CN104830993A - High-throughput typing technique universal to various molecular markers - Google Patents
High-throughput typing technique universal to various molecular markers Download PDFInfo
- Publication number
- CN104830993A CN104830993A CN201510307506.1A CN201510307506A CN104830993A CN 104830993 A CN104830993 A CN 104830993A CN 201510307506 A CN201510307506 A CN 201510307506A CN 104830993 A CN104830993 A CN 104830993A
- Authority
- CN
- China
- Prior art keywords
- target site
- typing
- hybridization
- site
- copy number
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6813—Hybridisation assays
- C12Q1/6816—Hybridisation assays characterised by the detection means
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6869—Methods for sequencing
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Microbiology (AREA)
- Immunology (AREA)
- Biotechnology (AREA)
- Molecular Biology (AREA)
- Biophysics (AREA)
- Analytical Chemistry (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses a high-throughput typing technique universal to various molecular markers and belongs to the field of molecular biology. By the use of hybrid template production of 5' terminal biotin labeling, a target area having single-nucleotide polymorphism, simple sequence repeat, insertion deletion, copy number variation and the like and containing various molecular markers and target areas such as exon and species specific single-copy areas can be subjected to capturing and gene typing; meanwhile, allele quantitative typing and precise quantitative detecting are both considered; site selection flexibility of the solution hybridization is combined with the advantages of the high-throughput sequencing technique, such as high throughput and low cost. Compared with the use of the existing molecular marker typing technique, the use of the high-throughput typing technique solves the problems such that the existing fixed-point molecular marker typing technique is available for only typing single molecular markers and unavailable for typing various markers at the same time or precisely and quantitatively detecting alleles, and production of random markers or unlabeled hybrid templates is limited.
Description
Technical field
The invention belongs to biology field, be specifically related to a kind of high-throughput, different kinds of molecules marks general typing method: HD-Marker (High-throughput Diverse Marker genotyping).
Background technology
Molecule marker is the polymorphism mark that deoxyribonucleotide (DNA) molecule causes due to base insertion, disappearance, restructuring, sudden change etc., to be widely deployed at present and the molecule marker type applied has single nucleotide polymorphism (Single Nucleotide Polymorphism, SNP), simple repeated sequence (Simple Sequence Repeats, SSR), insertion and deletion (Insertion and deletion, Indel), copy number variation (Copy number variation, CNV), the special single copy region of species etc.These molecule markers have Numerous, comprehensive covering gene group, the good characteristics such as polymorphism is high, genetic information rich content, at genetic map construction, whole-genome association, population genetic Epidemiological Analysis, multiple fields such as grand genome research and species abundance detection are widely used.Utilizing typing method in experiment sample, to carry out to candidate molecular marker the basic methods that allelic gene typing, copy number variation and species abundance detection by quantitative are application molecule marker, is also the hot issue that investigator pays close attention to always.
In recent years along with the development of chip technology and updating of new-generation sequencing technology, the high-pass typing technology for candidate molecular marker continues to bring out.The technology be widely used at present has the hybrid capture classification system based on chip, and by the technology that high-flux sequence combines with solution hybridization, what utilize molecular inversion probes catches classification system etc.These detection systems respectively have quality in analyzable labeling pattern, capture rate and specificity, somatotype flux etc., and investigator generally needs to select available classification system according to the research of oneself.But also there is obvious defect and deficiency in these technology.On the one hand, existing technology can only to the molecule marker of single type, as mononucleotide polymorphic site or microsatellite locus etc. carry out somatotype, cannot realize a kind of technology catching and the general somatotype of different kinds of molecules mark different lengths scope target area.On the other hand, existing candidate locus capture technique can only be accomplished, to the genotype qualitative detection of polymorphic site, cannot accomplish quantitative analysis.
Tracing it to its cause, is first due to the limitation of prior art in hybridization Template preparation.Current technology adopts random vitamin H to hybridize template mark method mostly, and vitamin H exists larger sterically hindered, for longer object fragment, is difficult to accomplish that upstream and downstream probe is hybridized successfully simultaneously, thus cannot realizes catching of longer object fragment.Some technology is in order to avoid this problem, direct use non-marked DNA is as hybridization template, but the new problem caused is that the organic efficiency in target fragment enrichment is not high, follow-up needs are by increasing polymerase chain reaction (Polymerase Chain Reaction, PCR) amplification cycles number just can obtain enough library samples, and the homogeneity in site is caught in impact.Therefore, the length range in the most fixed trapped region of prior art, can only to single type molecule marker, as mononucleotide polymorphic site or microsatellite locus carry out somatotype, cannot realize the general somatotype that a kind of technology marks different kinds of molecules, this makes investigator when attempting analyzing same laboratory sample broad variety molecule marker, has to attempt multiple classification system, thus add experimental cost and time, have a strong impact on somatotype efficiency and research progress.The more important thing is, existing candidate locus catches typing method owing to being subject to hybridization efficiency and the impact of catching homogeneity, qualitative detection can only be carried out to the allelic gene type of polymorphic site, special single copy region quantitative analysis of different plant species in the copy number that such as copy number makes a variation and sample cannot be accomplished, limit the application of candidate locus capture technique in copy number variation detection, species identification and the analysis of grand genome species abundance.
In view of the above-mentioned defect of prior art, need a kind of high-throughput badly, low cost, flexible, different kinds of molecules mark general typing method, carry out qualitative analysis and the detection by quantitative of differing molecular labeling pattern, to solve the limitation of prior art.
Summary of the invention
The object of the invention is to develop the typing method that a kind of novel high flux, broad variety molecule marker are general: HD-Marker(High-throughput Diverse Marker genotyping), to make up the above-mentioned deficiency of prior art.
