CN103131722A - Swine gene expression muscle creatine kinase (MCK)-diacylglycerol acyltrabsferase 1(DGAT1) carrier and preparation method thereof - Google Patents

Abstract

The invention discloses a swine gene expression muscle creatine kinase (MCK)-diacylglycerol acyltrabsferase 1(DGAT1) carrier and a preparation method thereof. The preparation method includes a first step of obtaining a complementary deoxyribonucleic acid (c DNA) overall length sequence of a swine DGAT1 gene according to the DGAT1 gene to compound the gene, a second step of designing two pairs of two-end distinguished sequences of two ends of a specific primer augmentation swine MCK gene promoter, enabling the two-end distinguished sequences to be connected on a p enhanced green fluorescent protein (p EGFP)-N1 carrier, obtaining the complete promoter of the swine MCK gene according to gene capture technology, wherein the overall length of a promoter sequence is 7121bp, and a third step of using the swine DGAT1 gene to replace a green fluorescent protein (GFP) gene on a p EGFP-N1-MCK carrier, and completing the structure of the MCK-DGAT1 expression carrier. The experimental result indicates that the expression carrier structured by the swine DGAT1 gene and the muscle specific expression gene MCK promoter, the contents of triglyceride and aliphatic acid in animal individual muscles are remarkably increased, and reliability and authenticity of the experiment are improved. The verified expression carrier is directly applied to swine transgenic engineering and molecular breeding. Through transgenosis, new species of high intramuscular fat can be obtained, quality of pork is improved, and the time for conventional breeding cultivating high intramuscular adipose is shortened.

Description

MCK-DGAT1 carrier and the preparation method of one boar genetic expression

Technical field

The invention belongs to animal gene engineering technology field, be specifically related to the MCK-DGAT1 carrier of a boar genetic expression, also relate to simultaneously the preparation method of the MCK-DGAT1 carrier of a boar genetic expression.

Background technology

The expression of gene (gene expression) refers to the process from DNA to protein, and the adjusting of this process is called the expression regulation of gene.And the expression regulation of gene is a multi-level complex process, is subjected to different adjusting controlling factors.It is that adjusting by the multistage level realizes, namely transcribe front, transcribe, transcribe after, the regulation and control of translation, rear five levels of translation.Grow by the different genes orderly expression on time and space and the synergy of higher organism realize, and the unlatching of genetic expression in this process, close, meticulous control that the height of expressive site, expression amount etc. all will be subject to each stage level.Promotor (promoter) refers to one section DNA sequence dna that gene is transcribed, if structure gene is under the regulation and control of the promotor of tissue or etap specificity promoter, gene is often only expressed in some specific histoorgan, and shows the characteristic of growing adjusting.

Along with engineered develop rapidly, how to make foreign gene become the focus of research according to correct, the efficient and stable expression in vivo of people's wish.Utilize promotor that some important specific or specified conditions can induce to build a series of expression vectors that can efficiently expressing exogenous gene, in conjunction with transgenic technology, these foreign genes are imported in organism simultaneously, cultivate and to come the animals and plants new variety of expression alien gene or the final foothold that new lines becomes modern molecular breeding according to people's design original intention fully.

Genetically Modified---transgenosis, be called for short GM, refer to use scientific method to extract needed gene from certain biology, it is changed in another kind of biology, make with another kind of biological gene and recombinate, thereby produce the material that specifically has the mutation genetic proterties.Utilize transgenic technology can change the animals and plants proterties, cultivate new variety.Also can utilize other organism to cultivate the biological products of expectation, be used for the aspects such as medicine, food.

Muscle creatine kinase (Muscle Creatine Kinase, MCK) is proved high-caliber expression in skeletal muscle and cardiac muscular tissue (Amacher, S.L, S.L., J.N.Buskin, and S.D.Hauschka.1993; Dorit B.Donoviel, 1996; Margaret A.Shield et al, 1996; Jane E.Johnson et al; 1989); some in-vitro transfection Skeletal Muscle cells and fibroblastic research; 2 MCK enhancer elements and a proximal promoter sub-element have been identified; these elements are only expressed in the Skeletal Muscle Cell of differentiation; an integrator gene that comprises 3300 Nucleotide of MCK5 ' terminal sequence demonstrates the activity level of chloramphenicol acetyltransferase in skeletal muscle; than other muscle tissue; as high in kidney, liver and spleen by 104, in the expression of new machine also than the high 2-3 of other a non-muscle tissue order of magnitude.

