CN100569941C - G6PD defect type A 375 stably transfected cell strains and construction process thereof - Google Patents
G6PD defect type A 375 stably transfected cell strains and construction process thereof Download PDFInfo
- Publication number
- CN100569941C CN100569941C CNB2008100580641A CN200810058064A CN100569941C CN 100569941 C CN100569941 C CN 100569941C CN B2008100580641 A CNB2008100580641 A CN B2008100580641A CN 200810058064 A CN200810058064 A CN 200810058064A CN 100569941 C CN100569941 C CN 100569941C
- Authority
- CN
- China
- Prior art keywords
- cell
- g6pd
- sirna
- expression
- slow virus
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Expired - Fee Related
Links
Images
Landscapes
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The present invention relates to the Medical Molecular Biology technology, especially adopt the siRNA perturbation technique to make up the research cell model.G6PD defect type A 375 stably transfected cell strains of the present invention be with the A375 cell strain through siRNA-slow virus expression system target silence the expression amount of endogenous G6PD more than 80%, and contain dna double chain fragment and green fluorescent protein GFP gene can green-emitting fluorescence steady commentaries on classics cell strain.The application uses the reticent human skin malignant melanoma A375 of siRNA-slow virus system cell endogenous G6PD and expresses more than 80%, has made up the G6PD defect type A 375 stably transfected cell strains, and its function has been carried out preliminary discussion.This cell model can be used for probing into the dependency and the mechanism thereof of G6PD and tumour; Also can be used for the research of tumour cell anti-oxidation stress; Also can be used as the model of people's malignant melanoma study of pathogenesis.
Description
Technical field
The present invention relates to the Medical Molecular Biology technology, especially adopt the siRNA perturbation technique to make up the research cell model.
Background technology
Tumour cell is propagation and breaks up cell out of control, there is the oxidation antioxidation loss of equilibrium, as ovarian cancer and kidney cancer cell reduced glutathion (reduced glutathione hormone, GSH) and the active change of metabolic enzyme (glutathione reductase, Selenoperoxidase etc.) relevant with clinical stages.GSH is the oxidation resistant topmost mechanism of eukaryotic cell, and keeping of its level mainly depends on NADPH, and the latter is mainly derived from phosphopentose pathway.G6PD (glucose-6-phosphatedehydrogenase, glucose-6-phosphate dehydrogenase (G6PD), EC1.1.1.49) be the key enzyme of phosphopentose pathway, it also is special enzyme, at all histocytes expression is arranged all, its assignment of genes gene mapping is in gene high density area Xq2.8 (NM_000402), and total length 18kb is made up of 13 exons and 12 introns; MRNA total length 2395bp, cDNA are 1548bp, 515 amino acid of encoding.In addition, phosphopentose pathway also provides five ribose phosphoric acids, and is as nucleic acid synthetic raw material, closely related with the abnormality proliferation of tumour cell.
Human esophagus cancer cell G6PD can be higher than normal more than 10 times; But the NIH 3T3 injection cell that will be higher than 2-16 times of G6PD expression of contrast produces tumour to the subcutaneous rapid induction nude mice of nude mice, and the size of tumour is relevant with the active height of G6PD.Yet epidemiologic observation is relatively poor to G6PD defective nasopharyngeal carcinoma patient prognosis, the recurrence rate height.(Confocal laserscanning microscopy CLSM) confirms fibrosarcoma cell low express of G6PD at apoptosis to confocal laser scanning microscope, CLSM.Ohl etc. during house-keeping gene, find G6PD unstable expression and relevant with the grade malignancy of tumour in detecting human bladder cancer and prostate cancer cell.Domestic Zhang Detai finds that (Dehydrooepian-drosterane is DHEA) by suppressing the lymphadenomatous growth of Burkit of can slowing down of cell G6PD enzymic activity for the noncompetitive inhibitor dehydroepiandrosterone of G6PD.
As seen, the generation of G6PD and tumour, development, clinical manifestation and treatment all have relation.Yet, do not illustrate the relation and the mechanism thereof of G6PD and tumour so far as yet, even inconsistent viewpoint and conclusion arranged.One of reason may be the interference of tumour cell endogenous G6PD.
Up to now, the G6PD deficient cells of bibliographical information has three sources, all is not people's tumour cell.The CJ7 mouse embryo stem cell of first G6PD defective (CJ7 G6PD Δ ES), adopt the locus specificity recombinant technology of Cre/lox system mediation by the Filosa laboratory, transient expression Cre recombinase obtains in G6PD-Loxed, and is used for the research of oxidative damage and mechanism thereof.The secondth, Pandolfi etc. separate from mouse 129sv phage genome library and obtain goal gene, make up the positive and negative carrier of selecting, change ABI ES cell over to through electroporation, " G6PD null ES cells " found in the screening back from 156 mono-clonals, the activity of its G6PD table is 14% of a normal control, is used for the research of the hemolytic disease gene therapy that the G6PD major defect causes.The cell of the 3rd G6PD defective is Chinese hamster ovary cell E89 or E48 (Chinese hamster ovary cell, CHO), obtain from the Chinese hamster ovary celI screening that contains the G6PD mutant by Stamato etc., its activity is about 10% of CHO K1 (wild-type), is used for ionization radiation injury and mechanism research thereof.So far, in human tumor research, do not see the report of G6PD deficient cell as yet.