To achieve these goals, the present invention adopts following technical proposals to be achieved:
Novel high flux, different kinds of molecules mark a general typing method, it is characterized in that according to lower step:
1) preparation of 5 ' terminal biotin mark hybridization template: extract sample gene group DNA, and being limited property endonuclease digestion, utilize the primer (being synthesized by Shanghai Sheng Gong biotechnology company limited) of 5 ' terminal biotin mark to carry out polymerase chain amplification reaction to endonuclease bamhi, the template obtaining 5 ' terminal biotin mark after purifying is for subsequent use;
2) target site for molecule marker somatotype screens: need and known sequence information according to research, the molecule marker of screening containing the polymorphic sites such as mononucleotide polymorphic site, microsatellite locus, insertion and deletion or copy number variation or exon region are as target site, wherein choose the polymorphic sites such as mononucleotide polymorphic site, microsatellite locus and insertion and deletion mainly for the qualitative detection of polymorphic site allelic gene typing, choose copy number variation polymorphic site and mainly detect for site copy number object quantitative analysis;
3) target site detected for grand genome analysis and species abundance screens: choose the candidate's species genome specific list contained in sample and copy region as target site, carry out the quantitative analysis of Special Thing wealth of species detect for these regions;
4) preparation of locus specificity hybridization probe: first according to the flanking sequence of target site, design two sequences: locus specificity capture probe 1(locus specificity capture probe 1) and locus specificity capture probe 2(locus specificity capture probe 2), article two, the interval region between probe can adjust flexibly according to different target sites, the probe of design is meeting on general primer principle of design basis, also need guanine and the cytosine content of taking into account target site interval region, control between 45%-65%.Obtain locus specificity capture probe 1 mixture after being mixed by many locus specificity capture probes 1 designed, many locus specificity capture probes 2 designed to be mixed and after 5 ' phosphorylation to obtain locus specificity capture probe 2 mixture for subsequent use;
5) target site hybrid capture: for subsequent use according to the configuration hybridization buffer optimized, the probe mixture comprising multipair locus specificity capture probe 1/ locus specificity capture probe 2 by described and the good hybridization template of end mark with mix in hybridization buffer after hybridize, catch and obtain target site, use magnetic bead to carry out enrichment to target site afterwards.
6) target site interval region extends connection: the extension ligation described hybridization adsorbed product being carried out different lengths scope, obtains the polymorphic DNA fragment in different target site;
7) sequencing library preparation and high-flux sequence: use the amplimer supporting with the order-checking platform of American I llunima company to increase to the target site obtained, obtain sequencing library after purifying.According to the length range in the different target site of catching, select different order-checking to read long order-checking platform flexibly and carry out high-flux sequence;
8) molecule marker somatotype or sequence abundances detect: use RADtyping somatotype software package to analyze sequencing data, obtain the abundance quantitative information of different plant species in target site polymorphic allele somatotype information, copy number variation copy information of number or institute's analytic sample.
Further optimization to technical scheme: invented hybridization template 5 ' terminal biotin marking method in described step (1), namely restriction enzyme EcoRI and MseI is first used to carry out double digestion to genomic dna, utilize the primer of 5 ' terminal biotin mark to increase afterwards, the hybridization template obtained after purifying is the DNA of 5 ' terminal biotin mark.
Further optimization to technical scheme: the current techique having invented different kinds of molecules mark united typing in described step (2).This technology can, according to the information in different research needs and sequence library, realize catching and gene type plurality of target sequence.Not only can accomplish that the molecule marker target area of the different lengths scopes such as mononucleotide polymorphic site, microsatellite locus, insertion and deletion is caught, but also can to the specific sequence capturing of exon region and gene type.
Further optimization to technical scheme: achieve the copy number accurate quantitative analyses to polymorphism marks such as copy number variations in described step (2), if namely target area is copy number variation, can accomplish that the copy number accurate quantification do not waited from 1 to 10 detects.
Further optimization to technical scheme: the species abundance in grand genome analysis described in described step (3) detects, if sample to be analyzed is the several species biased sample of grand genomic source, target area is that the species specific list of material standed for copies region, by analyzing the depth information of catching the different plant species distinguished sequence obtained, the abundance situation of corresponding species in sample can be obtained.
Further optimization to technical scheme: the principle of design of locus specificity hybridization probe described in described step (4), require that the guanine in probe itself and probe separation region and cytosine content are all limited between 45%-65%, strict target site screening criteria, ensure that, when interval region longer (100-500 base pair), multiple site is caught simultaneously and extended amplification still has good homogeneity.
Further optimization to technical scheme: the hybridization buffer that described in described step (5), target site hybrid capture is used.1 × Hybridization Buffer liquid formula of 1L volume is: 0.1g ficoll, 0.1g foetal calf serum, 5g sodium lauryl sulphate, 75mmol trisodium citrate, 0.75mol sodium-chlor, and all the other are distilled water, pH 7.0.
Hybridization buffer after optimization ensure that specificity, high efficiency and homogeneity that hybrid capture is tested, not only can realize the hybrid capture of different kinds of molecules mark, is also the gordian technique main points ensureing to reach copy number and species abundance accurate quantification simultaneously.
A kind of novel high flux of the present invention, different kinds of molecules mark general typing method, and the high-throughput gene type and the accurate quantification that are applicable to the broad variety molecule marker/target areas such as mononucleotide polymorphic site, microsatellite locus, insertion and deletion, copy number variation, exon, the special single copy region of species detect.
Compared with existing molecule marker typing method, advantage of the present invention and positively effect are: can only carry out somatotype to single molecule marker for existing sentinel molecule mark typing method, multiple mark somatotype simultaneously can not be realized simultaneously, cannot detect allelotrope accurate quantification, the problem such as random labelling or the hybridization Template preparation limitation that do not mark, this invention exploits a kind of novel high flux, different kinds of molecules marks general typing method: HD-Marker.The outstanding feature of this technology is the hybridization method for preparing template that employing 5 ' terminal biotin marks, can realize comprising the target area of dissimilar molecule marker and catching and gene type of the target area such as exon, the special single copy region of species to mononucleotide polymorphic site, microsatellite locus, insertion and deletion, copy number variation etc., the qualitative somatotype of allelotrope can be taken into account and accurate quantification detects simultaneously, be selected in the site of solution hybridization technology handiness and high throughput sequencing technologies flux is high, cost is low advantage to combine.
Compared with prior art, its principle is rationally reliable in the present invention, the easily control of processing step safety, reliable running of large-scale screening, and excellent effect can be widely used in basis on a large scale with practical study.
Embodiment
Below in conjunction with embodiment, technical scheme of the present invention is described in further detail.
Embodiment 1
The invention provides a kind of novel high flux, different kinds of molecules mark general typing method HD-Marker, with chlamys farreri (
chlamys farreri) genome microsatellite locus somatotype is that example is described.The present embodiment, with 1 chlamys farreri individuality, 33 microsatellite locus, 10 mononucleotide polymorphic sites and 5 copy number variant sites, repeats experiment for twice and describes technical scheme of the present invention in detail for example enforcement by experiment.
