (bb) restricts organ size by promoting cell proliferation. These regulatory factors play an important role in the growth and development of leaves. Nevertheless, there is limited knowledge of the intrinsic regulatory mechanisms underlying plant organ size.

Disclosure of Invention

The invention aims to provide an application of an IRM1 gene in preparation of a preparation for inhibiting plant leaf growth, an application of an IRM1 gene in preparation of a preparation for inhibiting plant leaf cell division, a method for promoting plant leaf growth and a method for promoting plant leaf cell division, and aims to provide a novel method for regulating plant leaf growth.

In order to achieve the purpose of the invention, the technical scheme adopted by the invention is as follows:

the invention provides an application of IRM1 gene in preparing a preparation for inhibiting plant leaf growth.

The invention also provides application of the IRM1 gene in preparing a preparation for inhibiting the cell division of plant leaves.

In another aspect, the present invention provides a method for promoting plant leaf growth, which is to inhibit the expression of IRM1 gene in plant genome to obtain a plant mutant with low IRM1 gene expression or a plant mutant without IRM1 gene expression.

In the last aspect of the invention, a method for promoting the division of plant leaf cells is provided, which is to inhibit the expression of IRM1 gene in plant genome and obtain plant mutant with low IRM1 gene expression or plant mutant without IRM1 gene expression.

Experiments show that by inserting IRM 1T-DNA into mutant phenotype, the rosette leaves of the obtained mutant Arabidopsis plant with IRM1 endogenous function deletion are larger than those of wild Arabidopsis plants, and the IRM1 gene is a gene capable of inhibiting the growth of Arabidopsis leaves. Meanwhile, as arabidopsis thaliana is a model plant, on the basis that the IRM1 gene can inhibit the growth of arabidopsis thaliana leaves, the growth of the leaves of other plants can also be inhibited, the gene can be used for preparing a preparation for inhibiting the growth of the plant leaves, the purpose of regulating and controlling the size of plant leaf organs is achieved, and the gene has important significance for further perfecting a molecular mechanism for regulating and controlling the size of the plant leaf organs and improving the size of crop organs by a genetic means.

Experiments show that the leaf cell area of the obtained Arabidopsis mutant plant with IRM1 endogenous function deletion is counted by inserting IRM 1T-DNA into the mutant phenotype, and the result shows that the average leaf cell area of the mutant Arabidopsis plant is larger than that of the wild Arabidopsis plant, but the difference is not significant. Since the shape and size of Arabidopsis leaf are determined by the cell division activity, the volume amplification rate and the transition period of the two, it is known that the IRM1 gene is a gene inhibiting cell division of Arabidopsis leaf. Meanwhile, as arabidopsis thaliana is a model plant, on the basis that the IRM1 gene can inhibit the cell division of arabidopsis thaliana leaf, the IRM1 gene can also inhibit the cell division of other plant leaves, and can be used for preparing a preparation for inhibiting the cell division of the plant leaf so as to regulate and control the size of a plant leaf organ.

According to the invention, the plant mutant of low expression IRM1 gene or the plant mutant of non-expression IRM1 gene is obtained by inhibiting the expression of IRM1 gene in plant genome, and the leaves of the plant mutant of low expression IRM1 gene or the plant mutant of non-expression IRM1 gene are larger than the wild type leaves of non-inhibition IRM1 gene expression in plant genome. Therefore, the method can promote the growth of plant leaves and obtain plants with larger leaf organs.

Because the IRM1 gene is a gene for inhibiting the division of plant leaf cells, the invention obtains a plant mutant with low expression of IRM1 gene or a plant mutant without expression of IRM1 gene by inhibiting the expression of IRM1 gene in plant genome. The leaf cell division activity of the plant mutant of the low-expression IRM1 gene or the plant mutant of the non-expression IRM1 gene is not inhibited by the IRM1 gene any more, and is faster than the cell division of a wild plant leaf, so the method can promote the division of the plant leaf cell.