In China, though not high about 1,/10 ten thousand population of the sickness rate of malignant melanoma, but be continuous ascendant trend, have grade malignancy height, course of disease progress rapidly, easily shift, characteristics such as, poor prognosis insensitive and mortality ratio height to conventional chemotherapy and radiotherapy, become long-term puzzlement doctor's a difficult problem.Melanomatous pathogeny and research thereof also are the technical barriers that needs to be resolved hurrily.
Summary of the invention
Purpose of the present invention aims to provide a kind of G6PD defect type A 375 stably transfected cell strains, is used to study the dependency and the mechanism thereof of G6PD and tumour as model.
Another object of the present invention is to provide the construction process of this cell strain.
G6PD defect type A 375 stably transfected cell strains of the present invention be with the A375 cell strain through siRNA-slow virus expression system target silence the expression amount of endogenous G6PD more than 80%, and contain dna double chain fragment 5 '-GATCCCGCCTCAGTGCCACTTGACATTGATATCCGTGTCAAGTGGCACTGAGGCTT TTTTCCAAC-3 ' and 5 '-TCGAGTTGGAAAAAAGCCTCAGTGCCACTTGACACGGATATCAATGTCAAGTGGCA CTGAGGCGG-3 ', and the steady commentaries on classics cell strain of the energy green-emitting fluorescence of green fluorescent protein GFP gene.
Above-mentioned A375 cell strain is a prior art, purchases the cell bank in the Chinese Academy of Sciences.It derives from a female skin malignant melanoma patient of 54 years old, is set up by people such as D.J.Giard, and adherent growth belongs to epithelial cell, has tumorigenicity (making immunosuppressant mouse produce the Subcutaneous tumor that is similar to malignant melanoma).Be shown as the hypo-triploid cell that contains 62 homologous chromosomess through CYTOGENETIC ANALYSIS OF ONE, 9 marker chromosomess are arranged, the STR site on its DNA has: Amelogenin:X; CSF1PO:11,12; D13S317:11,14; D16S539:9; D5S818:12; D7S820:9; THO1:8; TPOX:8,10 and vWA:16,17.G6PD defect type A 375 stably transfected cell strains of the present invention is that above-mentioned dna double chain fragment is inserted the pRNAT-U6.2/Lenti expression vector that contains the GFP green fluorescence, change the A375 cell strain again over to, in cell, express siRNA, screen through positive cell clone, siRNA target silence the expression amount of endogenous G6PD more than 80%, and the steady commentaries on classics cell strain of 95% above cell expressing green fluorescent protein.
The construction process of G6PD defect type A 375 stably transfected cell strains of the present invention is made up of following steps:
One, the design of siRNA sequence, dna profiling is with synthetic
With the siRNA:5 '-GCCTCAGTGCCACTTGACA-3 ' of OligoEngine RNAi software design at people G6PD gene (GenBank:NM_000402) 3 ' end non-coding region, and with the irrelevant sequence of siRNA:
5 '-TTCTCCGAACGTGTCACGT-3 ' is contrast, synthetic respectively again two complementations also contain siRNA or the dna profiling of the positive-sense strand of control sequence and antisense strand, middle Loop structure with 10 deoxynucleotides links to each other, after connect KNA PolyIII transcription pausing point, drive and introduce BamHI and XhoI restriction enzyme site at two ends: the dna profiling corresponding to the siRNA of people G6PD gene 3 ' end non-coding region is:
5 '-GATCCCGCCTCAGTGCCACTTGACATTGATATCCGTGTCAAGTGGCACTGAGGCTT TTTTCCAAC-3 ' and 5 '-TCGAGTTGGAAAAAAGCCTCAGTGCCACTTGACACGGATATCAATGTCAAGTGGCA CTGAGGCGG-3 '; And corresponding to the dna profiling of control sequence be:
5 '-GATCCCGTTCTCCGAACGTGTCACGTTTCAAGAGAACGTGACACGTTCGGAGAATT TTTTCCAAA-3 ' and 5 '-AGCTTTTGGAAAAAATTCTCCGAACGTGTCACGTTCTCTTGAAACGTGACACGTTC GGAGAACGG-3 ';
Two, make up the slow virus expression vector of siRNA
Through dilution, annealing, pRNAT-U6.2/Lenti is connected above-mentioned dna profiling with linear plasmid respectively; Transformed E .coli DH5 α again, spread plate, incubated overnight; Two single bacterium colonies of every group of sample picking detect through PCR, and the PCR condition is: 94 ℃ of 10min → 94 ℃ 30s → 55 ℃ of 30s → 72 ℃ 30s, totally 33 circulations; The positive bacterium colony of incubated overnight extracts the plasmid order-checking and identifies, for the correct positive colony of order-checking, extracts purifying and does not contain endotoxic recombinant plasmid dna;
Three, the production of slow virus particulate packing and viral liquid
With slow virus packaging plasmid mixture and siRNA slow virus expression plasmid cotransfection 293T cell; Be changed to the DMEM nutrient solution that contains 1%FBS in 24 hours; 48 hours collecting cells, the centrifugal 5min of 5000rpm is used as viral liquid to be measured after the pvdf membrane filtering supernatant of 0.45 μ m; With standard virus liquid 1 * 10
8Cfu/L (Colony forming unit) is contrast, two groups of samples by infection multiplicity (Multiplieity of infection, MOI) value is established 5 gradients: 1,3,5,10 and 20; Infect the intensity of observing the green fluorescence cell in 24 hours and quantity to determine virus titer, surpass 95% if express the cell of GFP, viral drop degree reaches 1.0 * 10
8Cfu/L can be used for subsequent experimental;
Four, virion infects A375 cell and the steady cell strain that changes of screening
Inoculation growth conditions good A375 cell to 6 orifice plate is with antibiotic-free, contain the DMEM substratum of 10%FBS, 37 ℃ and 5%CO
2Be cultured to the cell attachment of 70-80%; Add the slow mixing of viral liquid, changed liquid in 24 hours; G418 screening with 500ng/ul in 84-120 hour; Choose mono-clonal in 168-200 hour, and transferred to 24 orifice plates; Changed in 24 hours and contain antibiotic substratum; When the cell attachment of 70-80%, forward in 6 orifice plates and cultivate again; During the cell clone well-grown, amplification culture progressively; Whether stable, gone down to posterity 15-20 generation external if will surely change frozen repeatedly its luciferase expression of observation of cell strain, luciferase expression is stable, and siRNA is reticent, and G6PD expresses more than 80%, becomes G6PD defect type A 375 stably transfected cell strains (A375-G6PD Δ).
