CN111733185A

CN111733185A - Method for realizing improvement of animal meat quality through Mdfi gene editing and application

Info

Publication number: CN111733185A
Application number: CN202010613570.3A
Authority: CN
Inventors: 王翀; 李华琴; 焦义仁; 黄波; 侯连杰; 朱依凡
Original assignee: South China Agricultural University
Current assignee: South China Agricultural University
Priority date: 2020-06-30
Filing date: 2020-06-30
Publication date: 2020-10-02

Abstract

The invention discloses a method for realizing animal meat quality improvement through Mdfi gene editing, which is realized through overexpression of an Mdfi gene. Therefore, the method has the following beneficial effects: 1. compared with the breeding angle, the method for improving the meat quality of animals from the gene editing angle is more controllable and has very obvious effect; 2. a method for improving meat quality of animals in terms of gene editing, the meat quality trait obtained by the method being heritable; 3. the method for improving the meat quality of animals from the aspect of gene editing is safe, controllable and environment-friendly.

Description

Method for realizing improvement of animal meat quality through Mdfi gene editing and application

Technical Field

The invention relates to the technical field of biology, in particular to a method for improving animal meat quality through Mdfi gene editing and application.

Background

Skeletal muscle is an important component of the animal body, and about 45% is skeletal muscle. Pork accounts for more than 60% of meat consumption of residents in China, and is a main animal protein source for people. With the improvement of living standard, people have higher requirements on meat quality. The meat quality traits belong to typical multi-gene control economic traits, the forming mechanism of the meat quality traits is complex and is influenced by a plurality of factors such as variety, age, sex, nutrition, heredity and the like, and meanwhile, the meat quality traits are difficult to measure, slaughter determination is needed, and the determination cost is high, so the improvement of the meat quality traits is the difficult point and the key point of research of animal science workers at present. Skeletal muscle development is the process by which myoblasts proliferate and differentiate to form muscle fibers, and muscle proteins deposit. Vertebrate muscles are composed primarily of muscle fibers, which occupy 75% to 90% of the muscle tissue, and the morphological characteristics of muscle fibers determine the muscle properties. A large number of researches show that the composition of the muscle fiber type is closely related to important traits related to meat quality, such as meat color, tenderness (shearing force), pH value 24h after slaughter, drip loss and the like (Morales et al 2015; Wood et al 1999; Guojia 2011), so that the research and the improvement of the composition of the muscle fiber type have a direct guiding function on the improvement of the meat quality traits of pigs.

The myosin heavy chain (MyHC) subtypes in adult mammalian skeletal muscle fibers fall into 4 major classes: type I (MyHC I), type IIA (MyHC IIa), type IIx/d (MyHC IIx/d) and type IIB (MyHC IIb) (Schiaffeo et al, 1989). MyHC I corresponds to a slow-oxidizing muscle fiber, MyHC IIa to a fast-oxidizing muscle fiber, MyHC IIb to a fast-glycolytic muscle fiber, and MyHC IIx/d is between MyHC IIa and MyHC IIb, which are intermediate muscle fibers (Ashmore et al, 1972). Meat color is one of the important indicators that people use to evaluate meat quality organoleptically (O' Sullivan et al, 2003). Type I and IIA muscle fibers are found primarily in slow muscles (e.g. soleus), are highly oxidative, are rich in myoglobin (Mb) and cytochromes (cytochromes), and are bright red in muscle color (schiffinoet al, 2011). Type IIB muscle fibers are found primarily in the fast muscles (e.g., extensor digitorum longus and longissimus dorsi), have relatively low myoglobin and cytochrome contents, and are darker in muscle tone (Tseng et al, 2010). Research shows that different parts of the same pig have different types of skeletal muscle fibers, such as longissimus dorsi, biceps femoris, semimembranosus and other type IIB muscle fibers with higher content, while the psoas major contains higher type IIA muscle fibers and lower type IIB muscle fibers (Chang et al, 2003). The pH, intramuscular fat content, flesh color, etc. of the porcine psoas major and semitendinosus 24h after slaughter are positively correlated with the type I muscle fiber ratio (Shen et al, 2015). These studies all showed that the longissimus dorsi of pigs predominates in type IIB muscle fibers, while the psoas major muscle predominates in type I and IIA muscle fibers. In the study of the major psoas and the longissimus dorsi of the long white pigs, duroc pigs and baccharpy pigs, the meat color score of the major psoas with more oxidized fibers was found to be higher than that of the longissimus dorsi with a higher proportion of glycolytic fibers (Chang et al, 2003). In different pig species, the expression quantity of MyHC of different types is different, for example, the expression of MyHC I gene in the longissimus dorsi of the Bama miniature pigs which are 30 days and 60 days old at birth is obviously higher than that of Changbai pigs at the same age; the expression of MyHC I gene in the longissimus dorsi of 300-day-old Bama miniature pigs is significantly higher than that of 180-day-old Changbai pigs (Aokiazi, Guangxi university, 2014 Master paper). After birth, the number of muscle fibers has been determined, but the muscle fiber types remain highly plastic, controlled by multiple genes. The functional gene or genetic marker for controlling the quality of the livestock and poultry meat is excavated and can be used for genetic improvement of the quality of the livestock and poultry meat.