diacylglycerol acyltransferase (diacylglycerol acyltrabsferase, DGAT) is to control TAG synthetic core enzyme (Cases S, Smith SJ and Zheng YW, 1998 in adipocyte, Li Liu, Nancy Chen and Xiaojing Shi, 2007, Li Liu, 1Xiaojing Shi et al.2009, Manco, M., et al.2000, Scot J, Eric Yen and Chi-Liang, 2008, Yen C-HE, Monetti M and Burri B J et al., 2005, Yu, Y.H., and Ginsberg, H.N, 2004, ZhangY, Oelkers P and Sturley SL, 2002), play important central role in the metabolism of cell glycerolipid, its main mechanism is to make two phthalein glycerine (diacylglycerol, DAG) add that fatty acid acyl forms triacylglycerol (triacylglycerol, TAG), because there is vital role at three phthalein glycerine in DGAT in synthetic and energy storage, thereby DGAT also may absorb at the tripe tallow fat, the lipoprotein set, the deposition of fat in the adjusting of TG concentration and lipocyte in blood plasma, in muscle, the aspects such as metabolism of energy play a role, and can also affect milk yield and egg productivity.

Meat is the main source of human nutrition, and pork shared ratio in all consumption of meat is maximum.Along with the development of society and the raising of people's living standard, people are changed by the pursuit of original pursuit to amount to matter to the consumption idea of meat.In the decades in past, traditional breeding method is in the speed of growth that improves pig, and the effect of positive important has been brought into play in the aspects such as lean ratio and feed conversion rate, and has obtained significant achievement, the breeding plan successful.But simultaneously along with the intensity of high growth rate and high lean ratio being selected to have caused the degradation of meat quality, particularly caused the significantly decline of muscle fat, myofiber increases slightly (increase of fast muscle ratio), pork inferior emerge in multitude (Bee G, Guex G, Herzog W; Pettigrew J E, Esnaola MA, 2001).So transgenic breeding, the good target gene that can promote intramuscular fat to form is building up in the carrier that contains muscle specific expression promotor, then by transgenic technology, goal gene is imported in the pig body, cultivate the high-quality transgenosis new product boar of high muscle fat, thereby can greatly improve meat quality, create huge economic benefit and social benefit, better be the service of mankind's productive life, using gene engineering technique is improved the meat quality scientific and effective method of can yet be regarded as.

The present invention utilizes relevant Protocols in Molecular Biology, in pig MCK gene promoter and the gene constructed pEGFP-N1 carrier to not containing EGFP (enhanced green fluorescence protein) of DGAT1, and utilize the carrier that builds to obtain transgenic mice by pronuclear microinjection, by detecting triglyceride level and the fatty acid content in muscle tissue, verified the raising of intramuscular fat.

Summary of the invention

The objective of the invention is to be to provide the MCK-DGAT1 carrier of a boar genetic expression, this carrier has the myogenic expression specificity, and can obviously increase the content of triglyceride level and lipid acid in animal individual muscle.Can obtain by transgenic technology the new variety of high intramuscular fat, improve meat quality, shorten conventional breeding and cultivate the required time of high intramuscular fat.

Another object of the present invention is the preparation method who has been to provide the MCK-DGAT1 carrier of a boar genetic expression, and the method has obtained the 7kb sequence of pig MCK gene promoter by the gene technology of arresting, connected pig DGAT1 gene.

The present invention is achieved in that

studies show that on people and mouse, the DGAT1 gene is a gene that is closely related with triglyceride levels, the applicant is by synthetic pig cDNA full length sequence, and itself and gene are arrested the MCK gene promoter sub-connection of acquisition, obtained the pEGFP-N1-MCK-DGAT1 expression vector, obtained positive transgenic mice by pronuclear microinjection, the expression of pig DGAT1 gene in different tissues of mice that then utilized reverse transcription PCR (hereinafter to be referred as RT-PCR) methods analyst, result shows that the expression amount of pig DGAT1 gene in positive transgenic mice skeletal muscle is apparently higher than other tissue that detects and negative mouse.Then the expression of pig DGAT1 gene protein level in mice skeletal that utilized the WesternBlot methods analyst, result show pig DGAT1 gene in the skeletal muscle of positive transgenic mice protein level in negative mice skeletal.Then, the applicant has measured the content of triglyceride in the mice skeletal, and result shows that the triglyceride level storage in little positive transgenic mice skeletal muscle has increased.At last, the applicant has prepared the muscle section of mice skeletal and has dyeed with oil red, and result shows that the lipid content in positive transgenic mice skeletal muscle also increases.Experimental result shows, utilizes the expression vector of pig DGAT1 gene and muscle specific expressing gene MCK promotor structure, can improve the content of intramuscular fat.

