CN111733219A - Method for efficiently amplifying microbial DNA from soil sample - Google Patents
Method for efficiently amplifying microbial DNA from soil sample Download PDFInfo
- Publication number
- CN111733219A CN111733219A CN202010566375.XA CN202010566375A CN111733219A CN 111733219 A CN111733219 A CN 111733219A CN 202010566375 A CN202010566375 A CN 202010566375A CN 111733219 A CN111733219 A CN 111733219A
- Authority
- CN
- China
- Prior art keywords
- soil sample
- bsa
- soil
- amplification
- qpcr
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/686—Polymerase chain reaction [PCR]
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6806—Preparing nucleic acids for analysis, e.g. for polymerase chain reaction [PCR] assay
Landscapes
- Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- Life Sciences & Earth Sciences (AREA)
- Zoology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Wood Science & Technology (AREA)
- Analytical Chemistry (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Biophysics (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Immunology (AREA)
- Biotechnology (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention relates to the technical field of molecular biology, and discloses a method for efficiently amplifying microbial DNA from a soil sample, which comprises the following steps: step 1, collecting a soil sample; step 2, extracting microbial nucleic acid from the collected soil sample; step 3, performing quality detection on the extracted nucleic acid; step 4, comparing the amplification effect of the original PCR system with that of the optimized PCR system; step 5, qPCR verification: adding the optimal Bovine Serum Albumin (BSA) in the amplification system; the invention collects special soil samples with high contents of humic acid, organic matters, heavy metal ions and the like, and adopts
Description
Technical Field
The invention relates to the technical field of molecular biology, in particular to a method for efficiently amplifying microbial DNA from a soil sample.
Background
Soil microorganisms are an important component of the soil ecosystem and they are the driving force for the conversion of substances in the soil: such as; nitrogen fixation, nitrification, denitrification, decomposition and synthesis of humus, and promotion of decomposition of soil organic matters and conversion of nutrients. At present, culturable microorganisms account for only 1% of the total microorganisms in the environment, and molecular biological techniques that do not rely on culture techniques are widely used. In recent years, with the rapid development of a new generation of high-throughput sequencing technology and the great reduction of cost, more and more researchers analyze the diversity of soil microbial communities through the sequencing technology. The basis of sequencing technology relies on high quality DNA templates and efficient PCR amplification techniques. However, the soil components are complex, a large amount of humic acid, heavy metal ions and the like are contained, the humic acid, heavy metal ions and the like are difficult to completely remove in the extraction process, and the residues of the substances not only interfere the extraction process, but also seriously inhibit the subsequent PCR amplification, so that the library building and sequencing failure is caused. Therefore, it is important to develop a method for efficiently amplifying the DNA of microorganisms from soil samples.
Disclosure of Invention
Technical problem to be solved
In view of the shortcomings of the prior art, the present invention provides a method for efficiently amplifying microbial DNA from a soil sample, which solves the problems of the background art.
(II) technical scheme
In order to achieve the purpose, the invention provides the following technical scheme: a method for efficiently amplifying microbial DNA from a soil sample, comprising the steps of:
step 3, performing quality detection on the extracted nucleic acid;
Preferably, the soil sample collection step in step 1 is:
(1) collecting 5 soil samples in the domestic sewage area by using sludge particles, wherein the soil samples are S1, S2, S3, S4 and S5, and the contents of impurities, humic acid, organic matters, inorganic matters and heavy metal ions are high;
(2) and 5 soil samples of C1, C2, C3, C4 and C5 are collected in the soil on the upper layer and the lower layer of the lawn.