Mdfi (MyoD family inhibitor), also known as I-mf (inhibitor of MyoD family), was originally discovered by Chen et al (1996) in a mouse embryonic cDNA library by yeast two-hybrid assay to interact with a new gene of MyoD protein family. Subsequently researchers found that Mdfi also played an important role in mouse placental development (Kraut et al, 1998), skeletal development (oncogene al, 2013), disease, and tumorigenesis (Lin et al, 2015; Ma et al, 2018; Wu et al, 2015).

Disclosure of Invention

The invention aims to provide a method for improving the quality of animal meat by Mdfi gene editing so as to solve the problem of improving the quality of the animal meat.

According to one aspect of the invention, there is provided a method for achieving improved meat quality in an animal by Mdfi gene editing, the method comprising overexpressing the Mdfi gene. Therefore, the meat quality of animals can be improved efficiently, and the method is safe, controllable and environment-friendly.

In certain embodiments, the method comprises injecting Mdfi in the animal muscle. Therefore, the meat quality of animals can be improved efficiently, and the method is safe, controllable and environment-friendly.

In certain embodiments, the method comprises injecting an adeno-associated virus comprising an Mdfi coding region in the muscle of the animal. Therefore, the meat quality of animals can be improved efficiently, and the method is safe, controllable and environment-friendly.

In certain embodiments, the method comprises injecting an adeno-associated virus comprising an Mdfi coding region in an animal muscle at a virus titer of 10¹²vg/mL, 10-15. mu.L per spot. Therefore, the meat quality of animals can be improved efficiently, and the method is safe, controllable and environment-friendly.

In certain embodiments, the method comprises injecting an expression plasmid containing an Mdfi coding region in the muscle of the animal. Therefore, the meat quality of animals can be improved efficiently, and the method is safe, controllable and environment-friendly.

In certain embodiments, the method comprises obtaining a transgenic animal that overexpresses the Mdfi gene. Thus, the meat quality of the transgenic animal obtained is improved and the properties are heritable.

In certain embodiments, the method comprises obtaining an animal that overexpresses the Mdfi gene by injecting the Mdfi gene into a fertilized egg and then transplanting into the uterus of a surrogate pregnant animal. Therefore, the meat quality of animals can be improved efficiently, and the method is safe, controllable and environment-friendly.

According to another aspect of the present invention, there is provided a use of the edited Mdfi gene for quality improvement of animal meat.

In certain embodiments, editing the Mdfi gene comprises overexpressing the Mdfi gene in the animal.

In certain embodiments, overexpressing the Mdfi gene comprises at least one of injecting an expression plasmid containing the Mdfi coding region in the muscle of an animal, injecting an adeno-associated virus containing the Mdfi coding region in the muscle of an animal, overexpressing a transgenic animal for the Mdfi gene, injecting the Mdfi gene into a fertilized egg, and transplanting the Mdfi gene into the uterus of a surrogate pregnant animal to obtain an animal overexpressing the Mdfi gene.

The invention has the beneficial effects that:

1. compared with the breeding method, the method for improving the meat quality of the animals from the gene editing perspective is more controllable and has very obvious effect.

2. A method for improving meat quality of animals in terms of gene editing, the meat quality shape obtained by the method is heritable.