In view of the human tumor cell line of domestic and international shortage G6PD defective and the report of correlative study thereof, the application uses the reticent human skin malignant melanoma A375 of siRNA-slow virus system cell endogenous G6PD and expresses more than 80%, made up G6PD defect type A 375 stably transfected cell strains (A375-G6PD Δ), and its function has been carried out preliminary discussion.This cell model can be used for probing into the dependency and the mechanism thereof of G6PD and tumour; Also can be used for the research of tumour cell anti-oxidation stress; Also can be used as the model of people's malignant melanoma study of pathogenesis.
The G6PD defective type A375 cell that the application makes up unlike the prior art, its characteristics are the tumour cell of G6PD defect type human, and the prior art cell all derives from the normal cell of animal.The method that makes up also is different from prior art.The RNAi technology is the gene silent technology that fast development is in recent years got up, promptly in biological cell, (double-standed RNA dsRNA) causes the specific degraded of homologous mRNA to exogenous or endogenic double-stranded RNA, thereby suppresses the technology of destination gene expression.Its appear as analyzing gene function and signal transduction pathway and gene therapy aspect all provide a kind of new research means.Compare with technology such as traditional antisense nucleic acid, gene knockouts, have advantages such as high specificity, with strong points, cascade amplification.
The method that prepare at present siRNA has external preparation method (preparing siRNA as chemosynthesis, in-vitro transcription with the RNase III digestion lengthy motion picture double-stranded RNA that breaks) and expression in vivo method (as siRNA expression vector and siRNA expression framework); present technique adopts the siRNA-slow virus system of long-term reticent destination gene expression, comprises the 293T cell of slow virus expression vector (pRNAT-U6.2/Lenti), slow virus packaging plasmid mixture and generation virion.Its characteristics are as follows: the target sequence design of (1) siRNA is at 3 ' end non-coding region of people G6PD gene, after not only can observing endogenous G6PD " Knock down ", the change of cell growth and function, also ectogenic G6PD " Knock in " can be entered this cell, the recovery situation of observation of cell function.(2) dsDNA of clones coding siRNA advances between the BamH I and Xho I site under U6 promotor (rna plymerase iii promotor) control, help handling more corresponding bobby pin RNA (short hairpin RNA, shRNA) expression in the A375 cell, and stop transcribing by adding 6 U.(3) start the expression of green fluorescent protein GFP with the CMV promotor, so can directly follow the trail of transfection efficiency fast and accurately by fluorescent microscope.(4) SV40 promotor startup neomycin resistance gene is expressed available G418 screening, can be in order to set up steady commentaries on classics clone.(5) the slow virus packaging plasmid can provide packing RNA needed all accessory proteins, and contained HIV 5 ' LTR and HIV 3 ' LTR in the carrier in addition all helps the packing of virus, produces the viral liquid of high titre.(6) can infect division stage cell and non-division stage cell, and the siRNA that introduces the A375 cell is incorporated into host genome by means of slow virus, thus can stablize, long-term expression siRNA, thereby the expression of long-term reticent endogenous G6PD.
Description of drawings
Fig. 1 is at the siRNA target site of people G6PD gene and dna profiling sequence chart thereof.
Fig. 2 is the design of graphics of siRNA-slow virus expression vector.
Fig. 3 is positive recombinant plasmid figure for PCR detects.
Fig. 4 is the positive recombinant plasmid sequencer map of siRNA1.
Fig. 5 is the effective siRNA sequence chart of Real-time PCR screening.
Fig. 6 is slow virus packaging plasmid and siRNA1 slow virus recombinant plasmid cotransfection 24 hours fluorescence photo of 293T cell (100 *).
Fig. 7 dyes 24 hours fluorescence photo of 293T cell (40 *) for viral liquid inductance to be measured.
Fig. 8 dyes 24 hours fluorescence photo of 293T cell (40 *) for the standard virus liquid inductance.
Fig. 9 surely changes the photo (10 *) of cell under opticmicroscope for the A375-G6PD Δ.
Figure 10 surely changes the photo (10 *) of cell under fluorescent microscope for the A375-G6PD Δ.
Figure 11 is the Western blotting figure as a result of the G6PD of A375-WT and A375-G6PD Δ and β-actin.
Figure 12 is the Western blotting gray scale scanning figure as a result of G6PD.
Figure 13 is the G6PD determination of activity figure as a result of A375-WT and A375-G6PD Δ.
Figure 14 measures the growth curve chart of A375-WT and A375-G6PD Δ for mtt assay.
Figure 15 is the plate clone experimental result picture of A375-WT and A375-G6PD Δ.
Figure 16 is the cell cycle and the apoptosis measurement result figure of A375-WT and A375-G6PD Δ.