Preferably, the step 2 of extracting the soil sample microbial nucleic acid comprises the following steps:
(1) weighing about 0.5g of soil sample, adding the soil sample into a lysine Matrix E tube, and violently shaking and uniformly mixing;
(2) adding 978ul of Sodium Phosphate Buffer and 122ul of MT Buffer, shaking and mixing uniformly firstly, and then shaking and mixing uniformly for 2 min; centrifuging at 14000g for 15 min;
(3) transferring the supernatant into a new 1.5ml centrifuge tube, adding 250ul PPS, gently inverting and uniformly mixing for about 10 times, and centrifuging for 15min at 14000 g;
(4) transferring the supernatant into a new 5ml centrifuge tube; adding 1ml Binding matrix xSuspension, gently mixing for 2min, and standing for 3 min;
(5) then 500ul of milky white supernatant was discarded; continuing to mix the precipitate and the remaining supernatant in the 5ml tube;
(6) taking 700ul of colloid precipitate, passing through a column, centrifuging for 14000g for 1min, and discarding waste liquid; repeating the operation until all samples in the 5ml tube pass through the column;
(7) adding 500ul SEWS-M into the purification column, standing for 1min, centrifuging for 1min at 14000g, and discarding the waste liquid;
(8) and air throwing: centrifuging at 14000g for 2min, and discarding the collecting pipe;
(9) putting the centrifugal column into a new collecting pipe, opening the cover and airing for 5-10 minutes at room temperature;
(10) sucking 52ul DES, dripping on the white solid in the purification column, closing the cover and standing for 2 min; 14000g was centrifuged for 2min and about 50ul of DNA solution was collected.
Preferably, the nucleic acid quality detection step in step 3 is:
(1) detecting the extraction concentration and purity of the soil nucleic acid by adopting Qubit3.0 and Nanodrop;
(2) and detecting the extraction integrity of the soil microorganism nucleic acid by adopting 1% agarose gel electrophoresis.
Preferably, the step 4 of comparing the amplification effect comprises the following steps:
(1) original PCR system: each 25. mu.L reaction system contained 25mM MgCl 24. mu.L, 1U Taq enzyme, 10mM Meach dNTPs 1. mu.L, 10. mu. mol/L primer F/R1. mu.L and 10ng DNA template (S1, S2, S3, S4, S5);
(2) and the optimized PCR system: each 25. mu.L reaction system contained 25mM MgCl 24. mu.L, 1U Taq enzyme, 1. mu.L dNTPs of 10mM Meach, 1. mu.L each of 10. mu. mol/L primer 27F/1492R, and 10ng DNA template (S1, S2, S3, S4, S5). 1 μ L of 100ng/μ L bovine serum albumin BSA;
(3) the amplification primer adopts a full-length amplification primer of a bacterial 16S region, and has the following sequence:
27F：AGAGTTTGATCCTGGCTCAG；
1492R：GGYTACCTTGTTACGACTT；
(4) the PCR amplification reaction program comprises: pre-denaturation at 95 ℃ for 3 min; denaturation at 94 ℃ for 30sec, annealing at 56 ℃ for 30sec, and extension at 72 ℃ for 45sec for 35 cycles; finally, extending for 5min at 72 ℃; storing the amplification product at 4 ℃;
(5) and detecting a PCR amplification product: detecting the size of the PCR amplification product fragment by using 1% agarose gel electrophoresis.
Preferably, the verification step of qPCR in step 5 is:
(1) qPCR reaction system: each 20. mu.L reaction contained 0.4. mu.L of each of 2X AceQ Universal SYBR QPCRMaster Mix 10ul, 10uM primers 27F/1492R, and 10ng of DNA template (S1, S2, S3, S4, S5). BSA 1. mu.L (BSA with concentration gradient 50 ng/. mu.L, 100 ng/. mu.L, 200 ng/. mu.L, 500 ng/. mu.L, 1000 ng/. mu.L, 2000 ng/. mu.L);
(2) qPCR reaction procedure: pre-denaturation at 95 ℃ for 3 min; denaturation at 95 ℃ for 30S, annealing at 56 ℃ for 30S, and extension at 72 ℃ for 45S (fluorescence collection), for 40 cycles;
(3) and analyzing the detection result: the qPCR amplification effect was best at a BSA concentration of 100 ng/. mu.L.
Preferably, the verification step of qPCR in step 6 is:
(1) qPCR reaction system: each 25. mu.L reaction contained 12.5. mu.L of 2 × AceQ Universal SYBR QPCRMaster Mix, 0.5. mu.L of each 10uM primer 27F/1492R, and 10ng of DNA template (C1, C2, C3, C4, C5). BSA 1u L (BSA set concentration gradient 0 ng/. mu.L, 50 ng/. mu.L, 100 ng/. mu.L);
(2) qPCR reaction procedure: pre-denaturation at 95 ℃ for 3 min; denaturation at 95 ℃ for 30S, annealing at 56 ℃ for 30S, and extension at 72 ℃ for 45S (fluorescence collection), for 40 cycles;
(3) and analyzing the detection result: the addition of BSA in the PCR system does not affect the amplification effect of normal samples.
(III) advantageous effects
The invention provides a method for efficiently amplifying microbial DNA from a soil sample, which has the following beneficial effects:
(1) the method collects special soil samples with high contents of humic acid, organic matters, heavy metal ions and the like, and adopts
After the Spin Kit for Soil Kit was successfully extracted, the PCR amplification failed. By optimizing the PCR and qPCR systems, Bovine Serum Albumin (BSA) is added into the PCR system and the optimal concentration is searched, so that the amplification success rate reaches 100%, and the PCR amplification efficiency is greatly improved. The result of verification shows that the addition of Bovine Serum Albumin (BSA) in the PCR system has no influence on the soil sample which can be normally amplified.
(2) The invention aims at the high-efficiency PCR amplification system of soil microorganisms, has obvious amplification effect on soil microorganism samples which are high in humic acid, organic matters and heavy metal ions and difficult to amplify, greatly improves the PCR amplification success rate, and lays a scientific research foundation for subsequent deep research. The system is suitable for amplification of PCR, qPCR and the like, and can be widely applied to related fields of gene sequencing, genotyping detection, antibiotic resistance detection and the like.
Drawings
FIG. 1 is a schematic diagram of agarose gel electrophoresis detection of nucleic acid extracted according to the present invention;
FIG. 2 is a schematic diagram of the detection of the PCR amplification product by agarose gel electrophoresis in the present invention;
FIG. 3 is a graph of the relationship between Bovine Serum Albumin (BSA) concentration and the qPCR amplified CT value in the present invention;
FIG. 4 is a graph showing the relationship between the Bovine Serum Albumin (BSA) concentration and the amplified CT value in a normal soil sample qPCR system.
Detailed Description
The technical solutions in the embodiments of the present invention will be clearly and completely described below with reference to the drawings in the embodiments of the present invention, and it is obvious that the described embodiments are only a part of the embodiments of the present invention, and not all of the embodiments. All other embodiments, which can be derived by a person skilled in the art from the embodiments given herein without making any creative effort, shall fall within the protection scope of the present invention.
A method for efficiently amplifying microbial DNA from a soil sample, comprising the steps of:
(1) collecting 5 soil samples in the domestic sewage area by using sludge particles, wherein the soil samples are S1, S2, S3, S4 and S5, and the contents of impurities, humic acid, organic matters, inorganic matters and heavy metal ions are high;
(2) collecting 5 cases of soil samples in the soil on the upper layer and the lower layer of the lawn, wherein the soil samples are respectively C1, C2, C3, C4 and C5;
using what is common on the market
Performing nucleic acid extraction on the collected Soil microorganisms by using a Spin Kit for Soil Kit;
(1) weighing about 0.5g of soil sample, adding the soil sample into a lysine Matrix E tube, and violently shaking and uniformly mixing;
(2) adding 978ul of Sodium Phosphate Buffer and 122ul of MT Buffer, shaking and mixing uniformly firstly, and then shaking and mixing uniformly for 2 min; centrifuging at 14000g for 15 min;
(3) transferring the supernatant into a new 1.5ml centrifuge tube, adding 250ul PPS, gently inverting and uniformly mixing for about 10 times, and centrifuging for 15min at 14000 g;
(4) transfer the supernatant to a new 5ml centrifuge tube (do not aspirate into pellet); adding 1ml of Binding Matrix Suspension (Binding Matrix Suspensi on needs to be mixed vigorously in advance), mixing gently for 2min (hand mixing or rotator reversing mixing machine), and standing for 3 min;
(5) discard 500ul of milky white supernatant (do not suck the pellet); continuing to mix the precipitate and the remaining supernatant in the 5ml tube;
(6) taking 700ul of colloid precipitate, passing through a column, centrifuging for 14000g for 1min, and discarding waste liquid; repeating the operation until all samples in the 5ml tube pass through the column;
(7) adding 500ul SEWS-M (required to be prepared in advance) into the purification column, standing for 1min, centrifuging for 1min at 14000g, and discarding waste liquid;
(8) and air throwing: centrifuging at 14000g for 2min, and discarding the collecting pipe;
(9) putting the centrifugal column into a new collecting pipe, opening the cover and airing for 5-10 minutes at room temperature;
(10) sucking 52ul DES, dripping on the white solid in the purification column, closing the cover and standing for 2 min; 14000g, centrifuging for 2min, and collecting about 50ul of DNA solution;
step 3, performing quality detection on the extracted nucleic acid:
(1) detecting the extraction concentration and purity of the soil nucleic acid by adopting Qubit3.0 and Nanodrop;
(2) detecting the extraction integrity of the soil microbial nucleic acid by adopting 1% agarose gel electrophoresis;
(1) original PCR system: each 25. mu.L reaction system contained 25mM MgCl 24. mu.L, 1U Taq enzyme, 10mM Meach dNTPs 1. mu.L, 10. mu. mol/L primer F/R1. mu.L and 10ng DNA template (S1, S2, S3, S4, S5);
(2) and the optimized PCR system: each 25. mu.L reaction system contained 25mM MgCl 24. mu.L, 1U Taq enzyme, 1. mu.L dNTPs of 10mM Meach, 1. mu.L each of 10. mu. mol/L primer 27F/1492R, and 10ng DNA template (S1, S2, S3, S4, S5). 100 ng/. mu.L bovine serum albumin BSA 1. mu.L;
(3) the amplification primer adopts a full-length amplification primer of a bacterial 16S region, and has the following sequence:
27F：AGAGTTTGATCCTGGCTCAG；
1492R：GGYTACCTTGTTACGACTT；
(4) the PCR amplification reaction program comprises: pre-denaturation at 95 ℃ for 3 min; denaturation at 94 ℃ for 30sec, annealing at 56 ℃ for 30sec, and extension at 72 ℃ for 45sec for 35 cycles; finally, extending for 5min at 72 ℃; storing the amplification product at 4 ℃;
(5) and detecting a PCR amplification product: detecting the size of the PCR amplification product fragment by adopting 1% agarose gel electrophoresis;
(1) qPCR reaction system: each 20. mu.L reaction contained 0.4. mu.L of each of 2X AceQ Universal SYBR QPCRMaster Mix 10ul, 10uM primers 27F/1492R, and 10ng of DNA template (S1, S2, S3, S4, S5). BSA 1. mu.L (BSA with concentration gradient 50 ng/. mu.L, 100 ng/. mu.L, 200 ng/. mu.L, 500 ng/. mu.L, 1000 ng/. mu.L, 2000 ng/. mu.L);
(2) qPCR reaction procedure: pre-denaturation at 95 ℃ for 3 min; denaturation at 95 ℃ for 30S, annealing at 56 ℃ for 30S, and extension at 72 ℃ for 45S (fluorescence collection), for 40 cycles;
(3) and analyzing the detection result: the qPCR amplification effect is best when the BSA concentration is 100 ng/. mu.L;
(1) qPCR reaction system: each 25. mu.L reaction contained 12.5. mu.L of 2 × AceQ Universal SYBR QPCRMaster Mix, 0.5. mu.L of each 10uM primer 27F/1492R, and 10ng of DNA template (C1, C2, C3, C4, C5). BSA 1u L (BSA set concentration gradient 0 ng/. mu.L, 50 ng/. mu.L, 100 ng/. mu.L);
(2) qPCR reaction procedure: pre-denaturation at 95 ℃ for 3 min; denaturation at 95 ℃ for 30S, annealing at 56 ℃ for 30S, and extension at 72 ℃ for 45S (fluorescence collection), for 40 cycles;
(3) and analyzing the detection result: the addition of BSA in the PCR system does not affect the amplification effect of normal samples.
It is noted that, herein, relational terms such as first and second, and the like may be used solely to distinguish one entity or action from another entity or action without necessarily requiring or implying any actual such relationship or order between such entities or actions. Also, the terms "comprises," "comprising," or any other variation thereof, are intended to cover a non-exclusive inclusion, such that a process, method, article, or apparatus that comprises a list of elements does not include only those elements but may include other elements not expressly listed or inherent to such process, method, article, or apparatus.
Although embodiments of the present invention have been shown and described, it will be appreciated by those skilled in the art that changes, modifications, substitutions and alterations can be made in these embodiments without departing from the principles and spirit of the invention, the scope of which is defined in the appended claims and their equivalents.