Drawings

FIG. 1 is a photograph of Col-1 and irm1 mutant Arabidopsis plants grown for four weeks according to an embodiment of the present invention;

FIG. 2 is a diagram showing the results of PCR amplification and agarose gel electrophoresis separation of nucleic acids from Col-1 and irm1 mutant Arabidopsis plants according to an embodiment of the present invention;

FIG. 3 shows the result of identifying the IRM1 gene expression level of Col-1 and IRM1 mutant Arabidopsis plants by qRT-PCR in the example of the present invention;

FIG. 4 is a graph of the results of scanning electron microscope profiling of cells of the 5 th rosette leaf of Col-1 and irm1 mutant Arabidopsis plants grown normally for 4 weeks according to the example of the present invention;

FIG. 5 shows the scanning electron microscope examination of the cells in the middle part of the lower epidermis of the 5 th rosette leaf of Col-1 and irm1 mutant Arabidopsis plants growing for 4 weeks and the results of the cell area ratio.

Detailed Description

In order to make the objects, technical solutions and technical effects of the embodiments of the present invention clearer and more completely describe the technical solutions in the embodiments of the present invention, the embodiments described below are a part of the embodiments of the present invention, and not all of the embodiments. All other embodiments obtained by a person of ordinary skill in the art without any inventive step in connection with the embodiments of the present invention shall fall within the scope of protection of the present invention. The examples do not indicate specific conditions, and the conventional conditions or conditions suggested by the manufacturer are followed; the reagents or instruments used are conventional products which are not indicated by manufacturers and are commercially available.

In the description of the present invention, the term "and/or" describing an association relationship of associated objects means that there may be three relationships, for example, a and/or B, may mean: a alone, A and B together, and B alone. Wherein A and B can be singular or plural. The character "/" generally indicates that the former and latter associated objects are in an "or" relationship.

It should be understood that the weight of the related components mentioned in the embodiments of the present invention may not only refer to the specific content of each component, but also represent the proportional relationship of the weight among the components, and therefore, it is within the scope of the disclosure that the content of the related components is scaled up or down according to the embodiments of the present invention. Specifically, the weight described in the embodiments of the present invention may be a unit of mass known in the chemical field, such as μ g, mg, g, kg, etc.

In addition, unless the context clearly uses otherwise, an expression of a word in the singular is to be understood as including the plural of the word. The terms "comprises" or "comprising" are intended to specify the presence of stated features, quantities, steps, operations, elements, portions, or combinations thereof, but are not intended to preclude the presence or possible addition of one or more other features, quantities, steps, operations, elements, portions, or combinations thereof.

The embodiment of the invention provides application of IRM1 gene in preparation of a preparation for inhibiting plant leaf growth.

Experiments show that by inserting IRM 1T-DNA into mutant phenotype, rosette leaves of the obtained IRM1 mutant Arabidopsis plant with the deletion of endogenous function (namely, IRM1 mutant) are larger than those of a wild Arabidopsis plant, which indicates that the IRM1 gene is a gene capable of inhibiting the growth of Arabidopsis leaves. Meanwhile, as arabidopsis thaliana is a model plant, on the basis that the IRM1 gene can inhibit the growth of arabidopsis thaliana leaves, the gene can also inhibit the growth of leaves of other plants, and can be used for preparing a preparation for inhibiting the growth of the plant leaves so as to achieve the purpose of regulating and controlling the size of plant leaf organs.

The IRM1 gene (INCREASED RESISTANCE TO MYZUS PERSICAE 1) is numbered as AT5G65040 in the position of Arabidopsis genome, and the nucleotide sequence is shown as SEQ ID NO: 1.

Nucleotide sequence of IRM1 gene (SEQ ID NO: 1):