3. The method for improving the meat quality of animals from the aspect of gene editing is safe, controllable and environment-friendly.

Drawings

FIG. 1 shows the results of Westernblot detection of Mdfi and myofiber type MyHC-tagged proteins in muscle tissues of Laiwu pigs and big white pigs: FIG. A is the protein levels of the lumbar major muscle tests Mdfi, MyHC I, MyHC IIa and MyHC IIb of the Laiwu pigs and the large white pigs, and FIG. B is the protein levels of the lumbar major muscle tests Mdfi, MyHC I, MyHC IIa and MyHC IIb of the Laiwu pigs;

FIG. 2 is a graph showing the results of the conversion of myofiber types from glycolytic to oxidative following the myogenic differentiation of C2C12 cells promoted by Mdfi: FIG. A is the MyHC I immunofluorescence results at 7 days of C2C12 overexpression of Mdfi, FIG. B is the MyHC IIa immunofluorescence results at 7 days of C2C12 overexpression of Mdfi, FIG. C is the MyHC IIb immunofluorescence results at 7 days of C2C12 overexpression of Mdfi, and FIG. D is the Tnni1, Tnni2, MyHC I, MyHC IIa, MyHC IIb, MyHC IIx/D and myoglobin (myoglobin, Mb) fluorescence quantification results at 7 days of C2C12 overexpression of Mdfi: wherein N is 3, x: p <0.05, x: p is less than 0.01, the magnification of the picture is 100 times, and the ruler is 100 mu m;

FIG. 3 is a graph showing the result of Western blot detection of MyHC protein expression in the fast and slow muscle fiber type after the overexpression of Mdfi in the hind leg muscle of 8-week-old C57BL/6J mice embedded with adeno-associated virus.

Detailed Description

The present invention will be described in further detail with reference to the accompanying drawings.

Example 1: mdfi and myofiber type marker protein expression detection in muscle tissue of Laiwu pigs and white pigs

1) Experimental Material

The psoas major muscle from leypus pigs and large white pigs, the longissimus dorsi and psoas major muscle from leypus pigs.

2) Instrumentation and equipment

According to the Western blot experiment steps, the related instruments and equipment are as follows: centrifuge 5804R desk top high speed refrigerated Centrifuge (Eppendorf, germany); iMark^TMMicroplate Reader (U.S. BIO-RAD), ice maker (Japan Sanyo), vertical transfer tank (Shanghai-Tian-Nei), protein electrophoresis apparatus (Shanghai-Nei), Color liquid magnetic stirrer (German IKA), PowerPac (TM) Universal electrophoresis apparatus power supply (U.S. BIO-RAD), VORTE × 4 clingial circumferential oscillator (German IKA), Yipu Yida ultra-pure water system (Sichuan Yopu ultra-pure science and technology Co.), HS-3 vertical mixer (Ningbo New Ganoderma Biotech), D1008E palm centrifuge (U.S. SCILOGEX), transfer decolorizing shaker TS-8 (Yangbei of Jiangsu Haiman, Tubeier), Flor Chem^MPolychromatic fluorescence and chemiluminescence imaging systems (Protein Simple, usa); pipette (GILSON, usa).

3) Experiment consumable

According to the Western blot experiment steps, the related consumables are as follows: 5 × Loading Buffer (Shanghai Biyun sky); SDS-PAGE protein loading buffer (Shanghai Biyun day); PMSF (shanghai bi yunnan ST 505); RIPA lysate (strong) (shanghai bi yun tian).

4) Extraction of total protein of Laiwu pig lumbar large muscle tissue

Shearing the psoas major muscle tissue with scissors, adding RIPA lysis buffer (strong), adding protease inhibitor PMSF, mashing the muscle tissue with homogenizer, and splitting on ice for half an hour while shaking the lysis buffer. And finally, centrifuging the mixture for 15 minutes at 12,000g of a desktop high-speed refrigerated centrifuge, taking the supernatant, adding a 5 Xloading Buffer, and carrying out denaturation in water bath at 98 ℃ for 15 minutes to finally obtain total protein for a Western blot experiment in the later period.