A kind of novel high flux of the present invention, different kinds of molecules mark general typing method HD-Marker and specifically comprise the following steps:
1, extract scallop genomic dna, carry out biotin labeled primer amplification after digestion with restriction enzyme, method is as follows:
1) scallop (Chlamys farreri) group DNA is extracted: the closed shell flesh getting chlamys farreri individuality is about 0.1g, adds 500 μ l lysis buffer (sodium-chlor: 100mM; Tris hydrochloric acid: 10nM, pH=8.0; Ethylenediamine tetraacetic acid (EDTA): 1Mm, pH=8.0), shred, then add the sodium lauryl sulphate of 50 μ l 10%, and 5 μ l Proteinase Ks (20mg/ml, precious biotechnology company limited), 56 DEG C of water-bath digestion, to the complete cracking of tissue pieces, lysate is clarified.Add the saturated phenol of equal-volume (250 μ l) and chloroform/primary isoamyl alcohol (24:1) (250 μ l), extracting 3 times, get supernatant liquor, add equal-volume chloroform/primary isoamyl alcohol (24:1) (500 μ l) extracting 1 time, get supernatant liquor, add 1/10 volume sodium-acetate (3M, pH 5.2) (50 μ l) and 2 times of volumes-20 DEG C of preservations dehydrated alcohol (1000ul), slowly shake up;-20 DEG C precipitate 30 minutes, and 12000 revs/min centrifugal 10 minutes, and nucleic acid will be deposited at the bottom of pipe.(1000ul) washing precipitation of 70% ethanol is also dried to ethanol and all volatilizees, and add 100 μ l sterilized waters and a small amount of (1-2 μ l) RNaseA, 4 DEG C of Refrigerator stores are for subsequent use.
2) digestion with restriction enzyme of genomic dna: the enzyme system of cutting is 20ul, comprise 200ng genomic dna, 5U EcoRI restriction enzyme (Beijing Niu Yinglun Bioisystech Co., Ltd), 1U Mse I restriction enzyme (Beijing Niu Yinglun Bioisystech Co., Ltd), 1 × enzyme cutting buffering liquid (Beijing Niu Yinglun Bioisystech Co., Ltd); 37 DEG C of incubations after 2 hours 4 DEG C save backup.
3) joint connects: linked system is 20uL: comprise on 10 μ l and walk digestion products, 4 μMs of EcoRI joints (Shanghai Sheng Gong biotechnology company limited), 4 μMs of Mse I joints (Shanghai Sheng Gong biotechnology company limited), 2U T4 DNA ligase (Beijing Niu Yinglun Bioisystech Co., Ltd), 1 × enzyme cutting buffering liquid (Beijing Niu Yinglun Bioisystech Co., Ltd), 16 DEG C of connections are spent the night.
4) amplification reaction system is 20uL, comprise 50ng joint and connect product, the biotin labeled EcoRI-P1 primer of 2uM (Shanghai Sheng Gong biotechnology company limited), 2uM Mse I-P2 primer (Shanghai Sheng Gong biotechnology company limited), 6mM deoxyribonucleotide (Shanghai Sheng Gong biotechnology company limited), 1U surpasses fidelity Phusion DNA polysaccharase (Beijing Niu Yinglun Bioisystech Co., Ltd), 1 × super fidelity Phusion DNA polysaccharase (Beijing Niu Yinglun Bioisystech Co., Ltd); Reaction conditions is 98 DEG C of sex change 5 seconds, anneals 20 seconds for 60 DEG C, and 72 DEG C extend 10 seconds, carry out 10-14 circulation, and last 72 DEG C extend 5 minutes.Parallel amplification 3 is managed, and amplified production 1.5% agarose gel electrophoresis detects, and utilize amplified production purification kit (the Shanghai biological company limited of triumphant outstanding person) to reclaim purifying amplified production, 4 DEG C of Refrigerator stores are for subsequent use.
2, the preparation of site-specific primer mixture, method is as follows:
1) site-specific primer is designed: in order to verify validity of the present invention, the present embodiment chooses chlamys farreri 33 microsatellite locus delivered, 10 mononucleotide polymorphic sites and 5 copy number variant sites, two hybridization probe locus specificity capture probes 1 and locus specificity capture probe 2 is designed according to its flanking sequence, for site CFAD157
CFAD157 locus specificity capture probe 1:5'ctctatgggcagtcggtgTCTTTCCATCCCATACATTG3'(SEQ ID No:1);
CFAD157 locus specificity capture probe 2:5'TTATATTTACTTGTTCCCACTGcactgacctcaagtctgca3'(SEQ ID No:2)
Described primer sites specificity capture probe 1 comprises 3 ' the locus specificity sequence of holding 1 and the 5 ' universal primer sequence held (Slx-1ST-MpPrimer-1) two portions, wherein 3 ' the SP1 held is the sequence with target site one section of flanking sequence 22 base complementrities, and the 5 ' sequence of holding is the partial sequence of universal primer Slx-1ST-MpPrimer-1.
Described primer sites specificity capture probe 2 comprises 5 ' the locus specificity sequence of holding 2 and the 3 ' universal primer sequence held (Slx-1ST-MpPrimer-2-RC) two portions, wherein 5 ' the locus specificity sequence 2 of holding is the sequence with target site opposite side flanking sequence 22 base complementrities, and 3 ' end is the part reverse complementary sequence of universal primer Slx-1ST-MpPrimer-2.
Described primer sites specificity capture probe 1 and locus specificity capture probe 2 sequence (for site CFAD157) as follows:
CFAD157 locus specificity capture probe 1:5'ctctatgggcagtcggtgTCTTTCCATCCCATACATTG3'(SEQ ID No:1);
CFAD157 locus specificity capture probe 2:5'TTATATTTACTTGTTCCCACTGcactgacctcaagtctgca3'(SEQ ID No:2)
X in described locus specificity capture probe 1 and locus specificity capture probe 2 is respectively site-specific primer 1 and site-specific primer 2, concrete sequence is different because site sequence is different, and 5 ' end known array of described locus specificity capture probe 1 and 3 ' of locus specificity capture probe 2 holds the check order universal sequencing primer thing of platform of known array and American I llumina company identical.