ataaaaataaaacaatattatctctataattagattctcccattctttttctttaaataactttgttcttcttctcttcttcctcccctttactacacacttcttcttttttcttcagaaagaaagaaagacagagagagagagagaagatggtgttaggaaagcgtcatggatcactgatcaagagaacaactagcatgaagatgatcacactcgatacacccacgatctatgacgcatctcagccgtccgatcatctaacctttcatcaacaccctcacaatccgatggtggtgatggctagtaactacgatgatttcttgaagacttgtagtctctgcaatcgaagtctctgccatcatcgtgacatttacatgtataggtacgattttatttactttttattttgtaaattttataaacgtaattaacccttcacacaatttgaaatgatatgttttgatcatggttgtatgctatatagttttaatgaatatttttttgtatatattgaatcgtttttgtagagggaacaacgcattttgtagcttagaatgcagggagaagcaaattaagctggacgagaaaaaagcgaaaaccggcttcgtaacatcgaagaaaccaattcgtatttagttgatcatctatgatctaaaatgataacgatagtttttccttatgagtaaaatgaatatgtttttgcgtttcgtgtacaagaatgatgaaaattaagagagaaaaatgagactaaatgagtgtagtgatcatatagtaatgggacttcataagcatgatttgatttgttcgtgtgatttgtttctttgtgatgtgtaatatgtaatgtaatatcaatgttgatgtatattcaggtggtcttcttagttcttactacttgtcgtaacatataaagatatttagtaaacgtactctgattttataatatcagatggaccgtttcttaaatggacttagaaaatagaatttgtgatagtgatcagttctgag

the embodiment of the invention also provides application of the IRM1 gene in preparation of a preparation for inhibiting plant leaf cell division.

Experiments show that the leaf cell area of an obtained Arabidopsis mutant plant with the IRM1 endogenous function deletion is counted by inserting IRM 1T-DNA into the mutant phenotype, and the result shows that the average leaf cell area of the mutant Arabidopsis plant is larger than that of a wild Arabidopsis plant, but the difference is not significant. Since the shape and size of Arabidopsis leaf are determined by the cell division activity, the volume amplification rate and the transition period of the two, it is known that the IRM1 gene is a gene inhibiting cell division of Arabidopsis leaf. Meanwhile, as arabidopsis thaliana is a model plant, on the basis that the IRM1 gene can inhibit the cell division of arabidopsis thaliana leaf, the IRM1 gene can also inhibit the cell division of other plant leaves, and can be used for preparing a preparation for inhibiting the cell division of the plant leaf so as to regulate and control the size of a plant leaf organ.

The embodiment of the invention also provides a method for promoting the growth of plant leaves, which is to inhibit the expression of the IRM1 gene in a plant genome to obtain a plant mutant with low IRM1 gene expression or a plant mutant without IRM1 gene expression.

According to the embodiment of the invention, the expression of the IRM1 gene in the plant genome is inhibited to obtain the plant mutant with the low-expression IRM1 gene or the plant mutant without expressing the IRM1 gene, and the leaves of the plant mutant with the low-expression IRM1 gene or the plant mutant without expressing the IRM1 gene are larger than those of a wild type leaf without inhibiting the expression of the IRM1 gene in the plant genome. Therefore, the method can promote the growth of plant leaves and obtain plants with larger leaf organs.

In some embodiments, methods for inhibiting the expression of the IRM1 gene in a plant genome include, but are not limited to, gene editing, gene knockout, gene silencing, or a combination thereof.

The embodiment of the invention also provides a method for promoting the division of plant leaf cells, which is to inhibit the expression of the IRM1 gene in a plant genome to obtain a plant mutant with low IRM1 gene expression or a plant mutant without IRM1 gene expression.

Because the IRM1 gene is a gene for inhibiting the division of plant leaf cells, the embodiment of the invention obtains a plant mutant with low IRM1 gene expression or a plant mutant without IRM1 gene expression by inhibiting the expression of the IRM1 gene in the plant genome. The leaf cell division activity of the plant mutant of the low-expression IRM1 gene or the plant mutant of the non-expression IRM1 gene is not inhibited by the IRM1 gene any more, and is faster than the cell division of wild plant leaves, so the method can promote the division of plant leaf cells.

In order to make the details and operation of the above-mentioned embodiments of the present invention clearly understood by those skilled in the art, and to make the progress of the use of IRM1 gene in inhibiting the growth of plant leaves obvious, the above-mentioned technical solution is illustrated by the following specific examples.

Examples

The embodiment provides an irm1 mutant and an identification method and an identification result thereof.