5) Western blot detailed procedure

a) Sample preparation: the denatured protein samples were thawed on ice and 30 μ g protein was loaded per well;

b) preparation of 12% separation gel: the preparation is carried out according to the formula: ddH₂O2 mL; 0.1mL of 10% SDS; 1.5mol/LTris (pH 8.8)3.8 mL; 0.004mL of TEMED; 0.1mL of 10 percent ammonium persulfate and 4mL of 30 percent acrylamide mixed solution, uniformly mixing the gel, slowly adding the gel into a gel plate, swinging left and right to enable the gel to be horizontal left and right, and then slowly adding ddH into one side of the gel plate₂O, sealing the adhesive;

c) preparation of 5% concentrated glue: the preparation is carried out according to the formula: ddH₂O6.8 mL; 0.1mL of 10% SDS; 1.5mol/LTris (pH 6.8)1.25 mL; 0.1mL of 10% ammonium persulfate; 1.7mL of 30% acrylamide mixed solution and 0.01mL of TEMED; between the addition of the concentrated glue, the water in the glue plate is sucked dry by using filter paper, then the concentrated glue is slowly added, a cleaned and dried comb is inserted, the comb is slightly pressed downwards, and then glue is supplemented on two sides;

d) electrophoresis: slightly pulling out the comb, then placing the comb in an electrophoresis tank, adding Western blot electrophoresis solution, and then slowly adding protein sample solution; electrophoresis program 80V 40 min; 110V for 1 hour and 30 minutes;

e) film transfer: preparing membrane conversion liquid in advance, adding methanol, sealing with a sealing film to avoid volatilization, and pre-cooling in a refrigerator at 4 ℃; putting a black plate of a film-transferring clamp downwards, sequentially putting a spongy cushion, 3 pieces of thin filter paper, gel, a PVDF film, 3 pieces of thin filter paper and a spongy cushion, clamping, putting the film-transferring clamp in an electrophoresis tank, and transferring the film for 90 minutes at a constant current of 168 mA;

f) and (3) sealing: taking out the PVDF membrane, marking the left upper corner, and distinguishing the sample application sequence and the front side and the back side of the membrane; cutting according to a protein marker, and sealing for 2 hours at room temperature on a shaking bed with 5% skimmed milk powder;

g) incubating the primary antibody: after sealing, washing the strips with TBST, winding the strips into a centrifuge tube, screwing the membrane into the tube with the front side facing inwards, shaking the membrane on a vertical mixer at 4 ℃, and incubating for 12-18 hours;

h) incubation of secondary antibody: washing the strip with TBST for 3-5 times, 3-5 minutes each time; then, according to the property of the primary antibody, performing secondary antibody incubation in a glass dish;

i) color development: washing the strip with TBST for 3-5 times, each time for 3-5 minutes, incubating the strip with a developing solution, and finally performing fluorescence analysis on the strip in a Flour Chem^MScanning detection is performed in multicolor fluorescence and chemiluminescence imaging systems. The results are shown in FIG. 1A and FIG. 1B. FIG. 1 shows that the expression level of Mdfi is positively correlated with the expression levels of slow muscle fiber type MyHC I and MyHC IIa in different pig species; in Laiwu pigs, Mdfi and MyHC I and MyHC IIa expression in the psoas major, where there are more slow muscle fibers, are positively correlated.

The primary and secondary antibody information for Western blot is shown in tables 1 and 2 below:

example 2: detection of myofiber type conversion from glycolytic to oxidative after myogenic differentiation of Mdfi promoted C2C12 cells

1) Experimental Material

C2C12 mouse myoblasts were purchased at the ATCC official website under the accession number CRL-1772.

2) Instrumentation and equipment

According to the experimental steps of immunofluorescence and qPCR, the involved instruments and equipment are as follows: CO 2₂Incubators (Thermo, usa); super clean bench (suzhou jing anta); bench top high speed refrigerated centrifuge (Eppendorf, germany); leicaconfocal laser scanning Microscope SP8 (Lceica, Germany); CFX Connect^TMReal-time System fluorescent quantitative PCR instrument (U.S. BIO-RAD); pipettors (GILSON, usa); NanoDrop One ultramicro nucleic acid protein assay (Thermo, USA).