Embodiment
The design of siRNA sequence, dna profiling is with synthetic:
With three of OligoEngine RNAi software designs at the siRNA (for the cDNA of exogenous G6PD can be changed over to, so select non-coding region) of people G6PD gene (GenBank:NM_000402) 3 ' end non-coding region and the irrelevant siRNA sequence of a contrast; Again according to every siRNA, synthetic two complementary contain the dna profiling of siRNA positive-sense strand and antisense strand, middle Loop structure with 10 deoxynucleotides links to each other, the back is connected to RNAPolyIII polysaccharase transcription pausing site (TTTTTT), and introduces BamHI and XhoI restriction enzyme site (Fig. 1) at the template strand two ends.
Make up the slow virus expression vector of siRNA:
Article two, single stranded DNA template 1ug/ul, mixing, 95 ℃ of heating 10min, room temperature left standstill 1 hour, was diluted to final concentration 10ng/ul.Be connected 2 hour (Fig. 2) with expression plasmid pRNAT-U6.2/Lenti after the XhoI enzyme is cut at 22 ℃ with T4 dna ligase and BamHI; The ligation system contains linearized vector 0.1ug, dna profiling 1 μ l and T4 ligase enzyme 0.5 μ l.5ul connects product transformed competence colibacillus E.coli DH5 α, slow mixing, SOC substratum → 37 of 90 seconds → ice bath of 30 minutes → 42 ℃ water-baths of ice bath 2 minutes → add 900ul ℃ and 150 rev/mins of shaking tables cultivations 1 hour; Collect bacterium liquid, divide 100ul and 900ul coating LB flat board, 37 ℃ of incubated overnight.Two single bacterium colonies of four groups of each pickings of sample have 8 and detect positive recombinant plasmid (1-8 among Fig. 3) through PCR.The PCR primer is: 5 '-TACGATACAAGGCTGTTAGAGAG-3 ' and 5 '-TAGAAGGCACAGTCGAGG-3 '; The PCR condition is: 94 ℃ of 10min → 94 ℃ 30s → 55 ℃ of 30s → 72 ℃ 30s, totally 33 circulations.Get PCR product 5ul and go up sample, 1.5% agarose gel electrophoresis detects.The recombinant bacteria positive colony must comprise the segmental product 316bp (Fig. 3) that inserts siRNA.The positive bacterium colony of incubated overnight extracts plasmid DNA and through the UNIQ-10 column purification, order-checking identifies whether insertion sequence is correct.Fig. 4 shows that for the positive recombinant plasmid sequencing result of siRNA1 insertion sequence is correct.And siRNA2, siRNA3 and negative control sequence identify that too insertion sequence is correct.
Screen effective siRNA sequence:
Do not contain endotoxic plasmid DNA with the extraction of QIAGEN plasmid mini kit (Cat.No:12123) test kit.Inoculate in good A375 cell to 6 orifice plate of growth conditions 1.5 * 10
6Individual/well, to cultivate 24 hours, attached cell density reaches 75-80%, renews the substratum of bright DMEM+10%FBS; Get 6 Eppendorf pipes, wherein three pipes add Opti-MEM according to every hole 250 μ l, add the plasmid DNA of 4ug again; Other three pipes add Opti-MEM according to every hole 250 μ l, add the Lipofectamine of 10 μ l again
TM2000, leave standstill behind the 5min two kinds of liquid mixing, leave standstill 20min, be added drop-wise in the enchylema.37 ℃, 5%CO
224 hours visible cell forms of incubator cultivation are better, and adherent density can reach 70-80%, and by the fluorescence microscope experimental group, transfection efficiency can reach 45-55%, changes the D-MEM fresh culture of 10%FBS.Adherent density can reach 90% in 48 hours, and transfection efficiency can reach 60 above %, and luciferase expression slightly strengthens.Collecting cell extracts Total RNA with TRIZOL, through the synthetic cDNA of MMLV ThermoScript II.With β-actin is internal reference, and its primer is 5 ' CCTGTACGCCAACACAGTGC3 ' and 5 ' ATACTCCTGCTTGCTGATCC3 '; Goal gene G6PD primer is 5 ' CTGACCTACGGCAACAGATACAA 3 ' and 5 ' TGCCCTCATACTGGAAACCC 3 '; Fluorescence real-time quantitative PCR detects jamming effectiveness.The cycling condition of β-actin and G6PD: 94 ℃ of 5min → 94 ℃ 10s → 57 ℃ of 15s → 85.5 ℃ collection fluorescence 5s, totally 35 circulations.Each sample G6PD mrna concentration is divided by its β-actin mrna concentration, i.e. the relative content of sample for this reason.Cell among Fig. 5 (for the A375 cell of untransfected) and Lipo are (for only adding Lipofectamine
TM2000 A375 cell) in contrast, Neg (for the A375 cell of transfection negative control sequence), siRNA1, siRNA2 and siRNA3 (for the A375 cell of transfection corresponding sequence); From the G6PD relative content as can be known siRNA1 can make the expression level downward modulation of G6PD in the A375 cell cause 51%, so select for use the siRNA1 expression plasmid to carry out subsequent experimental.