Described locus specificity sequence 1 and locus specificity sequence 2 design of primers also follow following principle: 1, other mutational sites can not be contained in the position at locus specificity sequence 1 and locus specificity sequence 2 place; 2, can not there are more than 5 the identical bases of continuous print in locus specificity sequence 1 and the position sequence at locus specificity sequence 2 place; 3, the length of locus specificity sequence 1 and locus specificity sequence 2 is generally decided to be 22 bases, and for indivedual microsatellite locus, in order to meet the needs of annealing temperature, the length of locus specificity sequence 1 and locus specificity sequence 2 can fluctuate between 20-24 base; 4, the annealing temperature of locus specificity sequence 1 and locus specificity sequence 2 is between 55-65 DEG C; 5, the interval region guanine of locus specificity capture probe 1 and locus specificity capture probe 2 and cytosine content are between 45%-65%; Annealing temperature adopts online software OligoCalc (http://www.basic.northwestern.edu/biotools/oligocalc. html) to calculate, and selects 2Salt Adjusted parameter.The primer sites specificity capture probe 1 designed and locus specificity capture probe 2 are synthesized by Shanghai Sheng Gong biotechnology company limited.6, the length of locus specificity sequence 1 and locus specificity sequence 2 is generally decided to be 22 bases, and for indivedual microsatellite locus, for meeting the needs of annealing temperature, the length of locus specificity sequence 1 and locus specificity sequence 2 can 20-24 base fine setting.
2) multidigit point primer mixture is prepared: by locus specificity capture probe 1 balanced mix of multiple target site, obtain locus specificity capture probe 1 mixture; After locus specificity capture probe 2 balanced mix of multiple target site, locus specificity capture probe 2 mixture obtained is carried out 5 ' phosphorylation, reaction volume is 50ul, comprise 62.5uM mixture, 10U T4 polynueleotide kinase (Beijing Niu Yinglun Bioisystech Co., Ltd), 1 × T4 connects damping fluid (Beijing Niu Yinglun Bioisystech Co., Ltd); 37 DEG C of incubations 30 minutes, by locus specificity capture probe 2 mixture phosphorylation, 65 DEG C of incubations, 20 minutes deactivation T4 polynueleotide kinases.By locus specificity capture probe 1 mixture and locus specificity capture probe 2 mixture diluted to proper concn ,-20 DEG C of Refrigerator stores are for subsequent use.
3, site-specific primer hybridization and magnetic bead absorption, method is as follows:
1) balance of magnetic bead: affine for wetting ability Streptomycin sulphate magnetic bead (Beijing Niu Yinglun Bioisystech Co., Ltd) is shaken up gently, sucking-off 5ul is in Eppendorf tube, be placed on magnetic frame and leave standstill 2 minutes, suck supernatant, with 30ul 1 × hybridization solution, (formula of 1L 1 × hybridization solution is 0.1g ficoll, 0.1g foetal calf serum, 5g sodium lauryl sulphate, 75mmol trisodium citrate, 0.75mol sodium-chlor, all the other are distilled water, pH 7.0) carefully wash once, on magnetic frame, leave standstill 2 minutes at the end of each washing, suck supernatant liquor.For subsequent use after washing.
2) site-specific primer adsorbs with genomic DNA hybridization and magnetic bead: reacting cumulative volume is 50uL, (1 × Hybridization Buffer liquid formula of 1L volume is: 0.1g ficoll to comprise 1 × hybridization solution, 0.1g foetal calf serum, 5g sodium lauryl sulphate, 75mmol trisodium citrate, 0.75mol sodium-chlor, all the other are distilled water, pH 7.0), 250nM locus specificity capture probe 1 primer mixture, locus specificity capture probe 2 primer mixture of 250nM 5 ' phosphorylation, the biotin labeled genomic dna of 200ng, the magnetic bead of 10ul wash-out/binding buffer liquid (Beijing Niu Yinglun Bioisystech Co., Ltd) is suspended in after balance.
Hybridization carries out in amplification instrument, and reaction conditions is: 70 DEG C 12 minutes (later each circulation subtracts 2 DEG C), 69 DEG C 12 minutes (later each circulation subtracts 2 DEG C), after carrying out 20 circulations, keeps 30 DEG C, ensures that whole hybridization carries out at least 16 hours.
3) hybrid product washing: after hybridization and magnetic bead adsorb, fix magnetic bead with magnet stand, leave standstill 2 minutes, suck hybrid mixed liquid.By 50ul solution I, (formula of 1L solution I is 5g sodium lauryl sulphate, 30mmol trisodium citrate, 0.3mol sodium-chlor, all the other are distilled water, pH 7.0) washing magnetic bead is once, (formula of 1L solution I is 30mmol trisodium citrate to use 50ul solution II again, 0.3mol sodium-chlor, all the other are distilled water, pH 7.0) washing magnetic bead is once, to remove unnecessary locus specificity capture probe 1 mixture and locus specificity capture probe 2 mixture, obtain pure hybridization adsorbed product.
4, the acquisition of target DNA fragment
1) locus specificity extends ligation: reaction volume is approximately 50uL, comprise step and wash the hybridization adsorbed product obtained, 1U surpasses fidelity dna polysaccharase (Beijing Niu Yinglun Bioisystech Co., Ltd), 80U DNA ligase enzyme (Taq DNA ligase enzyme, Beijing Niu Yinglun Bioisystech Co., Ltd), 1 × high-fidelity damping fluid (Beijing Niu Yinglun Bioisystech Co., Ltd), 5mM deoxyribonucleotide, 1mM β-Reduced nicotinamide-adenine dinucleotide; 45 DEG C are reacted 15 minutes.
2) wash-out of target DNA fragment: after connection extension terminates, by 50uL solution III, (formula of 1L solution III is 1.576g Tris hydrochloric acid, all the other are distilled water, pH 8.5) washing 1 time after, the reaction product be adsorbed on magnetic bead be resuspended in 35uL sterilized water, 95 DEG C of incubations 1 minute, after fixing magnetic bead with magnetic frame, in absorption, honest and upright and thrifty 30ul is in Eppendorf tube, obtains amplified reaction template.
5, universal primer one takes turns amplification and object fragment amplification:
Amplimer is Slx-1ST-MpPrimer-1 and Slx-1ST-MpPrimer-2.