3) Reagent consumable

According to the experimental steps of immunofluorescence and qPCR, the reagent consumables are as follows: DMEM/HIGH GLUCOSE (HyClone, USA); FBS (Gibco, USA); horse serum (American HyCl)one); ampicillin antibiotic (Shanghai Biyuntian); 5% BSA (doctor Wuhan); triton X-100 (Membrin, Shanghai); trizol (Nanjing Novozan R401-01); DEPC water (shanghai bio-worker); chloroform (Shanghai Biyuntian); isopropanol (shanghai bi yuntian); absolute ethanol (shanghai bi yun tian);

IIQ RT Supermix for qPCR (+ gDNA wiper) (Nanjing Novovisan R223); puromycin (GIBCO, usa); construction of Mdfi over-expressed C2C12 cell line to Genome-TALER^TM&Genome-CRISPR^TM(GeneCopoeia Inc., Rockville, Md., USA); DAPI (shanghai bi yun tian).

4) Screening procedure for Mdfi-overexpressing monoclonal C2C12 cells

According to Genome-TALER^TM&Genome-CRISPR^TMThe kit comprises the following steps of firstly constructing an Mdfi DONOR vector DONOR-Mdfi: according to the primer Mdfi-F (5 '-3'): ATGTCCCAGGTGAGCGGT, respectively; Mdfi-R (5 '-3'): TCAGGAGGAGAAACAGAGTCC the CDS region of Mdfi (sequence shown in SEQ ID NO: 1) was amplified and cloned into Genome-TALER^TM&Genome-CRISPR^TMDONOR vector in kit (according to Genome-TALER)^TM&Genome-CRISPR^TMInstructions for kit to perform the procedure), the DONOR-Mdfi DONOR vector was successfully constructed. According to Invitrogen corporation

3000 instructions Co-transfect ROSA vector and DONOR-Mdfi Donor vector in C2C12 cells. After 48 hours, drug screening was performed using 2. mu.g/mL puromycin, followed by screening for Mdfi-expressing monoclonal C2C12 cells according to the clonal loop method. The method comprises the following specific steps:

a) the cells were digested with pancreatin 3 days after drug sieving using 2. mu.g/mL puromycin and then diluted to 1200 cells/cm²The density of (3), inoculating the cells in a 10cm dish, and culturing with a growth type culture medium;

b) observing under a 40-fold microscope, and when one cell is proliferated, the formed cell mass just occupies 40-fold visual field; observing cells under a fluorescence microscope, marking at fixed points, and marking out a single cell mass which emits green light and is formed by proliferation of one cell;

c) soaking cloning rings in 75% alcohol for 5 minutes in a super clean bench, then washing for 3 times by PBS, and finally soaking in PBS for later use;

d) absorbing the culture medium, washing with PBS for 2 times, changing the clone to the place of the marked cell, adding 100 μ L of 0.25% pancreatin, digesting for 2 min at room temperature, and adding 20 μ L of growth type complete culture medium to terminate digestion;

e) gently blowing the cells in the suspension cloning ring, and then directly transferring the cells to a 48-hole cell culture plate;

f) cells adhere to the wall after 12 hours of inoculation, a new complete culture medium is replaced, observation is carried out under a microscope, and fluorescent and non-luminous monoclonal cells are determined and marked;

g) screening in the previous step to obtain monoclonal cells, digesting, obtaining one third of cell suspension after digestion as a sample for homologous recombination identification, transferring the rest to a 24-well plate, and marking at the moment;

h) when the monoclonal cells grow to 80% in a 24-well plate, carrying out digestion passage, namely three to 6-well plates, according to the positive monoclonal cells verified by the PCR in the previous step;

i) when the cells grow to 80%, one hole of cells is used for freezing and storing the cells, one hole of cells is used for extracting RNA, and one hole of cells is used for extracting protein; when the cells were frozen, a small portion was taken for DNA extraction (direct lysis of the cells for PCR identification). And finally, verifying through qPCR, Western blot and homologous recombination PCR, and determining a candidate Mdfi over-expressing monoclonal C2C12 cell line for subsequent experiments.