The production of slow virus particulate packing and viral liquid:
Extract the DNA that does not contain the intracellular toxin plasmid of siRNA1 sequence corresponding expression carrier.With slow virus packaging plasmid mixture KCPACK-Lentivaris plasmids mix and the most effective siRNA1 slow virus shuttle plasmid cotransfection 293T cell; Be changed to the DMEM nutrient solution that contains 1%FBS in 24 hours, have GFP to express in the fluorescence microscope 293T cell, the cell of expressing GFP surpasses 90% (Fig. 6); 48 hours collecting cells, the centrifugal 5min of 5000rpm, the pvdf membrane filtering supernatant of 0.45 μ m, ice bath is preserved, and is used to measure its virus titer.Inoculate 293 good cells of growth conditions to 96 orifice plates by same concentrations, be divided into two groups, every group of 5 holes.Control group is that viral colony forming unit is 1 * 10
8Cfu/L (Colony forming unit, standard virus liquid cfu); Two groups of samples by infection multiplicity (Multiplicity of infection, MOI) value is divided into 5 gradients: 1,3,5,10 and 20; Infect the fluorescence intensity and the quantity of the cell (Fig. 8) that the cell (Fig. 7) that dyed through fluorescence microscope viral liquid inductance more to be measured in 24 hours and standard virus liquid inductance dye, determine that viral drop degree is 1.0 * 10
8Cfu/L.
Virion infects A375 cell and the steady cell strain that changes of screening:
Inoculation growth conditions good A375 cell to 6 orifice plate is with antibiotic-free, contain the DMEM substratum of 10%FBS, 37 ℃ and 5%CO
2Be cultured to the cell attachment of 70-80%; Add the slow mixing of viral liquid, changed liquid in 24 hours; Screened with G418 (concentration is 500ng/ul) in 96 hours; Chose mono-clonal in 192 hours, and transferred to 24 orifice plates, use instead after 1 day and contain antibiotic substratum; When 70% cell attachment, transfer in 6 orifice plates and cultivate again, fluorescence microscope A375 cell clone well-grown, progressively amplification culture; Whether will surely change frozen repeatedly its luciferase expression of observing under opticmicroscope (Fig. 9) and fluorescent microscope (Figure 10) of cell strain stablizes.Gone down to posterity 15-20 generation external at present, GFP green fluorescence continuous expression, the siRNA of stably express can be kept long-time G6PD gene silencing, become G6PD defect type A 375 stably transfected cell strains (A375-G6PD Δ).
The siRNA jamming effectiveness detects and the G6PD determination of activity:
Western blotting detects G6PD and expresses: extracting G6PD defect type A 375 stably transfected cell strains (G6PD Δ) and wild-type (WT, wild type) A375 cell protein, BCA protein quantification kit measurement total protein.The total protein of 50ug separated through 10%SDS-PAGE glue 60mA constant current in 4-5 hour; After changeing film, sealing, respectively with the antibody incubation of rabbit anti-people G6PD polyclonal antibody and the anti-people β-actin of rabbit, again with two anti-effects of Horseradish Peroxidase (HRP) mark after, pass through KC
TMChemoluminescence and X-ray film exposure, it the results are shown in Figure 11.It is quantitative that Image J software carries out the gray scale scanning of band, and the result shows that the G6PD expression amount of A375-WT cell is 2.301 ± 0.285; A375-G6PD Δ cell is 0.257 ± 0.074 then, is 11.17% (Figure 12) of untransfected siRNA G6PD cell, so the jamming effectiveness of siRNA is 88.83% (P<0.01).In addition, during with determined by ultraviolet spectrophotometry 340nm, in a certain amount of total protein G6PD in the unit time with NADP
+The amount that changes NADPH into is determined the G6PD enzymic activity, compares the enzymic activity of A375-G6PD Δ 78.47% (Figure 13) that descended with the A375-WT cell.
The A375-G6PD Δ surely changes the Function detection of cell strain:
Mtt assay (tetrazolium bromide colorimetry) is measured the growth curve of Δ 375-G6PD Δ and A375-WT cell.Inoculate good A375-G6PD Δ of growth conditions and A375-WT cell 3 * 10 respectively
4/ ml/ hole is a blank with the nutrient solution in 24 orifice plates, puts on the enzyme connection detector and measures the 490nm absorbance.Measure 3 holes every day, write down altogether 10 days.The result shows that the logarithmic phase of two groups of cells is postvaccinal 5-9 days, but the prolongation of G6PD Δ cell doubling time, growth velocity obviously descends, and propagation is suppressed.Compare with A375-WT, at 5-9 days that cultivate, G6PD Δ cell quantity reduced 24.4%-37.5% (Figure 14).
Plate clone forms the single celled multiplication capacity of test determination.The vegetative period cell of taking the logarithm is made single cell suspension, does the dilution of gradient multiple, by 2000,1000,500,250,125,62.5 cell densities in every hole, is inoculated in 6 orifice plates static cultivation 10 days respectively.When naked eyes occurring and as seen clone, stop cultivating.Ji's nurse Sa dyeing 10-30min is inverted flat board on the transparent film of band grid, the counting clone.The result: 2000,1000 and 500 cells of every hole inoculation are too close because of it, can't count; And 250,125 and 62.5 cell densities inoculations were pressed after 10 days in every hole, the cloning efficiency of A375-WT and A375-G6PD Δ cell is respectively 122.13 ± 12.83% and 91.6 ± 6.61%, and the average cloning efficiency of visible A375-G6PD Δ cell has reduced by 25% (P<0.05) (Figure 15).