The preparation method of the MCK-DGAT1 carrier of one boar genetic expression the steps include:

A, by a large amount of documents and materials of searching, the biochemical functions of the DGAT1 gene of reporting according to previous literature thinks that pig DGAT1 gene is an important candidate gene that affects the pig intramuscular fat content.Utilize the American National biotechnology (NCBI of information center, National Center for Biotechnology Information, http://www.ncbi.nlm.nih.gov) website has obtained cDNA full length sequence and synthetic this gene of pig DGAT1 gene.

B, next, the applicant has designed two pairs of Auele Specific Primers, and (its numbering is respectively T ₁F, T ₁R and T ₂F and T ₂R) the two ends distinguished sequence at amplification pig MCK gene promoter two ends, be connected to the pEGFP-N1 carrier (available from sky, Beijing bounties Gene Tech. Company Limited, article No.: 100401), on this basis, arrest technology by gene, obtain the promotor of complete pig MCK gene, the promoter sequence total length is 7121bp.

C, then, applicant with pig DGAT1 Gene Replacement the GFP gene on the pEGFP-N1-MCK carrier, completed the structure of MCK-DGAT1 expression vector.Then, obtained the transgenic mice of this expression vector by pronuclear microinjection, and done the detection of rna level and protein level on transgenic mice.Experimental result shows, utilizes the expression vector of pig DGAT1 gene and muscle specific expressing gene MCK promotor structure, can improve the content of intramuscular fat.

D, the pig DGAT1 assignment of genes gene mapping are in SSC4pl (Nonneman D, Rohrer G A, 2002), cDNA total length 1935bp has comprised 5 ' UTR of 198bp, the encoding sequence of 1470bp and 3 ' UTR of 261bp, research finds that the cDNA of pig DGAT1 gene cDNA encoding district and mouse, people and Niu has 83%, 88% and 91% nucleic acid homology, 489 amino acid of cDNA proteins encoded have 85%, 86% and 92% homology with mouse, people and bovine protein.Research finds that the in-house triglyceride levels of DGAT1 deficient mice white adipose has reduced, and can by increasing the obesity of energy consumption mechanisms opposing diet induced, also increase the susceptibility to leptin and Regular Insulin.These results show that DGAT1 plays an important role in the process of adjusting energy metabolism.Cross the C57BJ/L6 mouse of expressing people DGAT1 gene at fatty tissue, feed through high lipid food, with negative mouse contrast, body weight has increased by 20%, and adipocyte is loose.Same mistake expression people DGAT1 gene in FVB mouse fatty tissue, the body weight of positive mouse also obviously increases, and the DAG intake increases, and the TAG resultant quantity in fatty tissue significantly increases.People MCK-DGAT1 transgenic mice DAG intake and TAG resultant quantity also significantly increase.

The MCK-DGAT1 carrier of E, a kind of separation of acquisition in above-mentioned steps C, its sequence is the nucleotide sequence shown in SEQ ID NO:1.By the transgenic mice that this carrier obtains, at rna level and protein level, DGAT1 genetic expression significantly increases, and significant variation has also occured some genes on the metabolism of fat path.TAG resultant quantity and fatty acid content in the individual muscle tissue of mouse also obviously improve.This expression vector can improve the pig intramuscular fat content finally for the preparation of transgenic pig, thereby can greatly improve meat quality, cultivates the high-quality transgenosis new product boar of high muscle fat.

The invention has the advantages that:

(1) the present invention is combined pig DGAT1 gene first and is consisted of expression vector with the MCK gene promoter, for pig genetically engineered and molecular breeding provide new expression vector resource.

(2) the present invention utilizes transgenic mice to verify simultaneously, has improved reliability and the verity of experiment, and the expression vector of identifying can be applied directly to pig transgenic engineering and molecular breeding.

(3) expression vector that builds of the present invention can significantly improve triglyceride level and the intramuscular fat content of animal individual.

(4) rna level, DGAT1 genetic expression has increased thousands of times, protein level, DGAT1 has increased approximately 2 times, TAG resultant quantity in the individual muscle tissue of mouse significantly increases, improved closely 20%, the fatty acid content in muscle also obviously improves, and can find out that by the muscle section fatty deposits of positive mouse is obviously more than negative mouse.

Description of drawings

Fig. 1 is a kind of experiment process figure.

Fig. 2 is a kind of MCK gene promoter homology arm 1PCR amplification figure.

Fig. 3 is a kind of MCK gene promoter homology arm 2PCR amplification figure.

Fig. 4 is a kind of homology arm 1﹠amp; 2 are connected to pcr amplification detection figure on the pMD-18 carrier.

Fig. 5 is a kind of homology arm 1﹠amp; 2 are connected to pcr amplification detection figure on the pEGFP-N1 carrier.

Fig. 6 is a kind of pcr amplification detection figure after the MCK promotor that arrests.

Fig. 7 is pcr amplification detection figure after a kind of connection DGAT1 gene.

Fig. 8 is a kind of plasmid MCK-DGAT1 structural representation.

Fig. 9 is a kind of transgenic mice positive and negative pcr amplification detection figure.

Figure 10 is muscle, lung, kidney, liver, brain, the heart, intestines, spleen, the fat of the transgenic mice in a kind of two monthly ages and age in April and non-transgenic mouse, the express spectra of ovary tissue DGAT1.

Figure 11 is a kind of transgenic mice and non-transgenic mouse DGAT1, DGAT2, ACC1, the isogenic RT-PCR analysis chart of ACC2.

Figure 12 is that a kind of transgenic mice and non-transgenic mouse muscle muscle Western Blot analyze.

Figure 13 is a kind of transgenic mice and the analysis of non-transgenic Muscle Tissue content of triglyceride.

Figure 14 is a kind of transgenic mice and the analysis of non-transgenic Muscle Tissue section lipid content.

Embodiment

Embodiment 1:

(the Genbank accession number is: AC139878) (the Genbank accession number is pig muscle specific expression gene MCK: NM-214051.1) consist of expression vector for promotor and pig DGAT1 gene.

1. main agents: Taq archaeal dna polymerase (Fermentas company product), dNTP (Roche company, 4738284001), DL-2000Marker (Guangzhou Dongsheng bio tech ltd), TIANgen Mini sepharose DNA reclaims test kit (day root company product, DP208-02), restriction enzyme SnaB I, Sal I, Nde I, Ase I, Not I, PspOM I, Swa I (NEB company product, R0130S, R0138S, R0111S, R0526S, R0653S, R0646S), T4DNA ligase enzyme (NEB company product, M0202S), the little extraction reagent kit of TIANprep Mini plasmid sky root company product, DP103-02), carrier pMD18-T Vector is (available from precious biotechnology (Dalian) company limited, article No.: D101A) etc.

2. tissue sample: pig muscle tissue DNA

3. carrier construction:

With the MCK gene cDNA sequence of pig, its Genbank accession number is AC139878, adopts Primer 5.0 software design primer pair amplifications, homology arm primer (T ₁F:5 '-catatgGAGGTTCCCAGACTAG-3 ', T ₁R:5 '-tacgtaGCACAGCGGGTTAAGGATC-3 ', the clip size of amplification is 355bp; T ₂F:5 '-tacgtaGGCAAATCACGCAGCCT-3 ', T ₂R:5 '-gtcgacAAAGGACAGGACTGCAGCCCT-3 ', the clip size of amplification is 509bp).(in above-mentioned primer, small letter is partly restriction enzyme site, is respectively Nde I, SnaB I, SnaB I, Sal I successively).

(1) the PCR reaction system is merged in preparation: 12.5 μ l2 * GC B μ ffer, and 0.5 μ l10mM dNTP, 0.25 μ l5U/ μ lTaq Polymerase take pig muscle tissue DNA 1 μ l as template, mends sterilization ultrapure water to 25 μ l.

(2) fusion of PCR product: 94 ℃ of denaturation 4min; 94 ℃ of sex change 40s; 60 ℃ of annealing 80s; 72 ℃ are extended 80s.

The recovery purifying of PCR product: the homology arm 1 of amplification, 2 PCR product are after agarose gel electrophoresis detects, the gel that will contain the purpose fragment under ultraviolet lamp from the sepharose downcuts, put into the 1.5mLEpendorff pipe, then reclaim test kit (article No.: DP208-02 is available from sky root company) purified pcr product with sepharose DNA.

Ligation: the homology arm 1 of purifying, 2 PCR product are connected with pMD18-T carrier (available from TAKARA company) respectively, the ligation cumulative volume is 10 μ l, comprising 2.5 μ l2 * ligation buffer, and 0.3 μ l carrier, 7.2 μ l purified pcr product, 4 ℃ of connections of spending the night.

Transform: get 50～100 μ l competent cells under sterile state in 1.5ml Ependorff pipe, the connection product of 5～10 μ l is added mixing gently, place 42 ℃ of heat shock 90s after 30min on ice, do not shake the Ependorff pipe therebetween, rapid ice bath 3～4min after taking out, the LB nutrient solution that adds 200 μ l antibiotic-frees, 37 ℃, the 220rpm/min temperature is bathed recovery 45-60min.Then the centrifugal 5min of 5000rpm/min removes supernatant, with remaining thalline and substratum mixing gently, containing penbritin (Amp) concentration is on the flat board of 100 μ g/mL, smoothen, just putting to cultivate to be inverted after 1h for 37 ℃ and cultivating, observe after 14-16 hour and have or not bacterium colony to grow.

The evaluation of positive colony and order-checking: to contain 500 μ L penbritin (Amp) concentration be the LB nutrient solution of 100 μ g/mL to picking mono-clonal access 1.5mL from flat board, and cultivate approximately 4-6h left and right in 37 ℃ of shaking table 220rpm/min.Take bacterium liquid as template, select specific amplification primer T ₁F﹠amp; T ₁R, T ₂F﹠amp; P ₁R (CAGCTATGACCATGATTACGCCAAG) identifies.

After identifying correctly, extract plasmid with the little extraction reagent kit of plasmid (article No.: DP103-02 is available from sky root company).Then with Sal I and SnaBI double digestion plasmid, the fragment that contains homology arm 1 that obtains after reclaiming is connected on the plasmid that contains homology arm 2 with SnaB I single endonuclease digestion, proceeds to transform.With specific amplification primer T ₁F﹠amp; T ₂R carries out the PCR electrophoresis detection to be identified, obtains positive colony, and the bacterium liquid of positive colony is sent to order-checking, and sequencing is completed by Beijing AudioCodes biotechnology limited liability company.Sequencing result shows that the sequence that increases is the homology arm sequence of pig MCK gene promoter.With Nde I and Sal I double digestion plasmid, obtain to contain homology arm 1﹠amp after reclaiming; 2 fragment.The pEGFP-N1 plasmid has added a 14bp to contain the fragment of Swa I restriction enzyme site after cutting with the AseI enzyme, then with Ase I and Sal I double digestion, the homology arm 1﹠amp that connection obtains above; 2 fragments then transform, with specific amplification primer T ₁F﹠amp; T ₂R carries out the PCR electrophoresis detection to be identified, obtains the sub-pEGFP-N1-TYB1﹠amp of positive colony; 2, the bacterium liquid of positive colony is sent to order-checking, sequencing is completed by Beijing AudioCodes biotechnology limited liability company.Utilize then that teacher's Chen Hongxing of Military Medical Science Institute patent---gene is arrested technology, arrest out MCK gene promoter sequence 7121bp from pig BAC.With specific amplification primer pair P ₂F (GCTTCTGGCCTGGCTTTGAGTC) ﹠amp; P ₂R (GCCTCCTCACTACTTCTGGAAT) carries out PCR to be identified.Identify at last pig DGAT1 gene to be connected to the promotor downstream after correct, with specific amplification primer pair P ₂F (GCTTCTGGCCTGGCTTTGAGTC) ﹠amp; P ₃RGAGCGACAGCCACACAGCCGCGTTG carries out PCR to be identified, the expression vector that acquisition builds, and in this carrier, middle EGFP gene is by DGAT1 gene substitution.

4. expression vector is through delivering the synthetic transgenic mice of Invitrogen (Shanghai) company.

At the final MCK-DGAT1 carrier that obtains a kind of separation of above-mentioned steps, its sequence is the nucleotide sequence shown in SEQ ID NO:1.

Embodiment 2:

Synthetic, the tissue expression analysis of the extraction of transgenic mice total tissue RNA, cDNA and fluorescence quantitative PCR detection.

1. main agents:

The DNA extraction test kit of test use is (available from Bio Teke company, article No.: DP1901); TransEco FastPfu DNAPolymerase (available from the Beijing Quanshijin Biotechnology Co., Ltd, article No.: AP231); 2 * GC Buffer is (available from precious biotechnology (Dalian) company limited, article No.: DRR20GCI), LA Taq polysaccharase is (available from precious biotechnology (Dalian) company limited, article No.: DRR20BG), dNTP is (available from Roche company, article No.: 47382001), DL-2000Marker (available from Guangzhou Dongsheng bio tech ltd), TIANgel Mini sepharose DNA reclaim test kit (day root company product, DP208-02) etc.

2. the extraction of transgenic mice total tissue RNA and cDNA's is synthetic:

The Trizol Reagent test kit of Invitrogen company is adopted in the extraction of each total tissue RNA, specification sheets according to this test kit operates, total RNA utilizes agarose gel electrophoresis to detect its integrity (28S, two master tapes of 18S clear), and the purity of total RNA utilizes NanoDrop 2000Spectrophotometer (U.S. NanoDrop company) to detect (OD260/OD280=1.8-2.0).Total up-to-standard rear follow-up test of just carrying out of RNA.The synthetic TOYOBO ReverTra of company that utilizes of cDNA the first chain

QPCR RT Kit test kit carries out, by the specification sheets operation of this test kit.Concrete steps are as follows: at first get each total tissue RNA solution of 1 μ g in the little PCR pipe of the sterilization of 200 μ l, in 65 ℃ of sex change 5min, secondary structure is opened, then be placed on ice immediately.Then add respectively 4 μ l5 * RT buffer, 1 μ lPrimer Mix, 1 μ lRT EnzymeMix, then mend Nuclease-free Water 20 μ l, and in 37 ℃ of reverse transcription 15min, then 98 ℃ are carried out the 5min enzyme-deactivating, and reaction finishes rear in-20 ℃ of preservations.

3. the tissue expression analysis of transgenic mice DGAT1 gene:

Take 20 histioid the first chain cDNA of transgenic mice of being synthesized as template, utilize the sxemiquantitative primer of the testing goal gene DGAT1 of design to carry out pcr amplification, simultaneously reference gene β-actin of the mouse of correcting increased.PCR reaction conditions: 94 ℃ of 5min, 94 ℃ of 40sec, 65 ℃ of 40sec, 72 ℃ of 20sec, 30 circulations, 72 ℃ of 10min.The PCR product detects through agarose gel electrophoresis.Detected result is seen shown in accompanying drawing 2.The result demonstration, the expression amount of DGAT1 gene in the transgenic positive mice skeletal is significantly higher than the tissue that other detects.

4. the fluorescence quantitative PCR detection of transgenic mice muscle tissue:

Take the first chain cDNA of the transgenic mice muscle tissue sample that synthesized as template, utilize the primer of the fluorescent quantitation of design to carry out pcr amplification, simultaneously reference gene β-actin of the mouse of correcting increased.Quantitative fluorescent PCR reaction conditions: 95 ℃ of 5min, 94 ℃ of 20sec, 60 ℃ of 30sec, 72 ℃ of 20sec, 35 circulations, 72 ℃ of 5min

The primer sequence information that table 1 the present invention is designed

Embodiment 3:

The detection of transgenic mice protein level and the mensuration of content of triglyceride:

1. main agents:

The RIPA lysate is (available from green skies company, article No.: P0013D), PMSF is (available from green skies company, article No.: ST506), the DGAT1 primary antibodie is (available from abcam company, article No.: ab59034), the anti-sheep of HRP rabbit two anti-(available from antgene company, article No.: dye ANT013), in advance albumen Marker (available from Fermentas company, article No.: SM0441), 2*Loading Buffer (available from sky root company, article No.), OCT embedding medium (available from SakuraFinetek company, article No.: 4583) etc.

2.Western?Blot

(1), collect protein sample (Protein sample preparation)

Can use green skies RIPA lysate, the cracking group tissue samples.After collecting protein sample, consistent for the applied sample amount of guaranteeing each protein sample, utilize NanoDrop 2000Spectrophotometer (U.S. NanoDrop company) to measure the protein concentration of each protein sample.

(2), electrophoresis (Electrophoresis)

The preparation of SDS-PAGE gel:

Prepare 9% separation gel (15ml): distilled water 6.55ml, 1.5MTris-HCl (pH8.8) 3.75ml, 30% acrylamide storage liquid (Acry/Bis) 4.5ml, 10%SDS 150ml, 10% ammonium persulphate (APS) 50ml adds 3.75ml TEMED, immediately mixing after mixing, pour in the vertical panel that installs the about 2cm place to distance short glass top.Check whether bubble is arranged, if having, with the sucking-off of filter paper bar.Add one deck distilled water on glue, standing, when the interface of gel and water is clear, separation gel polymerization (approximately 30 minutes) is described, remove water, blot remaining liquid with filter paper.

The concentrated glue (10ml) of preparation 4%: distilled water 6.1ml, 0.5M Tris-HCl (pH6.8) 2.5ml, 30% acrylamide storage liquid (Acry/Bis) 1.3ml, 10%SDS 100ml, 10% ammonium persulphate (APS) 50ml, add 10ml TEMED after mixing, mixing, pour in vertical panel to short glass top immediately, insert comb, avoid producing bubble, standing, approximately after 60 minutes, the glue polymerization, take out comb, rinse well with electrode buffer, to remove unpolymerized acrylamide.

Gel is fixed in electrophoresis chamber, and the up and down groove respectively adds 1 ' Tris-glycine electrophoretic buffer, drives away the bubble of gel bottom between two sheet glass.

Sample preparation:

The SDS-PAGE albumen sample-loading buffer that adds 10 μ l 2X in the protein sample of collecting, 100 ℃ or boiling water bath heating 3-5 minute are with abundant metaprotein.

Loading and electrophoresis:

After cool to room temperature (20-25 ℃, below identical), protein sample directly is loaded in SDS-PAGE glue well gets final product.For the ease of observation electrophoretic effects and transferring film effect, and judgement molecular weight of albumen size, pre-dsred protein molecular weight standard used.

Use low voltage constant voltage electrophoresis when usually being recommended in upper strata glue during electrophoresis, and use high-voltage constant voltage electrophoresis when tetrabromophenol sulfonphthalein enters lower floor's glue.For standard electrophoresis apparatus or the similar electrophoresis apparatus of Bio-Rad, low voltage can be arranged on 80-100V, and high-voltage can be arranged on the 120V left and right.For the purpose of electrophoresis is convenient, also can adopt the mode of whole SDS-PAGE process constant voltage, usually voltage is arranged on 100V, then setting timing is 90-120 minute.Arranging regularly to avoid recurrent electrophoresis excessive.Get final product stop electrophoresis near the place, bottom of tetrabromophenol sulfonphthalein arrival glue during common electrophoresis, perhaps can according to the electrophoresis situation of pre-dsred protein molecular weight standard, estimate that target protein is got final product stop electrophoresis after appropriate separation.

(3), transferring film (Transfer)

The applicant selects pvdf membrane in the Western experiment, use the standard wet type membrane-transferring device of Bio-Rad, and setting the transferring film electric current is 300-400mA, and the transferring film time is 30-60 minute.Also can spend the night in the 15-20mA transferring film.The concrete transferring film time will decide according to the size of target protein, and the molecular weight of target protein is larger, and the transferring film time that needs is longer, and the molecular weight of target protein is less, and the transferring film time that needs is shorter.In the transferring film process, particularly during the quick transferring film of high electric current, usually have very serious fever phenomenon, need be placed on the transferring film groove to carry out transferring film in ice bath.The pre-dsred protein molecular weight standard that the effect of transferring film can observation post be used, the 1-2 band of molecular weight maximum is more difficult usually all forwards on film.

(4), sealing (Blocking)

After transferring film is complete, immediately protein film is placed in preprepared Western washings, rinsing 1-2 minute, to wash away the transferring film liquid on film.All steps after complete from transferring film must be noted the moisturizing of film, avoid the drying of film, otherwise very easily produce higher background.Remove washings, add the Western confining liquid, slowly shake on shaking table, room temperature sealing 60 minutes.For the higher antibody of some backgrounds, can spend the night 4 ℃ of sealings.

(5), primary antibodie is hatched (Primary antibody incubation)

With reference to the specification sheets of primary antibodie (available from Abcam company), according to suitable proportion Western primary antibodie diluted primary antibodie.Remove confining liquid, add immediately the good primary antibodie of dilution, room temperature or 4 ℃ slowly shake on the side-sway shaking table hatches one hour.If primary antibodie is hatched one hour poor effect, can slowly shake overnight incubation at 4 ℃.Reclaim primary antibodie.Add the Western washings, slowly shake washing 5-10 minute on the side-sway shaking table.After exhausting washings, then add washings, washed 5-10 minute.Wash altogether 3 times.Can the proper extension washing time and increase washing times if background is higher as a result.

(6) two anti-hatch (Secondary antibody inucubation)

With reference to the specification sheets of two anti-(available from Pierce companies), resist with two of the anti-diluted horseradish peroxidase of Western two (HRP) mark according to suitable proportion.Remove washings, add immediately good two anti-of dilution, room temperature or 4 ℃ slowly shake on the side-sway shaking table hatches one hour.Reclaiming two resists.Add the Western washings, slowly shake washing 5-10 minute on the side-sway shaking table.After exhausting washings, then add washings, washed 5-10 minute.Wash altogether 3 times.Can the proper extension washing time and increase washing times if background is higher as a result.

(7), Protein Detection (Detection of proteins)

Detect albumen with reference to TIANgen enhancement type HRP-DAB substrate colouring reagents box (article No.: PA110 is available from sky root company limited).

3. the mensuration of triglyceride level

(1) animal tissues's cracking, centrifuge tube is accurately weighed, and weighs after adding tissue block again, both subtract each other, obtain the 50mg tissue, the 1mg tissue adds 20 μ l lysates, can significantly reduce albumen and the lipid content variation of each sample room, and strongly recommend the lysate consumption in 1ml left and right homogenate.

(2) get 500 μ l lysates and transfer to the 1.5ml centrifuge tube, 70 ℃ of heating 10min flocks may occur when tissue mass is many, the centrifugal 5min of fingerprint 2000rpm, and the upper strata stillness of night namely can be used for enzymatic determination.

(3) configuration effort solution: in 4: 1 ratios, get 4ml reagent R1 and mix with 1ml reagent R2 and get final product, use immediately or 4 ℃ of preservations are less than 1 day.

(4) standard substance dilution: 4mM glycerine standard substance distilled water diluting is 1000,500,250,125,62.5,31.25,15.625, notes arranging 0 concentration and control reaction pipe.

(5) recommend take 10 μ l as initial application of sample amount, surpassing linearity range as observed value can suitably dilute, according to the extension rate calculating concentration.

37 ℃ of 10 minutes or 25 ℃ 20 minutes, after molecular balance, color is stable in 60 minutes, first with the zeroing of distilled water blank tube, then measures and respectively manages the OD value.The drawing standard curve also calculates triglyceride concentration, and the Excel mapping---each standard pipe OD value is the y axle, draws the formula of typical curve, y-0.7689x-0.0043, R ²=0.9998

4. muscle tissue section oil red dyeing

The freezing treatment of muscle tissue: make and organize quick freezing, the ice crystal of avoiding cutting into slices forms.

Cut into slices after the embedding of OCT embedding medium: the embedding action wants fast, prevents that tissue from thawing; Section will be got the square section of tissue; Section can be slightly thick, 7～10 μ m;-20 ℃ of preservations are put in section.

Staining procedure:

(1) freeze section

(2) distilled water fully washs.

(3) the oil red diluent dyed 10-15 minute, lucifuge, sealing.The preparation of oil red diluent:

(4) get 6 milliliters of oil red saturated solutions, 4 milliliters of adding distil waters use after filtering after standing 5-10 minute.

Between breaking up extremely under (5) 60% ethanol mirrors, matter is clear.

(6) washing.

(7) the MarryShi Hematorylin is redyed core.

(8) washing.

(9) glycerine or glycogelatin mounting.

Result: fat is bright red, and it is blue that nucleus is, and a matter is colourless.

Claims (2)

1. the MCK-DGAT1 carrier of a separation, its sequence is the nucleotide sequence shown in SEQ ID NO:1.

2. the preparation method of the MCK-DGAT1 carrier of a boar genetic expression claimed in claim 1, the steps include:

A, basis DGAT1Gene has obtained pig DGAT1The cDNA full length sequence of gene and synthetic this gene;

B, two pairs of primer amplified pigs have been designed MCKThe two ends distinguished sequence at gene promoter two ends is connected on the pEGFP-N1 carrier, arrests technology by gene, obtains complete pig M CKThe promotor of gene, promoter sequence total length are 7121bp;

C, use pig DGAT1Gene Replacement on the pEGFP-N1-MCK carrier GFPGene has been completed the structure of MCK-DGAT1 expression vector, then, has obtained the transgenic mice of this expression vector by pronuclear microinjection, and done the detection of rna level and protein level on transgenic mice, and experimental result shows, utilizes pig DGAT1Gene and muscle specific expressing gene MCKThe expression vector that promotor builds.

Images