5) MyHC I/IIa/IIb immunofluorescence experiment procedure

To examine the effect of Mdfi on myofiber type during differentiation of C2C12, myofiber formation was analyzed by MyHC I/IIa/IIb immunofluorescence, respectively, and the detailed assay procedure for 48-well plates was as follows:

a) inoculating wild C2C12 cells and C2C12 cells stably overexpressing Mdfi into a 48-well plate at the same cell density, and performing induced differentiation after the cells are attached to the wall;

b) after induced differentiation for 7 days, the medium was removed and washed twice with 200. mu.L PBS;

c) fixing: add 200. mu.L of 4% paraformaldehyde into each well, shake slowly on a shaker for 30 minutes;

d) washing: the fixative was aspirated off and washed three times with 200 μ L PBS for 20 seconds each;

e) permeabilization: adding 150 mu L of prepared 1% Trition-100 permeabilizing agent into each well, and carrying out permeabilization for 30 minutes on a shaking table;

f) and (3) sealing: removing the permeabilizing agent, washing with PBS 3 times, adding 200 μ L of 5% BSA, and standing at 37 deg.C for 2 hr;

g) incubation of MyHC I antibody: preparing MyHC I antibody diluent with 5% BSA according to the instruction, and incubating at 37 ℃ for 2 hours, wherein each well contains 150 mu LMyHC I antibody diluent; the dilution ratio of the MyHC I antibody is shown in Table 1;

h) washing of MyHC I antibody: MyHC I antibody was recovered and washed three times with 200. mu.L PBS for 5 minutes each; note that the recovered MyHC I antibody may also be subjected to two immunofluorescence assays;

i) incubating a secondary antibody, Goat Anti-Mouse lgG/Cy 3: preparing an antibody diluent by using PBS (phosphate buffer solution), wherein 120 mu L of the secondary antibody diluent is used in each hole, and incubating for 2 hours at room temperature in a dark place; the dilution ratio of the coat Anti-Mouse lgG/Cy3 is shown in Table 2;

j) washing secondary antibody: washed three times with 200 μ L PBS for 5 minutes each;

k) DAPI incubation: DAPI dilutions were prepared according to the instructions, 100 μ L of DAPI dilution was added to each well, incubated for 30 minutes at room temperature, and then subjected to photographic analysis, with three different fields selected for each well. See results fig. 2A.

The effect of Mdfi on MyHC IIa and MyHC IIb type muscle fiber formation was examined using the same method, as shown in fig. 2B and fig. 2C, respectively: the results show that overexpression of Mdfi increases the myotube ratio of MyHC I and MyHC IIa (fig. 2A and 2B), and decreases the myotube ratio of MyHC IIb type (fig. 2C).

6) Fluorescence quantitative determination of mRNA level of fast and slow muscle fiber related gene

To clarify the effect of Mdfi on the mRNA level of the fast and slow muscle fiber-associated genes, respectivelyCells were collected from wild type C2C12 nuclei and from 7 days of differentiation of the C2C12 cell line stably overexpressing Mdfi, subjected to total RNA extraction, and then used by Nanjing Novophilia

II Q RT Supermix for qPCR (+ gDNA wrapper), reverse transcription to obtain cDNA, and final detection using CFX Connect Real-Time System. The primers used are shown in Table 3 below. The results are shown in FIG. 2D: the results show that overexpression of Mdfi extremely significantly increases MyHC I (p)<0.01) and MyHC IIa (p)<0.01) mRNA level, decreased MyHC IIb (p)<0.01) mRNA level. It is demonstrated that overexpression of the Mdfi gene can transform fast to slow muscle fibers and increase the proportion of slow muscle fibers.

Example 3: and (3) overexpressing Mdfi in the hind leg muscle of the mouse by an adeno-associated virus embedding method, separating gastrocnemius muscle, and performing western blot to detect the result of the fast and slow muscle fibers.

1) Experimental Material

C57BL/6J mice (purchased from Guangdong provincial animal center for medical laboratory); adeno-associated virus (AAV; from Kjekay Gene Co., Ltd.) packaging the Mdfi coding region enriches Mdfi in muscle for expression using the MHCK7 promoter.

2) Reagent consumable

A disposable syringe; phosphate Buffered Saline (PBS).

3) Experimental procedure for injecting adeno-associated virus packaging Mdfi coding region into hind leg muscle of C57BL/6J mice

7 weeks old male C57BL/6J common pathogen Free (SPF) grade mice were purchased from the medical laboratory animal center, Guangdong province. The mouse material is of a common SPF grade and meets the national standard. Animal feeding conditions: 1, one plant is cultured per cage; raising temperature and humidity: 20-26 ℃ and 40-70 percent, and adopts 12h day and night intermittent illumination. The condition of the feeding room is always stable, and the feeding room can freely take food and drink water.