Flow cytometry (FCM, Flow cytometry) PI (Propidium idodide, propidium iodide) dyeing detects apoptosis.Single cell suspension 1 * 10
6Wash through PBS, 70% ethanol is fixed, PI dyeing 30 minutes. argon ion excitation wavelength 488nm, get cell mass according to forward scatter light (FSC) and side scattered light (SSC) frame, carry out the dna content analysis, Cellqust software analysis data. analysis indexes: 1. apoptosis (Apo, apotosis): on the DNA histogram, diploid G
0/ G
1The cell peak of the hypodiploid dna content that occurs before the cell peak is the Apo peak; 2. S phase cells ratio (SPF, S-phase fraction): SPF (%)=[S ÷ (G
0/ G
1+ S+G
2/ M)] * 100%; 3. proliferation index (PI, Proliferation index): PI (%)=[(S+G
2/ M) ÷ (G
0/ G
1+ S+G
2/ M)] * 100%.10000 cells of each sample collection.The result: the DNA proximate analysis shows that the apoptosis cell of A375-G6PD Δ is A375-WT 2.86 times (P<0.01), SPF has increased by 33.8% (P<0.05) than A375-WT, PI has increased by 59.7% (P<0.01), and the G0/G1 phase has descended 27.7% (P<0.05) (Figure 16).
The G6PD defective type A375 cell that the applicant makes up, the cell expressing green fluorescent protein more than 95%, through siRNA target silence the expression amount 88.83% of endogenous G6PD, promptly the amount of G6PD only is 11.17% of a wild-type A375 cell.Compare with wild-type A375 cell, activity has only 21.53%; Cell doubling time prolongs, and propagation is suppressed; Cloning efficiency reduces, and apoptosis cell increases, and points out the expression of reticent G6PD can suppress the growth of malignant melanoma.This is the tumour cell of the first strain G6PD defective by literature search, at least following purposes can be arranged:
Study influence and the mechanism thereof of G6PD to the cellular biology of tumor behavior:
After not only can be used for observing endogenous G6PD " Knock down ", the change of cell growth condition and function thereof, also the cDNA " Knock in " of wild-type and mutant G6PD can be gone into this cell (because our siRNA design is at the non-coding region of 3 ' end, cDNA to external source does not produce interference), the recovery situation of observation of cell correlation function, inquire into effect and the mechanism thereof of G6PD in growth of tumour cell, propagation and differentiation, also can be used for the research that G6PD lacks the gene therapy of sending out disease.
The anti-oxidation stress reaction of research G6PD and tumour cell:
Can be with this cell as model, compare with the A375 of wild-type, impose oxygenant such as diamide, H
2O
2Deng processing, the stress reaction of observation of cell is inquired into G6PD--tumour cell--anti-oxidant three's relation.
Research people's malignant melanoma pathogeny and treatment thereof:
Inquire into the G6PD expression silencing cause the apoptotic signal conduction of A375 by way of; Inquire into the G6PD inhibitor and can cause the A375 apoptosis, look for the new drug of possible anti-people's malignant melanoma.
Sequence table of the present invention is as follows:
5′-GCCTCAGTGC?CACTTGACA-3′ 19
5′-CGTGAGAGAA?TCTGCCTGT-3′ 19
5′-TTGACCTCAG?CTGCACATT-3′ 19
5′-TTCTCCGAAC?GTGTCACGT-3′ 19
The siRNA sequence positive-sense strand that has nothing to do
5′-GATCCCGCCT?CAGTGCCACT?TGACATTGAT?ATCCGTGTCA?AGTGGCACTG?AGGCTTTTTT?60
CCAAC-3′ 5
SsDNA template corresponding to siRNA 1 positive-sense strand
5′-TCGAGTTGGA?AAAAAGCCTC?AGTGCCACTT?GACACGGATA?TCAATGTCAA?GTGGCACTGA?60
GGCGG-3′ 5
Complementary strand corresponding to the ssDNA template of siRNA 1 positive-sense strand
5′-GATCCCCGTG?AGAGAATCTG?CCTGTTTGAT?ATCCGACAGG?CAGATTCTCT?CACGTTTTTT?60
CCAAC-3′ 5
SsDNA template corresponding to siRNA 2 positive-sense strands
5′-TCGAGTTGGA?AAAAACGTGA?GAGAATCTGC?CTGTCGGATA?TCAAACAGGC?AGATTCTCTC?60
ACGGG-3′ 5
Complementary strand corresponding to the ssDNA template of siRNA 2 positive-sense strands
5′-GATCCCTTGA?CCTCAGCTGC?ACATTTTGAT?ATCCGAATGT?GCAGCTGAGG?TCAATTTTTT?60
CCAAC-3′ 5
SsDNA template corresponding to siRNA 3 positive-sense strands
5′-TCGAGTTGGA?AAAAATTGAC?CTCAGCTGCA?CATTCGGATA?TCAAAATGTG?CAGCTGAGGT?60
CAAGG-3′ 5
Complementary strand corresponding to the ssDNA template of siRNA 3 positive-sense strands
5′-GATCCCGTTC?TCCGAACGTG?TCACGTTTCA?AGAGAACGTG?ACACGTTCGG?AGAATTTTTT?60
CCAAA-3′ 5
SsDNA template corresponding to the irrelevant sequence positive-sense strand of siRNA
5′-AGCTTTTGGA?AAAAATTCTC?CGAACGTGTC?ACGTTCTCTT?GAAACGTGAC?ACGTTCGGAG?60
AACGG-3′ 5
Complementary strand corresponding to the ssDNA template of the irrelevant sequence positive-sense strand of siRNA
5′-TACGATACAA?GGCTGTTAGA?GAG-3′ 23
PCR detects the forward primer of positive recombinant plasmid
5′-TAGAAGGCAC?AGTCGAGG-3′ 18
PCR detects the reverse primer of positive recombinant plasmid
5′CTGACCTACG?GCAACAGATA?CAA?3′ 23
Fluorescence real-time quantitative PCR detects the forward primer of G6PD genetic expression
5′TGCCCTCATA?CTGGAAACCC?3′ 20
Fluorescence real-time quantitative PCR detects the reverse primer of G6PD genetic expression
5′CCTGTACGCC?AACACAGTGC?3′ 20
Fluorescence real-time quantitative PCR detects the forward primer of β-actin genetic expression
5′ATACTCCTGC?TTGCTGATCC?3′ 20
Fluorescence real-time quantitative PCR detects the reverse primer of β-actin genetic expression
Claims (1)
1, a kind of G6PD defect type A 375 stably transfected cell strains, it is characterized in that be with the A375 cell strain through siRNA-slow virus expression system target silence the expression amount of endogenous G6PD more than 80%, and contain dna double chain fragment 5 '-GATCCCGCCTCAGTGCCACTTGACATTGATATCCGTGTCAAGTGGCACTGAGGCTT TTTTCCAAC-3 ' and 5 '-TCGAGTTGGAAAAAAGCCTCAGTGCCACTTGACACGGATATCAATGTCAAGTGGCA CTGAGGCGG-3 ', and the steady commentaries on classics cell strain of the energy green-emitting fluorescence of green fluorescent protein GFP gene, the construction process of described G6PD defect type A 375 stably transfected cell strains, form by following steps:
One, the design of siRNA sequence, dna profiling is with synthetic
With the siRNA:5 '-GCCTCAGTGCCACTTGACA-3 ' of OligoEngine RNAi software design at people G6PD gene 3 ' end non-coding region, and with the irrelevant sequence of siRNA: 5 '-TTCTCCGAACGTGTCACGT-3 ' is contrast, synthetic respectively again two complementations also contain siRNA or the dna profiling of the positive-sense strand of control sequence and antisense strand, middle Loop structure with 10 deoxynucleotides links to each other, after connect RNA PolyIII transcription pausing point, and introduce BamH I and Xho I restriction enzyme site at two ends; Corresponding to the dna profiling of the siRNA of people G6PD gene 3 ' end non-coding region be 5 '-GATCCCGCCTCAGTGCCACTTGACATTGATATCCGTGTCAAGTGGCACTGAGGCTT TTTTCCAAC-3 ' and 5 '-TCGAGTTGGAAAAAAGCCTCAGTGCCACTTGACACGGATATCAATGTCAAGTGGCA CTGAGGCGG-3 '; And corresponding to the dna profiling of control sequence be 5 '-GATCCCGTTCTCCGAACGTGTCACGTTTCAAGAGAACGTGACACGTTCGGAGAATT TTTTCCAAA-3 ' and 5 '-AGCTTTTGGAAAAAATTCTCCGAACGTGTCACGTTCTCTTGAAACGTGACACGTTC GGAGAACGG-3 ';
Two, make up the slow virus expression vector of siRNA
Through dilution, annealing, pRNAT-U6.2/Lenti is connected above-mentioned dna profiling with linear plasmid respectively; Transformed E .coliDH5 α again, spread plate, incubated overnight; Two single bacterium colonies of every group of sample picking detect through PCR, and the PCR condition is: 94 ℃ of 10min → 94 ℃ 30s → 55 ℃ of 30s → 72 ℃ 30s, totally 33 circulations; The positive bacterium colony of incubated overnight extracts the plasmid order-checking and identifies, for the correct positive colony of order-checking, extracts purifying and does not contain endotoxic recombinant plasmid dna;
Three, the production of slow virus particulate packing and viral liquid
With slow virus packaging plasmid mixture and siRNA slow virus expression plasmid cotransfection 293T cell; Be changed to the DMEM nutrient solution that contains 1%FBS in 24 hours; 48 hours collecting cells, the centrifugal 5min of 5000rpm is used as viral liquid to be measured after the pvdf membrane filtering supernatant of 0.45 μ m; With standard virus liquid 1 * 10
8Cfu/L is contrast, and two groups of samples are established 5 gradients by the infection multiplicity value: 1,3,5,10 and 20; Infect the intensity of observing the green fluorescence cell in 24 hours and quantity to determine virus titer, surpass 95% if express the cell of GFP, viral drop degree reaches 1.0 * 10
8Cfu/L can be used for subsequent experimental;
Four, virion infects A375 cell and the steady cell strain that changes of screening
Inoculation growth conditions good A375 cell to 6 orifice plate is with antibiotic-free, contain the DMEM substratum of 10%FBS, 37 ℃ and 5%CO
2Be cultured to the cell attachment of 70-80%; Add the slow mixing of viral liquid, changed liquid in 24 hours; G418 screening with 500ng/ul in 84-120 hour; Choose mono-clonal in 168-200 hour, and transferred to 24 orifice plates; Changed in 24 hours and contain antibiotic substratum; When the cell attachment of 70-80%, forward in 6 orifice plates and cultivate again; During the cell clone well-grown, amplification culture progressively; Whether stable, gone down to posterity 15-20 generation external if will surely change frozen repeatedly its luciferase expression of observation of cell strain, luciferase expression is stable, and siRNA is reticent, and G6PD expresses more than 80%, becomes the G6PD defect type A 375 stably transfected cell strains.
Priority Applications (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CNB2008100580641A CN100569941C (en) | 2008-01-25 | 2008-01-25 | G6PD defect type A 375 stably transfected cell strains and construction process thereof |
Applications Claiming Priority (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CNB2008100580641A CN100569941C (en) | 2008-01-25 | 2008-01-25 | G6PD defect type A 375 stably transfected cell strains and construction process thereof |
Publications (2)
Publication Number | Publication Date |
---|---|
CN101289654A CN101289654A (en) | 2008-10-22 |
CN100569941C true CN100569941C (en) | 2009-12-16 |
Family
ID=40034100
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
CNB2008100580641A Expired - Fee Related CN100569941C (en) | 2008-01-25 | 2008-01-25 | G6PD defect type A 375 stably transfected cell strains and construction process thereof |
Country Status (1)
Country | Link |
---|---|
CN (1) | CN100569941C (en) |
Families Citing this family (5)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN102067828B (en) * | 2009-11-24 | 2013-07-10 | 上海市肿瘤研究所 | Highly metastatic model of human melanoma, cell subline, creation methods, and dynamic detection of metastasis |
CN104531622A (en) * | 2014-12-19 | 2015-04-22 | 昆明医科大学 | G6PD over-expressed ACHN stable cell strain and construction method thereof |
CN104560880A (en) * | 2014-12-19 | 2015-04-29 | 昆明医科大学 | G6PD-deficient Caki-1 stable cell strain and construction method thereof |
CN109554365A (en) * | 2018-12-10 | 2019-04-02 | 中国医科大学 | A kind of HCG11 gene inhibitor with antitumor action |
CN117866965B (en) * | 2024-02-29 | 2024-09-06 | 华南农业大学 | SgRNA sequence of specific targeting G6PD gene and application thereof in inhibition of pseudorabies virus replication |
-
2008
- 2008-01-25 CN CNB2008100580641A patent/CN100569941C/en not_active Expired - Fee Related
Non-Patent Citations (3)
Title |
---|
Mortality in a cohort of men expressing the glucose-6-phosphate dehydrogenase deficiency. Pierluigi Cocco et al..Blood,Vol.91 No.2. 1998 * |
siRNA抑制生存素基因对恶性黑素瘤细胞A375凋亡的影响. 陈思远等.中华皮肤科杂志,第39卷第4期. 2006 * |
实时定量PCR测定人皮肤黑色素瘤细胞G6PD的表达. 朱月春等.昆明医学院学报,第4期. 2007 * |
Also Published As
Publication number | Publication date |
---|---|
CN101289654A (en) | 2008-10-22 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
CN107828738A (en) | A kind of dnmt rna deficiency Chinese hamster ovary celI system and preparation method and application | |
CN100569941C (en) | G6PD defect type A 375 stably transfected cell strains and construction process thereof | |
CN106754926B (en) | MiRNA and its application for regulating apple spot defoliation resistance | |
CN109593848B (en) | Tumor-associated sequence, long-chain non-coding RNA and application thereof | |
CN108486060A (en) | It is a kind of to be used to treat excretion body of tumour and its preparation method and application | |
CN104099371A (en) | Application of KAP26.1 gene as exogenous gene introduced into cashmere goat cells and used for improving wool fineness | |
CN109750104A (en) | Application of the ABHD6 in Diagnosis of Non-Small Cell Lung, prognosis, treatment product | |
CN113599524A (en) | Application of HNRNPC and RBMX as target points in preparation of products for treating small cell lung cancer | |
CN109321655A (en) | NKIRAS2 gene regulation region sequence, regulating and controlling sequence and its application in nasopharyngeal carcinoma | |
CN111387143A (en) | Application of miRNA-203a-3p in development of pancreatic cancer inhibition drugs | |
CN114181937B (en) | shRNA molecule for silencing human LINC01614 expression and application thereof | |
CN102747038B (en) | NOX4 knock-down A375 stably-transfected cell line and construction method thereof | |
CN108465108A (en) | A kind of specific gene target spot prevented or treat glioma | |
CN109010831A (en) | The application of LncRNA RET modulate tumor cellular radiosensitivity | |
CN104357451B (en) | For the siRNA of DD3 gene and expression vector establishment thereof and application | |
CN101503685A (en) | Anticancer recombinant adenovirus with tumour cell miR-221/222 as drug target, construction method and use | |
CN110628791A (en) | Application of tRNA (tRNA) modifier gene in non-small cell lung cancer | |
CN105582536B (en) | Application of AGPAT9 gene in preparation of liver cancer treatment drug and diagnosis and prognosis evaluation reagent | |
CN103937745B (en) | People A375 stable cell strain and the construction method of long-chain non-coding GAS5 defect | |
Liu et al. | GPX7 promotes the growth of human papillary thyroid carcinoma via enhancement of cell proliferation and inhibition of cell apoptosis | |
CN110295147A (en) | The rapid identification method and its application of proliferation phenotype after functional gene knocks out in a kind of esophageal carcinoma cell line | |
CN116536429B (en) | Application of c8orf76 in preparation of lung adenocarcinoma targeting drugs | |
CN102911938B (en) | siRNA (si Ribonucleic Acid) sequence for targeted restrain of POLD1 genetic expression | |
NL2036931A (en) | Human Ovarian Cancer Cell Line SKOV3-sh-MUC1, Constructing Method and Uses Thereof | |
CN102028956A (en) | Application of BTG2 (B Cell Translocation Gene 2) in preparing medicament for inhibiting cancer transfer |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
C06 | Publication | ||
PB01 | Publication | ||
C10 | Entry into substantive examination | ||
SE01 | Entry into force of request for substantive examination | ||
C14 | Grant of patent or utility model | ||
GR01 | Patent grant | ||
CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20091216 Termination date: 20150125 |
|
EXPY | Termination of patent right or utility model |