Slx-1ST-MpPrimer-1：
5'ACACTCTTTCCCTACACGACGCTCTCTCTATGGGCAGTCGGTG3'（SEQ ID No：7）。
Slx-1ST-MpPrimer-2：
5'GTGACTGGAGTTCAGACGTGTGCTCTGCTGTACGGCCAAGGCG3'（SEQ ID No：8）。
Amplification reaction system is 50uL: comprise 30uL reaction template, 5uM Slx-1ST-MpPrimer-1 primer, 5uM Slx-1ST-MpPrimer-2 primer, 15mM deoxyribonucleotide, 1U surpasses fidelity Phusion DNA polysaccharase (Beijing Niu Yinglun Bioisystech Co., Ltd), 1 × super fidelity Phusion DNA polymerase buffer; Reaction conditions is 98 DEG C of sex change 5 seconds, anneals 20 seconds for 60 DEG C, and 72 DEG C extend 10 seconds, carry out 17-20 circulation, and last 72 DEG C extend 5 minutes.Amplified production 1.5% agarose gel electrophoresis detects, and amplified production size is about 90 base pairs, cuts glue and reclaims amplified production.
6, barcode primer amplified is carried out to the object fragment reclaimed:
In order to realize multiple individuality mixing sequencing and typing, can distinguish by adding different barcodes to each individuality, utilizing the different primers of reaction to introduce different barcodes.
Described amplimer sequence is as follows:
Slx-2ND-MpPrimer:5'AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCT 3'（SEQ ID No：9）；
Slx-index-Barcode:5'CAAGCAGAAGACGGCATACGAGATXXXXXXGTGACTGGAGTTCAGACGTGTGCT 3'（SEQ ID No：10）；
XXXXXX in described Slx-index-Barcode is bar code sequence, for the differentiation of different sample.The base of different barcode is different.
Amplification reaction system is 20uL, comprise 25ng mono-and take turns amplification purification product, 2uM Slx-2ND-MpPrimer primer, 2uM Slx-index-Barcode primer, 6mM deoxyribonucleotide, 1U surpasses fidelity Phusion DNA polysaccharase (Beijing Niu Yinglun Bioisystech Co., Ltd), 1 × super fidelity Phusion DNA polymerase buffer; Reaction conditions is 98 DEG C of sex change 5 seconds, anneals 20 seconds for 60 DEG C, and 72 DEG C extend 10 seconds, carry out 17-20 circulation, and last 72 DEG C extend 5 minutes.Parallel amplification 3 is managed, and amplified production 1.5% agarose gel electrophoresis detects, and amplified production size is about 140 base pairs, utilizes Product Purification Kit (Shanghai Kai Jie Bioisystech Co., Ltd) to reclaim purifying amplified production.Utilize the order-checking platform of American I llumina company to check order, this part completes by by order-checking company.
6, data analysis:
Utilize RADtyping software package analytical data, somatotype is carried out to 33 microsatellite locus repeating for twice to test and 5 copy number variant sites.For microsatellite locus, analyze allelic gene type, for copy number variant sites, analyze copy number.
7, validation verification:
In order to verify validity of the present invention, HD-Marker somatotype is carried out to the data repeating to test acquisition for twice of 33 microsatellite locus of 1 chlamys farreri, 10 mononucleotide polymorphic sites and 5 copy number variant sites.The detection efficiency of experimental result display HD-Marker loci can reach 98.5%, and the somatotype rate in site reaches 95.2%, and the somatotype concordance rate repeating for twice to test reaches more than 99%.Therefore, fully demonstrating present method can carry out somatotype to different kinds of molecules mark fast and efficiently, can realize simultaneously to the allelic somatotype of multiple microsatellite locus and copy number variation copy number object accurate analysis.
The primer sequence table related in table 1 the present invention
* because number of sites is more, here chlamys farreri two microsatellite locus and the locus specificity capture probe 1 of 1 mononucleotide polymorphic site and the sequence information of locus specificity capture probe 2 is only listed, wherein lower-case portion is universal sequence, and upper-case portion is locus specificity sequence.
The present embodiment has that flux is high, flexible, different kinds of molecules marks general feature, and the allelic gene typing and the accurate quantification that are applicable to multiple candidate molecular marker detect, and in actual motion, effect reaches safely the requirement of goal of the invention.
SEQUENCE LISTING
<110> Chinese Marine University
The typing method that <120> high-throughput, broad variety molecule marker are general
<160> 1
<170> Patent In version 3.3
<210> 1
<211> 38
<212> DNA
<213> artificial sequence
<400> 1
1 CTCTATGGGC AGTCGGTGTC TTTCCATCCC ATACATTG 38
<110> Chinese Marine University
The typing method that <120> high-throughput, broad variety molecule marker are general
<160> 2
<170> Patent In version 3.3
<210> 2
<211> 41
<212> DNA
<213> artificial sequence
<400> 2
1 TTATATTTAC TTGTTCCCAC TGCACTGACC TCAAGTCTGC A 41
<110> Chinese Marine University
The typing method that <120> high-throughput, broad variety molecule marker are general
<160> 3
<170> Patent In version 3.3
<210> 3
<211> 41
<212> DNA
<213> artificial sequence
<400> 3
1 CTCTATGGGC AGTCGGTGAT TGATCAACTA TTGATTGGTA A 41
<110> Chinese Marine University
The typing method that <120> high-throughput, broad variety molecule marker are general
<160> 4
<170> Patent In version 3.3
<210> 4
<211> 37
<212> DNA
<213> artificial sequence
<400> 4
1 GAGATGTCAG TCTCACATCA CTGACCTCAA GTCTGCA 37
<110> Chinese Marine University
The typing method that <120> high-throughput, broad variety molecule marker are general
<160> 5
<170> Patent In version 3.3
<210> 5
<211> 38
<212> DNA
<213> artificial sequence
<400> 5
1 CTCTATGGGC AGTCGGTGCC CTGCGGTACT GCTTGGTG 38
<110> Chinese Marine University
The typing method that <120> high-throughput, broad variety molecule marker are general
<160> 6
<170> Patent In version 3.3
<210> 6
<211> 41
<212> DNA
<213> artificial sequence
<400> 6
1 GCTGTGGTGT CTTGCGATTG GTCACTGACC TCAAGTCTGC A 41
<110> Chinese Marine University
The typing method that <120> high-throughput, broad variety molecule marker are general
<160> 7
<170> Patent In version 3.3
<210> 7
<211> 43
<212> DNA
<213> artificial sequence
<400> 7
1 ACACTCTTTC CCTACACGAC GCTCTCTCTA TGGGCAGTCG GTG 43
<110> Chinese Marine University
The typing method that <120> high-throughput, broad variety molecule marker are general
<160> 8
<170> Patent In version 3.3
<210> 8
<211> 43
<212> DNA
<213> artificial sequence
<400> 8
1 GTGACTGGAG TTCAGACGTG TGCTCTGCTG TACGGCCAAG GCG 43
<110> Chinese Marine University
The typing method that <120> high-throughput, broad variety molecule marker are general
<160> 9
<170> Patent In version 3.3
<210> 9
<211> 48
<212> DNA
<213> artificial sequence
<400> 9
1 AATGATACGG CGACCACCGA GATCTACACT CTTTCCCTAC ACGACGCT 48