1. Arabidopsis culture conditions and overall experimental flow

Preparing 1/2MS solid culture medium, sterilizing Col-0 seed and irm1 mutant seed (purchased from Arabidopsis thaliana seed TAIR website Arabidopsis thaliana planting resource center), uniformly dropping the seeds in solidified culture medium, cold treating in refrigerator at 4 deg.C for 2 days, culturing in constant temperature (about 22 deg.C) culture room for 7 days, and transplanting seedling to nutrient soil after 7 days. After the plants grow for 2 weeks, the Col-0 leaves and the irm1 mutant leaves are taken for mutant identification, after the plants grow for 4 weeks, the 5 th lotus throne leaf of each plant is taken for fixation, and after sample preparation through a scanning electron microscope, the number and the size of cells are observed and counted under the electron microscope.

Identification of irm1 mutants

DNA samples were extracted from Col-0 and IRM1 mutant plants by CTAB method, PCR-amplified by upstream and downstream primers of IRM1 gene and LBb1.3 specific primer and nucleic acid was isolated by agarose gel electrophoresis.

The CTAB method comprises the following specific processes of extracting a DNA sample: respectively putting 2-3 Col-0 arabidopsis thaliana young leaves and irm1 mutant young leaves into different 2ml centrifuge tubes, freezing by using liquid nitrogen and grinding into powder, adding 1ml of CTAB solution into the tubes, shaking uniformly, putting into a 65 ℃ metal bath, heating for 30min, adding 700ml of chloroform into the tubes, shaking uniformly for 10min lightly at room temperature, centrifuging for 15min at 12000r, and transferring the supernatant into a new centrifuge tube; adding 420ml of isopropanol into the supernatant, shaking up, centrifuging at 12000r for 10min, discarding the supernatant, washing the precipitate with 500ml of 75% ethanol, centrifuging at 12000r for 5min, drying the precipitate, adding 30-50 ul of TE (pH 8.0) to dissolve DNA, and obtaining two DNA samples as follow-up PCR templates for amplification.

During PCR amplification, the following amplification primers are used: the upstream and downstream primers (IRM1-F and IRM1-R) of IRM1 are used for amplifying DNA sample of Col-0, and the nucleotide sequence is shown in SEQ ID NO. 2-3; the LBb1.3 specific primer and IRM1-R were used to amplify DNA samples of IRM1 mutant, and the nucleotide sequence of the LBb1.3 specific primer is shown in SEQ ID NO. 4.

Nucleotide sequence of IRM1-F (SEQ ID NO: 2):

5'-acgggggactctagaggatccatggtgttaggaaagcgtcatgg-3'

nucleotide sequence of IRM1-R (SEQ ID NO: 3):

5'-gcccttgctcaccatggtaccaatacgaattggtttcttcgatgtt-3'

nucleotide sequence of the specific primer LBb1.3 (SEQ ID NO: 4):

5'-attttgccgatttcggaac-3'

the PCR amplification system for amplifying the DNA sample extracted from Col-0 Arabidopsis young leaves is shown in Table 1; the PCR amplification system for amplifying DNA samples extracted from young leaves of irm1 mutant is shown in Table 2. The reaction conditions for PCR amplification are as follows: pre-denaturation: 94 ℃, 5 min; denaturation: 30s at 94 ℃; and (3) annealing: at 58 ℃ for 30 s; extension: circulating for 34 times at 72 ℃ for 1 min; finally, the product is fully extended by extension for 10min at 72 ℃, and then the agarose gel electrophoresis is carried out to separate the nucleic acid.

TABLE 1 PCR amplification System for Col-0 DNA samples

Name of reagent	Volume (μ l)
		Taq mix(2x)	7.5
IRM1-F(10μM)	0.5
		IRM1-R(10μM)	0.5
DNA template	1
		Sterilized water	5.5
Total volume	15

TABLE 2 PCR amplification System for 2 irm1 mutant DNA samples

The results of separating nucleic acids by agarose gel electrophoresis are shown in FIG. 2. As can be seen from FIG. 2, no band was detected in IRM1 (6 bands from left to right) mutant plants using primers (IRM1-F and IRM1-R), while the band was detected in Col-0 positive control (7 bands from left to right in Col group); in the IRM1 mutant, bands (6 bands from right to left) were detectable using the detection mutant primers (LB1.3 and IRM1-R), whereas the negative control Col-0 (7 bands from right to left in IRM1 group) was undetectable, indicating that the IRM1 genotype was indeed a mutant.

qRT-PCR identification of expression level of IRM1 gene of plant

Irm1 mutant RNA was extracted using a Total RNA extraction kit (DP432) from Tiangen, and PrimeScript from Takara was used ^TM RT reaThe cDNA sequence for Real-Time fluorescent PCR was synthesized by reverse transcription using gene Kit (Perfect Real Time) reverse transcription Kit, and then used as TB from Takara

Premix Ex Taq ^TM (Tli RNaseH Plus) kit, by TB Green chimeric fluorescence method for real-time fluorescent PCR. A PCR reaction system (ice operation) was prepared with the components shown in Table 3:

TABLE 3 real-time fluorescent PCR reaction System

qPCR was then performed using a BIO-RAD CFX96 PCR machine, with the qPCR amplification program shown in Table 4.

TABLE 4 qPCR amplification procedure

The first step is as follows: pre-denaturation	The second step is that: PCR reaction	The third step: melting
			Reps：1	Reps：40	95℃，15s
95℃，30s	95℃，5s	60℃，60s
				60℃，30s	95℃，15s

After amplification, the qPCR data was processed by analyzing the amplification curve and the melting curve of Real Time PCR, and the gene expression levels of each group of samples were analyzed, with the analysis results shown in fig. 3.

As can be seen from FIG. 3, the expression level of the IRM1 gene in imr1 mutant plants is significantly lower than that of Col-0 Arabidopsis plants.

4. Scanning electron microscope photographing

Selecting the Col-0 arabidopsis thaliana plant growing normally for 4 weeks and the 5 th rosette leaf of the irm1 mutant arabidopsis thaliana plant, fixing, vacuumizing, drying at the critical point of a scanning electron microscope sample preparation system (high vacuum film plating machine-EMACE 600), spraying gold, and observing the cells in the middle part of the lower surface skin of the leaf by using a high-resolution scanning electron microscope (FEI APREO S). The obtained photographs and the results of cell area analysis are shown in FIGS. 4 and 5.

As can be seen from FIG. 4, under the same size of field of the SEM, the cell area is measured by plotting the cell profile and counting the number of cells. Statistical data show that the mean area of single cells of the IRM1 mutant is slightly larger than that of single cells of Col-0, but there is no significant difference, and the difference of leaf area size is shown that IRM1 influences the cell number.

In the cell area statistics by the scanning electron microscope of fig. 5, the average cell area of the irm1 mutant leaf (three repeats) was large but not significant relative to Col-0 (three repeats). Therefore, the IRM1 gene controls the size of the lotus throne leaf organ by regulating the cell number of Arabidopsis thaliana instead of the cell size, and plays a role in negatively regulating cell division and organ growth. The aim of increasing the cell number and the size of organs can be achieved by mutating the IRM1 gene.

The above-mentioned embodiments only express several embodiments of the present invention, and the description thereof is more specific and detailed, but not construed as limiting the scope of the present invention. It should be noted that various changes and modifications can be made by those skilled in the art without departing from the spirit of the invention, and these changes and modifications are all within the scope of the invention. Therefore, the protection scope of the present patent shall be subject to the appended claims.

Sequence listing

<110> Shenzhen university

Application of <120> IRM1 gene in inhibiting plant leaf growth

<160> 4

<170> SIPOSequenceListing 1.0

<210> 1

<211> 1005

<212> DNA

<213> Arabidopsis thaliana (Arabidopsis thaliana)

<400> 1

ataaaaataa aacaatatta tctctataat tagattctcc cattcttttt ctttaaataa 60

ctttgttctt cttctcttct tcctcccctt tactacacac ttcttctttt ttcttcagaa 120

agaaagaaag acagagagag agagagaaga tggtgttagg aaagcgtcat ggatcactga 180

tcaagagaac aactagcatg aagatgatca cactcgatac acccacgatc tatgacgcat 240

ctcagccgtc cgatcatcta acctttcatc aacaccctca caatccgatg gtggtgatgg 300

ctagtaacta cgatgatttc ttgaagactt gtagtctctg caatcgaagt ctctgccatc 360

atcgtgacat ttacatgtat aggtacgatt ttatttactt tttattttgt aaattttata 420

aacgtaatta acccttcaca caatttgaaa tgatatgttt tgatcatggt tgtatgctat 480

atagttttaa tgaatatttt tttgtatata ttgaatcgtt tttgtagagg gaacaacgca 540

ttttgtagct tagaatgcag ggagaagcaa attaagctgg acgagaaaaa agcgaaaacc 600

ggcttcgtaa catcgaagaa accaattcgt atttagttga tcatctatga tctaaaatga 660

taacgatagt ttttccttat gagtaaaatg aatatgtttt tgcgtttcgt gtacaagaat 720

gatgaaaatt aagagagaaa aatgagacta aatgagtgta gtgatcatat agtaatggga 780

cttcataagc atgatttgat ttgttcgtgt gatttgtttc tttgtgatgt gtaatatgta 840

atgtaatatc aatgttgatg tatattcagg tggtcttctt agttcttact acttgtcgta 900

acatataaag atatttagta aacgtactct gattttataa tatcagatgg accgtttctt 960

aaatggactt agaaaataga atttgtgata gtgatcagtt ctgag 1005

<210> 2

<211> 44

<212> DNA

<213> primers (Primer)

<400> 2

acgggggact ctagaggatc catggtgtta ggaaagcgtc atgg 44

<210> 3

<211> 46

<212> DNA

<213> primers (Primer)

<400> 3

gcccttgctc accatggtac caatacgaat tggtttcttc gatgtt 46

<210> 4

<211> 19

<212> DNA

<213> primers (Primer)

<400> 4

attttgccga tttcggaac 19

Claims

1. A method of promoting the growth of plant leaves, the method comprising: inhibiting the expression of an IRM1 gene in a plant genome to regulate and control the size of a plant leaf organ to obtain a plant mutant with low expression of an IRM1 gene or a plant mutant without expression of an IRM1 gene, wherein the method for inhibiting the expression of the IRM1 gene in the plant genome comprises at least one of gene editing, gene knockout and gene silencing; wherein the plant is arabidopsis thaliana, the IRM1 gene controls the size of a lotus throne leaf organ by regulating the number of arabidopsis thaliana cells but not the size of the cells, and the nucleotide sequence SEQ ID NO 1 of the IRM1 gene is ataaaaataaaacaatattatctctataattagattctcccattctttttctttaaataactttgttcttcttctcttcttcctcccctttactacacacttcttcttttttcttcagaaagaaagaaagacagagagagagagagaagatggtgttaggaaagcgtcatggatcactgatcaagagaacaactagcatgaagatgatcacactcgatacacccacgatctatgacgcatctcagccgtccgatcatctaacctttcatcaacaccctcacaatccgatggtggtgatggctagtaactacgatgatttcttgaagacttgtagtctctgcaatcgaagtctctgccatcatcgtgacatttacatgtataggtacgattttatttactttttattttgtaaattttataaacgtaattaacccttcacacaatttgaaatgatatgttttgatcatggttgtatgctatatagttttaatgaatatttttttgtatatattgaatcgtttttgtagagggaacaacgcattttgtagcttagaatgcagggagaagcaaattaagctggacgagaaaaaagcgaaaaccggcttcgtaacatcgaagaaaccaattcgtatttagttgatcatctatgatctaaaatgataacgatagtttttccttatgagtaaaatgaatatgtttttgcgtttcgtgtacaagaatgatgaaaattaagagagaaaaatgagactaaatgagtgtagtgatcatatagtaatgggacttcataagcatgatttgatttgttcgtgtgatttgtttctttgtgatgtgtaatatgtaatgtaatatcaatgttgatgtatattcaggtggtcttcttagttcttactacttgtcgtaacatataaagatatttagtaaacgtactctgattttataatatcagatggaccgtttcttaaatggacttagaaaatagaatttgtgatagtgatcagttctgag.