② one week after feeding, the mice were injected with the adeno-associated virus containing the Mdfi coding region (SEQ ID NO: 1) at multiple points in the hind leg muscle of C57BL/6J mice using sterile syringes at a virus titer of 10¹²vg/mL, 10-15 μ L per spot, and 3-5 spots. Normal mice (Wild Type, WT) were injected with an equal volume of PBS. The gastrocnemius muscle of the mouse is a mixed muscle and contains fast muscle fibers and slow muscle fibers. To investigate whether Mdfi has an effect on fast and slow muscle fiber transformation. Thus, one week after injection, the gastrocnemius muscle of the mice was isolated and Western blot examined the protein levels of MyHC associated with fast and slow muscle fiber type. The results are shown in FIG. 3: compared with the WT type group, the over-expression Mdfi (AAV-Mdfi) is shown to reduce the MyHC IIb protein level, increase the MyHC I and MyHC IIa protein levels, and show that the conversion from fast muscle to slow muscle in gastrocnemius of an adult mouse is promoted, and the muscle character of the mouse is improved, so that the over-expression Mdfi is presumed to improve the slow muscle proportion of animals such as pigs or cattle and the like, and further improve the meat quality.

Example 4: a method for improving meat quality in swine by intramuscular injection of an adeno-associated virus containing an Mdfi coding region into the hind leg of the swine.

Weaning piglets with the same genetic background are divided into two groups, namely an experimental group and a control group. The hind leg muscles of the experimental group of piglets were injected with adeno-associated virus containing the Mdfi coding region. The virus titer was 10¹²vg/mL, 10-15 μ L per spot, and 5-8 spots. Control piglets were injected with an equal volume of PBS. After the pigs of the experimental group and the control group are marked, the pigs are raised to 100 days old under the same condition, and the rear leg muscles of the pigs are detected, and the result shows that the MyHC IIb protein expression of the pigs of the experimental group is reduced, the MyHCI and MyHC IIa protein expression is increased, the muscles are converted from fast muscles to slow muscles, and the pork quality is improved.

Example 5: a method for improving meat quality in swine by injecting an expression plasmid containing an Mdfi coding region into the hind leg muscle of swine.

Weaned piglets with the same genetic background are divided into two groups, namely an experimental group and a control group. The hind leg muscle of the experimental group of piglets was injected with an expression plasmid containing the Mdfi coding region. The plasmid concentration is 20. mu.M, 10-15. mu.L of plasmid is injected into each spot, and 5-8 spots are punched. Control piglets were injected with an equal volume of PBS. After the pigs of the experimental group and the control group are marked, the pigs are raised to 100 days old under the same condition, and the rear leg muscles of the pigs are detected, and the result shows that the MyHC IIb protein expression of the pigs of the experimental group is reduced, the MyHC I and MyHC IIa protein expression is increased, the muscles are converted from fast muscles to slow muscles, and the pork quality is improved.

Example 6: the pork quality is improved by constructing transgenic pigs over-expressing Mdfi.

The DONOR-Mdfi DONOR vector constructed as the method in example 2 is used for transfecting pig fibroblasts, a positive cell line expressing the Mdfi gene is obtained after screening, and the cell line is used as a nuclear DONOR cell of somatic cell cloning to carry out somatic cell cloning, so that the transgenic pig specifically over-expressing the Mdfi gene in the muscle is obtained. The transgenic pig and the negative control group are slaughtered after being raised to 100 days of age under the same feeding condition, the muscle type of the transgenic pig is detected, and the MyHC IIb protein level in the transgenic pig is obviously reduced, the MyHC I and MyHC IIa protein levels are obviously increased, so that the muscle is converted from fast muscle to slow muscle, and the pork quality is improved.

Example 7: the quality of pork is improved by injecting Mdfi gene into fertilized eggs, and then transplanting the fertilized eggs into the uterus of a surrogate pregnant animal to obtain the pig over-expressing the Mdfi gene.

The fertilized eggs of the pig were divided into experimental group and control group. The experimental group was injected with an expression plasmid containing the Mdfi coding region (DONOR-Mdfi DONOR vector constructed as described in example 2) at a plasmid concentration of 20. mu.M and an injection volume of 10 pL. The control group was injected with an equal volume of PBS solution. After the pigs of the experimental group and the control group are marked, the pigs are fed to 100 days of age under the same condition, and the rear leg muscles of the pigs are detected, the results show that the protein levels of MyHC IIb of the pigs of the experimental group are obviously reduced, the protein levels of MyHC I and MyHC IIa are obviously increased, the muscle is converted from fast muscle to slow muscle, and further the quality of the pork is improved.

Sequence listing

<110> southern China university of agriculture

<120> method and application for realizing improvement of animal meat quality through Mdfi gene editing

<130>2020.6.30

<160>1

<170>SIPOSequenceListing 1.0

<210>1

<211>741

<212>DNA

<213> Artificial sequence ()

<400>1

atgtcccagg tgagcggtca gtgcccttct cgctgcgacg cgcctcatgg agtccccagc 60

gctgccctgg acccagccca gaccatgtcc ctcctccctg ggctggaggt agcaagatcc 120

actcaccctg tagaggcatc ttctgaagag ggcttcccgg aggaggcggc accctccatg 180

ccccatgaca gtggtctccg ggctcagcag gctctgaaca gcattgacct cgatgtcccc 240

acagaagctg tgacgtgcca gcctcaaggg aacccccaag gctgcacccc actactgcca 300

aatggctcca gccacgacca cctctcagaa ccgggcagtg cagggcatgc ggggaacggt 360

gctctgggcg ggtccaaggc ccaccggaag ttgcagacgc atccatctct gggcagccag 420

gctggaagga aaagcagagg cagcgcccgg tcagcctcac aggtccctct ccaggcacag 480

gaagattgct gcgtccactg catactgtcc tgtctattct gtgagttcct gacgctctgt 540

aacatcctcc tggactgcgc cacctgtggc tcctgcagct ctgaggactc ctgcctctgc 600

tgctgctgct gtgggtccgg cgagtgcgcg gactgtgacc tgccctgcga cctggactgc 660

ggcatcgtgg atgcctgctg cgagtccgca gactgcttgg agatatgcat ggagtgctgt 720

ggactctgtt tctcctcctg a 741

Claims

1. A method for achieving improved meat quality in an animal by Mdfi gene editing, wherein the method comprises overexpressing the Mdfi gene.

2. The method for improving the quality of animal meat by Mdfi gene editing of claim 1, wherein the method comprises injecting Mdfi in the animal muscle.

3. The method for improving the meat quality of an animal by Mdfi gene editing according to claim 2, wherein the method comprises injecting the animal intramuscularly with an adeno-associated virus containing the Mdfi coding region.

4. The method for improving the meat quality of animals by Mdfi gene editing as claimed in claim 3, wherein the method comprises injecting the animal intramuscular with adeno-associated virus containing Mdfi coding region with a virus titer of 10¹²vg/mL, 10-15. mu.L per spot.

5. The method for improving the quality of animal meat by Mdfi gene editing of claim 2, wherein the method comprises injecting the expression plasmid containing the Mdfi coding region into the muscle of the animal.

6. The method for improving the meat quality of an animal by Mdfi gene editing according to claim 1, wherein the method comprises obtaining a transgenic animal that overexpresses the Mdfi gene.

7. The method for improving the meat quality of an animal by Mdfi gene editing according to claim 1, wherein the method comprises obtaining an animal over-expressing the Mdfi gene by injecting the Mdfi gene into a fertilized egg and then transplanting the fertilized egg into the uterus of a surrogate pregnant animal.

8. The edited Mdfi gene is applied to the improvement of the quality of animal meat.

9. The use of claim 8, wherein editing the Mdfi gene comprises overexpressing the Mdfi gene in the animal.

10. The use of claim 9, wherein said overexpressing an Mdfi gene comprises at least one of injecting an expression plasmid containing an Mdfi coding region intramuscularly in an animal, injecting an adeno-associated virus containing an Mdfi coding region intramuscularly in an animal, overexpressing a transgenic animal of an Mdfi gene, injecting an Mdfi gene into a fertilized egg and transplanting the Mdfi gene into the uterus of a surrogate pregnant animal to obtain an animal overexpressing an Mdfi gene.