<110> Chinese Marine University
The typing method that <120> high-throughput, broad variety molecule marker are general
<160> 10
<170> Patent In version 3.3
<210> 10
<211> 51
<212> DNA
<213> artificial sequence
<400> 10
1 CAAGCAGAAG ACGGCATACG AGATAACCTG GTGACTGGAG TTCAGACGTG T 51。
SEQUENCE LISTING
<110> Chinese Marine University
The typing method that <120> high-throughput, broad variety molecule marker are general
<160> 1
<170> Patent In version 3.3
<210> 1
<211> 38
<212> DNA
<213> artificial sequence
<400> 1
1 CTCTATGGGC AGTCGGTGTC TTTCCATCCC ATACATTG 38
<110> Chinese Marine University
The typing method that <120> high-throughput, broad variety molecule marker are general
<160> 2
<170> Patent In version 3.3
<210> 2
<211> 41
<212> DNA
<213> artificial sequence
<400> 2
1 TTATATTTAC TTGTTCCCAC TGCACTGACC TCAAGTCTGC A 41
<110> Chinese Marine University
The typing method that <120> high-throughput, broad variety molecule marker are general
<160> 3
<170> Patent In version 3.3
<210> 3
<211> 41
<212> DNA
<213> artificial sequence
<400> 3
1 CTCTATGGGC AGTCGGTGAT TGATCAACTA TTGATTGGTA A 41
<110> Chinese Marine University
The typing method that <120> high-throughput, broad variety molecule marker are general
<160> 4
<170> Patent In version 3.3
<210> 4
<211> 37
<212> DNA
<213> artificial sequence
<400> 4
1 GAGATGTCAG TCTCACATCA CTGACCTCAA GTCTGCA 37
<110> Chinese Marine University
The typing method that <120> high-throughput, broad variety molecule marker are general
<160> 5
<170> Patent In version 3.3
<210> 5
<211> 38
<212> DNA
<213> artificial sequence
<400> 5
1 CTCTATGGGC AGTCGGTGCC CTGCGGTACT GCTTGGTG 38
<110> Chinese Marine University
The typing method that <120> high-throughput, broad variety molecule marker are general
<160> 6
<170> Patent In version 3.3
<210> 6
<211> 41
<212> DNA
<213> artificial sequence
<400> 6
1 GCTGTGGTGT CTTGCGATTG GTCACTGACC TCAAGTCTGC A 41
<110> Chinese Marine University
The typing method that <120> high-throughput, broad variety molecule marker are general
<160> 7
<170> Patent In version 3.3
<210> 7
<211> 43
<212> DNA
<213> artificial sequence
<400> 7
1 ACACTCTTTC CCTACACGAC GCTCTCTCTA TGGGCAGTCG GTG 43
<110> Chinese Marine University
The typing method that <120> high-throughput, broad variety molecule marker are general
<160> 8
<170> Patent In version 3.3
<210> 8
<211> 43
<212> DNA
<213> artificial sequence
<400> 8
1 GTGACTGGAG TTCAGACGTG TGCTCTGCTG TACGGCCAAG GCG 43
<110> Chinese Marine University
The typing method that <120> high-throughput, broad variety molecule marker are general
<160> 9
<170> Patent In version 3.3
<210> 9
<211> 48
<212> DNA
<213> artificial sequence
<400> 9
1 AATGATACGG CGACCACCGA GATCTACACT CTTTCCCTAC ACGACGCT 48
<110> Chinese Marine University
The typing method that <120> high-throughput, broad variety molecule marker are general
<160> 10
<170> Patent In version 3.3
<210> 10
<211> 51
<212> DNA
<213> artificial sequence
<400> 10
1 CAAGCAGAAG ACGGCATACG AGATAACCTG GTGACTGGAG TTCAGACGTG T 51
Claims (7)
1. high-throughput, different kinds of molecules mark a general typing method, it is characterized in that according to following steps:
1) preparation of 5 ' terminal biotin mark hybridization template: extract sample gene group deoxyribonucleotide, and being limited property endonuclease digestion, utilize the primer of 5 ' terminal biotin mark to carry out polymerase chain amplification reaction to endonuclease bamhi, the template obtaining 5 ' terminal biotin mark after purifying is for subsequent use;
2) target site for molecule marker somatotype screens: need and known sequence information according to research, the molecule marker of screening containing the polymorphic sites such as mononucleotide polymorphic site, microsatellite locus, insertion and deletion or copy number variation or exon region are as target site, wherein choose the polymorphic sites such as mononucleotide polymorphic site, microsatellite locus and insertion and deletion mainly for the qualitative detection of polymorphic site allelic gene typing, choose copy number variation polymorphic site and mainly detect for site copy number object quantitative analysis;
3) target site detected for grand genome analysis and species abundance screens: choose the candidate's species genome specific list contained in sample and copy region as target site, carry out the quantitative analysis of Special Thing wealth of species detect for these regions;
4) preparation of locus specificity hybridization probe: first according to the flanking sequence of target site, design two probes: locus specificity capture probe 1 and locus specificity capture probe 2, article two, the interval region between probe can adjust flexibly according to different target sites, the probe of design is meeting on general primer principle of design basis, also need guanine and the cytosine content of taking into account target site interval region, control between 45%-65%;
Obtain locus specificity capture probe 1 mixture after being mixed by many locus specificity capture probes 1 designed, many locus specificity capture probes 2 designed to be mixed and after 5 ' phosphorylation to obtain locus specificity capture probe 2 mixture for subsequent use;
5) target site hybrid capture: for subsequent use according to the recipe configuration hybridization buffer optimized, the probe mixture comprising multipair locus specificity capture probe 1/ locus specificity capture probe 2 by described and the good hybridization template of end mark with mix in hybridization buffer after hybridize, catch and obtain target site, use magnetic bead to carry out enrichment to target site afterwards;
6) target site interval region extends connection: the extension ligation described hybridization adsorbed product being carried out different lengths scope, obtains the polymorphic DNA fragment in different target site;
7) sequencing library preparation and high-flux sequence: use the amplimer supporting with order-checking platform to increase to the target site obtained, obtain sequencing library after purifying;
According to the length range in the different target site of catching, select different order-checking to read long order-checking platform flexibly and carry out high-flux sequence;
8) molecule marker somatotype or sequence abundances detect: use RADtyping somatotype software package to analyze sequencing data, obtain the abundance quantitative information of different plant species in target site polymorphic allele somatotype information, copy number variation copy information of number or institute's analytic sample.