Claims (7)
1. A method for efficiently amplifying microbial DNA from a soil sample, comprising the steps of:
step 1, collecting a soil sample;
step 2, extracting microbial nucleic acid from the collected soil sample;
step 3, performing quality detection on the extracted nucleic acid;
step 4, comparing the amplification effect of the original PCR system with that of the optimized PCR system;
step 5, qPCR verification: adding the optimal Bovine Serum Albumin (BSA) in the amplification system;
step 6, qPCR verification: whether the addition of Bovine Serum Albumin (BSA) to the amplification system has an effect on a sample that can be normally amplified.
2. The method for efficiently amplifying microbial DNA from a soil sample according to claim 1, wherein: the soil sample collection step in the step 1 is as follows:
(1) collecting 5 soil samples in the domestic sewage area by using sludge particles, wherein the soil samples are S1, S2, S3, S4 and S5, and the contents of impurities, humic acid, organic matters, inorganic matters and heavy metal ions are high;
(2) and 5 soil samples of C1, C2, C3, C4 and C5 are collected in the soil on the upper layer and the lower layer of the lawn.
3. The method for efficiently amplifying microbial DNA from a soil sample according to claim 1, wherein: the step 2 of extracting the soil sample microbial nucleic acid comprises the following steps:
(1) weighing about 0.5g of soil sample, adding the soil sample into a lysine Matrix E tube, and violently shaking and uniformly mixing;
(2) adding 978ul of Sodium Phosphate Buffer and 122ul of MT Buffer, shaking and mixing uniformly firstly, and then shaking and mixing uniformly for 2 min; centrifuging at 14000g for 15 min;
(3) transferring the supernatant into a new 1.5ml centrifuge tube, adding 250ul PPS, gently inverting and uniformly mixing for about 10 times, and centrifuging for 15min at 14000 g;
(4) transferring the supernatant into a new 5ml centrifuge tube; adding 1ml Binding matrix x Suspension, mixing for 2min, standing for 3 min;
(5) then 500ul of milky white supernatant was discarded; continuing to mix the precipitate and the remaining supernatant in the 5ml tube;
(6) taking 700ul of colloid precipitate, passing through a column, centrifuging for 14000g for 1min, and discarding waste liquid; repeating the operation until all samples in the 5ml tube pass through the column;
(7) adding 500ul SEWS-M into the purification column, standing for 1min, centrifuging for 1min at 14000g, and discarding the waste liquid;
(8) and air throwing: centrifuging at 14000g for 2min, and discarding the collecting pipe;
(9) putting the centrifugal column into a new collecting pipe, opening the cover and airing for 5-10 minutes at room temperature;
(10) sucking 52ul DES, dripping on the white solid in the purification column, closing the cover and standing for 2m in; 14000g was centrifuged for 2min and about 50ul of DNA solution was collected.
4. The method for efficiently amplifying microbial DNA from a soil sample according to claim 1, wherein: the nucleic acid quality detection step in the step 3 is as follows:
(1) detecting the extraction concentration and purity of the soil nucleic acid by adopting Qubit3.0 and Nanodrop;
(2) and detecting the extraction integrity of the soil microorganism nucleic acid by adopting 1% agarose gel electrophoresis.
5. The method for efficiently amplifying microbial DNA from a soil sample according to claim 1, wherein: the step 4 of comparing the amplification effect comprises the following steps:
(1) original PCR system: each 25. mu.L reaction system contained 25mM MgCl 24. mu.L, 1U Taq enzyme, 10mM each dNTPs 1. mu.L, 10. mu. mol/L primer F/R1. mu.L and 10ng DNA template (S1, S2, S3, S4, S5);
(2) and the optimized PCR system: each 25. mu.L reaction system contained 25mM MgCl 24. mu.L, 1U Taq enzyme, 10mM each dNTPs 1. mu.L, 10. mu. mol/L primer 27F/1492R 1. mu.L, and 10ng DNA template (S1, S2, S3, S4, S5). 100 ng/. mu.L bovine serum albumin BSA 1. mu.L;
(3) the amplification primer adopts a full-length amplification primer of a bacterial 16S region, and has the following sequence:
27F：AGAGTTTGATCCTGGCTCAG；
1492R：GGYTACCTTGTTACGACTT；
(4) the PCR amplification reaction program comprises: pre-denaturation at 95 ℃ for 3 min; denaturation at 94 ℃ for 30sec, annealing at 56 ℃ for 30sec, and extension at 72 ℃ for 45sec for 35 cycles; finally, extending for 5min at 72 ℃; storing the amplification product at 4 ℃;
(5) and detecting a PCR amplification product: detecting the size of the PCR amplification product fragment by using 1% agarose gel electrophoresis.
6. The method for efficiently amplifying microbial DNA from a soil sample according to claim 1, wherein: the qPCR verification step in the step 5 is as follows:
(1) qPCR reaction system: each 20. mu.L reaction contained 2 × AceQ Universal SYBR QPCR MasterMix 10ul, 0.4. mu.L each of 10uM primers 27F/1492R, and 10ng of DNA template (S1, S2, S3, S4, S5). BSA 1. mu.L (BSA with concentration gradient 50 ng/. mu.L, 100 ng/. mu.L, 200 ng/. mu.L, 500 ng/. mu.L, 1000 ng/. mu.L, 2000 ng/. mu.L);
(2) qPCR reaction procedure: pre-denaturation at 95 ℃ for 3 min; denaturation at 95 ℃ for 30S, annealing at 56 ℃ for 30S, and extension at 72 ℃ for 45S (fluorescence collection), for 40 cycles;
(3) and analyzing the detection result: the qPCR amplification effect was best at a BSA concentration of 100 ng/. mu.L.
7. The method for efficiently amplifying microbial DNA from a soil sample according to claim 1, wherein: the qPCR verification step in the step 6 is as follows:
(1) qPCR reaction system: each 25. mu.L reaction contained 12.5. mu.L of 2 × AceQ Universal SYBR QPCR MasterMix, 0.5. mu.L of each 10uM primer 27F/1492R, and 10ng of DNA template (C1, C2, C3, C4, C5). BSA 1u L (BSA set concentration gradient 0 ng/. mu.L, 50 ng/. mu.L, 100 ng/. mu.L);
(2) qPCR reaction procedure: pre-denaturation at 95 ℃ for 3 min; denaturation at 95 ℃ for 30S, annealing at 56 ℃ for 30S, and extension at 72 ℃ for 45S (fluorescence collection), for 40 cycles;
(3) and analyzing the detection result: the addition of BSA in the PCR system does not affect the amplification effect of normal samples.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202010566375.XA CN111733219A (en) | 2020-06-19 | 2020-06-19 | Method for efficiently amplifying microbial DNA from soil sample |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202010566375.XA CN111733219A (en) | 2020-06-19 | 2020-06-19 | Method for efficiently amplifying microbial DNA from soil sample |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN111733219A true CN111733219A (en) | 2020-10-02 |
Family
ID=72650375
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202010566375.XA Pending CN111733219A (en) | 2020-06-19 | 2020-06-19 | Method for efficiently amplifying microbial DNA from soil sample |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN111733219A (en) |
Citations (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| TW200535244A (en) * | 2004-04-19 | 2005-11-01 | Univ Nat Cheng Kung | Polymerase chain reaction solution and application thereof |
| JP2006067890A (en) * | 2004-09-01 | 2006-03-16 | Shigeji Ikeda | Method for extracting nucleic acid and nucleic acid-extracting kit |
| CN103074329A (en) * | 2013-02-04 | 2013-05-01 | 首都师范大学 | Enhancing method for polymerase chain reaction |
| CN103911364A (en) * | 2013-01-07 | 2014-07-09 | 中国中医科学院中药研究所 | Special herb PCR reaction strengthening agent |
| CN104328170A (en) * | 2014-10-24 | 2015-02-04 | 福建师范大学 | PCR (polymerase chain reaction) reaction solution and kit, and PCR method |
| CN107771938A (en) * | 2016-08-29 | 2018-03-09 | 本溪木兰花乳业有限责任公司 | One kind zero adds yoghurt and its preparation technology |
-
2020
- 2020-06-19 CN CN202010566375.XA patent/CN111733219A/en active Pending
Patent Citations (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| TW200535244A (en) * | 2004-04-19 | 2005-11-01 | Univ Nat Cheng Kung | Polymerase chain reaction solution and application thereof |
| JP2006067890A (en) * | 2004-09-01 | 2006-03-16 | Shigeji Ikeda | Method for extracting nucleic acid and nucleic acid-extracting kit |
| CN103911364A (en) * | 2013-01-07 | 2014-07-09 | 中国中医科学院中药研究所 | Special herb PCR reaction strengthening agent |
| CN103074329A (en) * | 2013-02-04 | 2013-05-01 | 首都师范大学 | Enhancing method for polymerase chain reaction |
| CN104328170A (en) * | 2014-10-24 | 2015-02-04 | 福建师范大学 | PCR (polymerase chain reaction) reaction solution and kit, and PCR method |
| CN107771938A (en) * | 2016-08-29 | 2018-03-09 | 本溪木兰花乳业有限责任公司 | One kind zero adds yoghurt and its preparation technology |
Non-Patent Citations (2)
| Title |
|---|
| 李生斌: "《人类DNA遗传标记》", 31 May 2000, 人民卫生出版社 * |
| 潘明 等: "浓香型大曲中微生物总DNA的PCR优化", 《中国酿造》 * |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Demergasso et al. | Molecular characterization of microbial populations in a low-grade copper ore bioleaching test heap | |
| Schuurman et al. | Prospective study of use of PCR amplification and sequencing of 16S ribosomal DNA from cerebrospinal fluid for diagnosis of bacterial meningitis in a clinical setting | |
| EP2341151B1 (en) | Methods for determining sequence variants using ultra-deep sequencing | |
| Mohapatra et al. | Tracking the prokaryotic diversity in acid mine drainage-contaminated environments: a review of molecular methods | |
| CN101717815B (en) | Legionnella rapid detecting and parting method | |
| JP2003516710A (en) | Nucleic acid detection method | |
| Desneux et al. | Comparison of DNA extraction kits and modification of DNA elution procedure for the quantitation of subdominant bacteria from piggery effluents with real‐time PCR | |
| CN104830993A (en) | High-throughput typing technique universal to various molecular markers | |
| Zhang et al. | Application of real-time PCR to monitor population dynamics of defined mixed cultures of moderate thermophiles involved in bioleaching of chalcopyrite | |
| CN102304559B (en) | Fluorescence quantitative polymerase chain reaction (PCR) method for detecting bacillus coagulans quickly | |
| WO2017147946A1 (en) | High-throughput sequencing method for methylated cpg island in trace dna | |
| CN104894233B (en) | A kind of multisample multiple clips DNA methylation high-flux sequence method | |
| Hu et al. | Comparative metagenomics reveals microbial community differentiation in a biological heap leaching system | |
| CN101712953A (en) | DNA extracting method for evaluating community diversity of the intestinal microorganisms of animals | |
| Wang et al. | Improving PCR and qPCR detection of hydrogenase A (hyd A) associated with Clostridia in pure cultures and environmental sludges using bovine serum albumin | |
| CN111154847A (en) | Rapid nucleic acid extraction sequencing identification method based on bacterial 16S rDNA sequence | |
| CN111733219A (en) | Method for efficiently amplifying microbial DNA from soil sample | |
| Tiquia et al. | Bacterial diversity in livestock manure composts as characterized by terminal restriction fragment length polymorphisms (T-RFLP) of PCR-amplified 16S rRNA gene sequences | |
| CN104480103B (en) | A kind of extracting method of edaphon genome | |
| CN110628920A (en) | Fluorescence labeling multiplex amplification kit for 35 STR loci of human Y chromosome and application thereof | |
| Quatrini et al. | Biomolecular and cultivation tools | |
| CN112899382B (en) | Detection method for identifying amycolatopsis | |
| JP3628232B2 (en) | Microorganism identification method, microorganism identification device, method for creating a database for microorganism identification, and recording medium on which a microorganism identification program is recorded | |
| CN102209794A (en) | Method for the specific detection of low abundance rna species in a biological sample | |
| Mill et al. | Profiling DNA methylation from small amounts of genomic DNA starting material: efficient sodium bisulfite conversion and subsequent whole-genome amplification |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| RJ01 | Rejection of invention patent application after publication | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20201002 |