2. the typing method that a kind of high-throughput according to claim 1, broad variety molecule marker are general, it is characterized in that in described step (1), adopting hybridization template 5 ' terminal biotin marking method, namely restriction enzyme EcoRI and MseI is first used to carry out double digestion to genomic dna, utilize the primer of 5 ' terminal biotin mark to increase afterwards, the hybridization template obtained after purifying is the DNA of 5 ' terminal biotin mark; Effectively prevent the sterically hindered problem that random biotin labeling brings; Compared with hybridizing template mark method with existing random vitamin H, hybridization template end labelling method of the present invention effectively can solve the sterically hindered problem causing realizing longer interval region extension (100-500 base pair) because random biotin labeling brings, simultaneously, compared to cold standard hybridization template, end-labelled hybridization template is conducive to the target area that enriching and recovering is expeditiously caught, ensure that experiment success rate, improve the accessibility of operation.
3. a kind of high-throughput according to claim 1, the typing method that broad variety molecule marker is general, it is characterized in that the copy number accurate quantitative analyses achieved in described step (2) polymorphism marks such as copy number variations, if namely target area is copy number variation, can accomplish that different copy number accurate quantification detects, realize plurality of target sequence, comprise containing mononucleotide polymorphic site, microsatellite locus, the molecule marker region of the different lengths scopes such as insertion and deletion and exon region etc., carry out catching and gene type, greatly reduce somatotype cost, improve compatibility and the accessibility of experimental implementation.
4. the typing method that a kind of high-throughput according to claim 1, broad variety molecule marker are general, it is characterized in that the copy number accurate quantitative analyses achieved in described step (2) polymorphism marks such as copy number variations, compared with the qualitative analysis that can only detect allelotrope kind with existing method, this technology both can realize the allelic somatotype qualitative analysis of polymorphic site, also can accomplish that the accurate quantification of copy number number detects.
5. the typing method that a kind of high-throughput according to claim 1, broad variety molecule marker are general, it is characterized in that the accurate quantification achieving different plant species genome list copy area in sample in described step (3) detects, can be used for the species abundance analysis in grand genome analysis, if sample to be analyzed is the several species biased sample of grand genomic source, target area is that the species specific list of material standed for copies region, by analyzing the depth information of catching the different plant species distinguished sequence obtained, the abundance situation of corresponding species in sample can be obtained.
6. a kind of high-throughput according to claim 1, the typing method that broad variety molecule marker is general, it is characterized in that the design requirements probe of described step (4) middle site specific hybridization probes itself and the guanine in probe separation region and cytosine content are all limited between 45%-65%, compared with common design principle, this technology is except the consideration guanine of probe own and cytosine content, also define guanine and the cytosine content of whole target area, strict target site screening criteria, ensure that when interval region longer (100-500 base pair), multiple site is caught simultaneously and extended amplification still has good homogeneity.
7. a kind of high-throughput according to claim 1, different kinds of molecules mark general typing method, it is characterized in that 1 × Hybridization Buffer liquid formula of the hybridization buffer 1L volume that target site hybrid capture is used in described step (5) is: 0.1g ficoll, 0.1g foetal calf serum, 5g sodium lauryl sulphate, 75mmol trisodium citrate, 0.75mol sodium-chlor, all the other are distilled water, pH 7.0.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510307506.1A CN104830993B (en) | 2015-06-08 | 2015-06-08 | The general typing method of a kind of high flux, polytype molecular labeling |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510307506.1A CN104830993B (en) | 2015-06-08 | 2015-06-08 | The general typing method of a kind of high flux, polytype molecular labeling |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN104830993A true CN104830993A (en) | 2015-08-12 |
| CN104830993B CN104830993B (en) | 2017-08-18 |
Family
ID=53809188
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201510307506.1A Active CN104830993B (en) | 2015-06-08 | 2015-06-08 | The general typing method of a kind of high flux, polytype molecular labeling |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN104830993B (en) |
Cited By (12)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105695572A (en) * | 2016-02-02 | 2016-06-22 | 中国水产科学研究院南海水产研究所 | Method for massively and efficiently developing molecular markers on basis of Indel and SSR (simple sequence repeat) site techniques |
| CN107058298A (en) * | 2017-06-06 | 2017-08-18 | 中国海洋大学 | A kind of auxiliary gene group assemble method based on artificial meiosis |
| WO2018024082A1 (en) * | 2016-08-02 | 2018-02-08 | 中国海洋大学 | Method for constructing serially-connected rad tag sequencing libraries |
| CN108004335A (en) * | 2017-12-08 | 2018-05-08 | 江汉大学 | A kind of bacterial leaf spot bacterium microspecies isolation and identification method |
| CN108026568A (en) * | 2016-01-31 | 2018-05-11 | 阿费梅特里克斯公司 | Nucleic acid analysis by binding barcode-labeled polynucleotide probes |
| CN109609610A (en) * | 2018-11-27 | 2019-04-12 | 江苏苏博生物医学科技南京有限公司 | A method of self-control probe in detecting BRCA gene |
| CN109680041A (en) * | 2018-12-25 | 2019-04-26 | 上海派森诺生物科技股份有限公司 | A kind of processing method based on the sequencing sample for simplifying gene order-checking |
| CN109777858A (en) * | 2018-12-20 | 2019-05-21 | 天津诺禾医学检验所有限公司 | The probe and method of hybrid capture are carried out to Duplication region |
| CN110570901A (en) * | 2019-09-03 | 2019-12-13 | 北京市农林科学院 | method and system for SSR typing based on sequencing data |
| US11118216B2 (en) | 2015-09-08 | 2021-09-14 | Affymetrix, Inc. | Nucleic acid analysis by joining barcoded polynucleotide probes |
| US11319589B2 (en) | 2012-01-13 | 2022-05-03 | Affymetrix, Inc. | Methods of determining the presence or absence of a plurality of target polynucleotides in a sample |
| CN114457143A (en) * | 2022-03-16 | 2022-05-10 | 苏州贝康医疗器械有限公司 | Method for constructing CNV detection library and CNV detection method |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103555846A (en) * | 2013-11-07 | 2014-02-05 | 中国海洋大学 | High-throughput low-cost SNP (single nucleotide polymorphism) genotyping method based on liquid molecular hybridization principle |
-
2015
- 2015-06-08 CN CN201510307506.1A patent/CN104830993B/en active Active
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103555846A (en) * | 2013-11-07 | 2014-02-05 | 中国海洋大学 | High-throughput low-cost SNP (single nucleotide polymorphism) genotyping method based on liquid molecular hybridization principle |
Non-Patent Citations (1)
| Title |
|---|
| M.HILL ET AL.: "PCR-based fingerprinting using AFLPs as a tool for studying genetic relationships in Lactuca spp.", 《THEOR APPL GENET》 * |
Cited By (15)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US11319589B2 (en) | 2012-01-13 | 2022-05-03 | Affymetrix, Inc. | Methods of determining the presence or absence of a plurality of target polynucleotides in a sample |
| US11118216B2 (en) | 2015-09-08 | 2021-09-14 | Affymetrix, Inc. | Nucleic acid analysis by joining barcoded polynucleotide probes |
| CN108026568A (en) * | 2016-01-31 | 2018-05-11 | 阿费梅特里克斯公司 | Nucleic acid analysis by binding barcode-labeled polynucleotide probes |
| CN105695572A (en) * | 2016-02-02 | 2016-06-22 | 中国水产科学研究院南海水产研究所 | Method for massively and efficiently developing molecular markers on basis of Indel and SSR (simple sequence repeat) site techniques |
| WO2018024082A1 (en) * | 2016-08-02 | 2018-02-08 | 中国海洋大学 | Method for constructing serially-connected rad tag sequencing libraries |
| US20190194648A1 (en) * | 2016-08-02 | 2019-06-27 | Ocean University Of China | Construction method for serial sequencing libraries of rad tags |
| CN107058298A (en) * | 2017-06-06 | 2017-08-18 | 中国海洋大学 | A kind of auxiliary gene group assemble method based on artificial meiosis |
| CN108004335A (en) * | 2017-12-08 | 2018-05-08 | 江汉大学 | A kind of bacterial leaf spot bacterium microspecies isolation and identification method |
| CN108004335B (en) * | 2017-12-08 | 2021-07-02 | 江汉大学 | Method for separating and identifying small species of rhizoctonia solani |
| CN109609610A (en) * | 2018-11-27 | 2019-04-12 | 江苏苏博生物医学科技南京有限公司 | A method of self-control probe in detecting BRCA gene |
| CN109777858A (en) * | 2018-12-20 | 2019-05-21 | 天津诺禾医学检验所有限公司 | The probe and method of hybrid capture are carried out to Duplication region |
| CN109680041A (en) * | 2018-12-25 | 2019-04-26 | 上海派森诺生物科技股份有限公司 | A kind of processing method based on the sequencing sample for simplifying gene order-checking |
| CN110570901B (en) * | 2019-09-03 | 2022-03-18 | 北京市农林科学院 | Method and system for SSR typing based on sequencing data |
| CN110570901A (en) * | 2019-09-03 | 2019-12-13 | 北京市农林科学院 | method and system for SSR typing based on sequencing data |
| CN114457143A (en) * | 2022-03-16 | 2022-05-10 | 苏州贝康医疗器械有限公司 | Method for constructing CNV detection library and CNV detection method |
Also Published As
| Publication number | Publication date |
|---|---|
| CN104830993B (en) | 2017-08-18 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN104830993A (en) | High-throughput typing technique universal to various molecular markers | |
| EP2341151B1 (en) | Methods for determining sequence variants using ultra-deep sequencing | |
| EP2620511B1 (en) | Single molecule nucleic acid sequence analysis processes | |
| EP1877576B1 (en) | Methods for determining sequence variants using ultra-deep sequencing | |
| JP7407227B2 (en) | Methods and probes for identifying gene alleles | |
| CN106591441B (en) | Alpha and/or beta-thalassemia mutation detection probe, method and chip based on whole gene capture sequencing and application | |
| EP2563939B1 (en) | Rapid genotyping analysis for human papillomavirus and the device thereof | |
| EP2616555B1 (en) | Capture probes immobilizable via l-nucleotide tail | |
| CN103555846B (en) | A kind of high-throughput low cost S NP classifying method based on liquid phase molecule Hybridization principle | |
| US20060292601A1 (en) | Rapid genotyping analysis and the device thereof | |
| EP3388532B1 (en) | Integrated capture and amplification of target nucleic acid for sequencing | |
| CN110564861A (en) | Fluorescence labeling composite amplification kit for human Y chromosome STR locus and InDel locus and application thereof | |
| CN117925802A (en) | Primer composition for HLA-I and HPA multiplex PCR, application and genotyping method | |
| CN102559856B (en) | Method for deleting vector segments in sequencing library | |
| CN113166809A (en) | Method, kit, device and application for detecting DNA methylation | |
| CN109295048A (en) | A kind of method of full-length genome Markers for Detection | |
| Zhang et al. | A New SNP Genotyping Technology by Target SNP-Seq | |
| KR101985659B1 (en) | Method for identification of Baekwoo breed using single nucleotide polymorphism markers | |
| US7049070B2 (en) | Materials and methods for detection and characterization of nucleic acid sequence variability | |
| KR101930710B1 (en) | SNP primer set for cultivar and origin identification of rice, method for cultivar and origin identification of rice using the same | |
| CN118726614A (en) | SNP molecular marker related to sheep chest width character, primer set, kit and application thereof | |
| CN118581200A (en) | Method for detecting nucleic acid molecule, detection kit and detection cartridge | |
| CN115725745A (en) | SNP molecular marker related to sheep multi-thoracic vertebra number, amplification primer group and application | |
| Albert et al. | A Methodology Study for Metagenomics Using Next Generation Sequencers | |
| WO2008091839A2 (en) | Reagents and methods for detecting cyp2c9 polymorphisms |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| EXSB | Decision made by sipo to initiate substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |