CN111718944B - Peanut salt-tolerant gene and application thereof - Google Patents
Peanut salt-tolerant gene and application thereof Download PDFInfo
- Publication number
- CN111718944B CN111718944B CN202010620229.0A CN202010620229A CN111718944B CN 111718944 B CN111718944 B CN 111718944B CN 202010620229 A CN202010620229 A CN 202010620229A CN 111718944 B CN111718944 B CN 111718944B
- Authority
- CN
- China
- Prior art keywords
- salt
- peanut
- gene
- ahnac65
- tolerant gene
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/415—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from plants
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
- C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
- C12N15/8261—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield
- C12N15/8271—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance
- C12N15/8273—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance for drought, cold, salt resistance
Landscapes
- Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- Engineering & Computer Science (AREA)
- Molecular Biology (AREA)
- Biophysics (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Zoology (AREA)
- Biochemistry (AREA)
- Wood Science & Technology (AREA)
- General Health & Medical Sciences (AREA)
- General Engineering & Computer Science (AREA)
- Biotechnology (AREA)
- Biomedical Technology (AREA)
- Botany (AREA)
- Physics & Mathematics (AREA)
- Cell Biology (AREA)
- Plant Pathology (AREA)
- Gastroenterology & Hepatology (AREA)
- Microbiology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Medicinal Chemistry (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention belongs to the technical field of biological gene engineering, and particularly discloses a peanut salt-tolerant gene and application thereof, wherein the nucleotide sequence of the peanut salt-tolerant gene is SEQ ID No.1, the amino acid sequence of the peanut salt-tolerant gene is SEQ ID No.2, DNA of young and young peanut leaves is taken as a template, primers AhNAC65-F2 and AhNAC65-R2 are used for PCR amplification, an overexpression vector of AhNAC65a is constructed, the overexpression vector is used for Arabidopsis genetic transformation, the salt tolerance change of transgenic Arabidopsis is analyzed and identified, and the salt tolerance of the transgenic Arabidopsis transformed AhNAC65a is found to be remarkably improved. The invention provides gene resources for the genetic improvement of plant salt tolerance, and has important theoretical significance and application value for analyzing the diversity function of peanut NAC transcription factors.
Description
Technical Field
The invention belongs to the technical field of biological gene engineering, and particularly relates to a peanut salt-tolerant gene and application thereof.
Background
Peanuts (Arachis Hypogaea L.) are important oil crops in China, and are important vegetable oil and protein sources. At present, the edible oil produced by China can not meet the consumption requirements of people in China. Therefore, the enlargement of the peanut planting area plays a significant role in guaranteeing the safety of edible oil. However, the conflict between land competition between oil crops and food crops is increasingly prominent. The area of the prior saline-alkali soil in China is about 9913 ten thousandhm2Accounting for 26.3 percent of the area of the saline-alkali soil in the world, and having agricultural development potential is about 667 kilohm2. The method for breeding the saline-alkali tolerant peanut variety and increasing the planting area of the peanuts in the saline-alkali land is an effective way for solving the contradiction of 'land competition between grains and oil' in China and ensuring the safety of edible oil. The excavation of the salt-tolerant gene is the basis of peanut resistance breeding. Therefore, the function identification and the molecular mechanism research of the salt-tolerant gene have important significance for breeding the salt-tolerant peanut variety by means of transgenic technology or molecular assisted breeding so as to improve the utilization efficiency of the saline-alkali soil.
At present, the genes with salt tolerance function in peanuts are still few. The method needs to excavate and identify the salt-tolerant genes of the peanuts and provides gene resources and theoretical basis for the peanut molecule assisted breeding.
Disclosure of Invention
In order to overcome the defects of the prior art, AhNAC65a is transferred into arabidopsis thaliana by using a transgenic technology to obtain AhNAC65a gene-transferred arabidopsis thaliana, and the salt tolerance of the transgenic arabidopsis thaliana can be improved by transferring the gene. The invention provides a peanut salt-tolerant gene and application thereof.
The invention provides a peanut salt-tolerant gene, wherein the nucleotide sequence of the peanut salt-tolerant gene is SEQ ID No.1, and the amino acid sequence of the peanut salt-tolerant gene is SEQ ID No. 2.
Furthermore, the open reading frame of the salt-tolerant gene is 861bp, and 286 amino acids are coded in total.
The invention also discloses application of the peanut salt-tolerant gene, which is characterized in that DNA of young peanut leaves is used as a template, primers AhNAC65-F2 and AhNAC65-R2 are used for PCR amplification, and an overexpression vector of AhNAC65a is constructed and used for arabidopsis genetic transformation, and the salt tolerance of arabidopsis is analyzed and identified.
Further, the sequences of the primers AhNAC65-F2 and AhNAC65-R2 are TGGAGAGAACACGGGGGATCCATGGAAGGAAGTAGTAAAAG and CGATCGGGGAAATTCGAGCTCTTAGTAATATCCTCTTAAATCA respectively.
Further, the PCR amplification system comprises ddH2O, buffer solution containing Mg2+, dNTP, AhNAC65-F2, AhNAC65-R2, DMSO, Phusion enzyme and a genome DNA template.
Further, the reaction conditions of the PCR amplification primers are as follows: pre-denaturation at 90-98 ℃ for 30 s; denaturation at 95-98 ℃ for 10s, annealing at 50-58 ℃ for 10s, and annealing at 65-75 ℃ for 50s, for 30 cycles; extending for 10min at 65-75 ℃.
Furthermore, the expression level of the peanut salt-tolerant gene in the peanut is increased after salt stress treatment.
Furthermore, the peanut salt-tolerant gene can be applied to improving the salt tolerance of transgenic arabidopsis thaliana.
Furthermore, the peanut salt-tolerant gene can be applied to improving the salt tolerance of transgenic peanut, soybean and cotton plants.
Compared with the prior art, the invention has the advantages and the technical effects that: by utilizing a transgenic technology, the peanut salt-tolerant gene AhNAC65a is transferred into arabidopsis thaliana, so that the effect of remarkably improving the salt-tolerant effect of the transgenic arabidopsis thaliana is obtained, gene resources are provided for the research on the salt tolerance of plants, and the transgenic arabidopsis thaliana has important theoretical significance and application value.
Drawings
FIG. 1 is a bar graph showing the expression of AhNAC65a gene in roots under salt stress according to the present invention.
FIG. 2 is a graph showing the comparison of the growth conditions of transgenic Arabidopsis thaliana and common plants under salt stress treatment according to the present invention. A is normal growth state, B: three weeks after salt stress treatment, C: one week after re-watering. AhNAC65 a-OX: transgenic AhNAC65a Arabidopsis; WT: transgenic Arabidopsis thaliana was not obtained.
Detailed Description
The technical solution of the present invention will be described in further detail with reference to the accompanying drawings and the detailed description.
Example 1
NAC transcription factor (named AhNAC65a) is cloned, and qRT-PCR analysis shows that the expression level of the gene is obviously improved under salt stress. The gene is transferred into arabidopsis thaliana to obtain AhNAC65a gene-transferred arabidopsis thaliana, and the gene is found to be capable of remarkably improving the salt stress resistance of the transgenic arabidopsis thaliana, so that the gene is proved to be a salt-tolerant gene. The functional identification of the AhNAC65a gene of the peanut enriches the gene resource of peanut salt-tolerant breeding, is favorable for analyzing the diversity function of the NAC transcription factor of the peanut, has important theoretical significance and application value, and comprises the following specific steps of cloning AhNAC65a of the salt-tolerant gene of the peanut and application of the AhNAC65 a:
1. primers AhNAC65-F2 and AhNAC65-R2 are designed by taking the sequence of peanut SEQ ID No.1 as reference. Extracting the DNA of the young leaf of the salt-tolerant peanut variety 'Baisha 1016' as a PCR amplification template.
The amplification primers are as follows:
AhNAC65-F2：
TGGAGAGAACACGGGGGATCCATGGAAGGAAGTAGTAAAAG
AhNAC65-R2：
CGATCGGGGAAATTCGAGCTCTTAGTAATATCCTCTTAAATCA。
2. PCR amplification is performed using the genomic DNA template and primers. The PCR amplification system is as follows: ddH2O31 μ L, containing Mg2 +10. mu.L of 5 XHF buffer solution; 2 μ L dNTP with a concentration of 2.5 mM; AhNAC65-F2 and AhNAC65-R2 at a concentration of 5. mu.M each, 2. mu.L; DMSO 0.6 μ L; phusion enzyme 0.5 μ L; genomic DNA template 2. mu.L.
The PCR reaction conditions are as follows: pre-denaturation at 98 ℃ for 30 s; denaturation at 98 ℃ for 10s, annealing at 58 ℃ for 10s, annealing at 72 ℃ for 50s, and 30 cycles; stretching for 10min at 72 ℃.
3. An overexpression vector for AhNAC65a was constructed. The amplified fragment obtained in step 2 was ligated to a pCambia2300EC vector (which contains 35S promoter and NOS terminator) digested with BamHI and SacI using a seamless cloning kit, and after sequencing was correct, Agrobacterium GV3101 was transformed by freeze-thaw method, and Arabidopsis thaliana was genetically transformed by dip-flower method.
4. Analyzing and identifying the salt tolerance of the AhNAC65 a. The expression pattern in peanut roots under salt stress was analyzed. The salt-tolerant variety 'Baisha 1016' at the seedling stage is treated by 1% NaCl solution, and the dynamic changes of the expression level of the gene in 0h, 2h, 6h, 12h, 24h, 36h, 48h and 72h are analyzed. AhNAC65a was found to have significantly increased expression after salt stress treatment, and reached a peak at 48 hours, which preliminarily verified that the gene responded to salt stress. The fluorescent quantitative primers used were as follows:
AhNAC65-F1：TAACCGCGCAACAGTTTCTG
AhNAC65-R1：ACCAAGGCCTTCTTGACACC
the result shows that the expression level of the gene is obviously improved under the induction of salt stress. This indicates that AhNAC65 gene participates in peanut salt tolerance reaction.
Transgenic Arabidopsis thaliana (AhNAC65a-OX) overexpressing AhNAC65a has been obtained. We have identified the salt tolerance, and found that: three weeks after salt stress treatment, AhNAC65a-OX and non-transgenic arabidopsis (WT) both experienced different wilting, but AhNAC65a-OX was slightly less severe, and after one week of re-watering, AhNAC65a-OX plants gradually turned green again, while WT died (fig. 2). The results prove that: the peanut transcription factor AhNAC65a can improve the salt tolerance of transgenic arabidopsis thaliana.
The open reading frame of the salt-tolerant gene is 861bp, 286 amino acids are coded, the nucleotide sequence of the peanut AhNAC65a gene is SEQ ID No.1, and the specific sequence is as follows:
ATGGAAGGAAGTAGTAAAAGTTGTGAACTACTACCACCAGGGTTTAGATTCCACCCAACAGATGAGGAGCTAATTGTGTATTACCTTTGTAACCAAGCAACATCAAAGCCCTGCCCTGCTTCCATCATCCCTGAAGTTGACATCTACAAATTTGATCCATGGGAATTGCCAGGGAAGGCTGAGTTTGGGGAGAAAGAATGGTACTTCTTTAGCCCAAGGGAAAGGAAGTATCCCAATGGGGTTCGGCCTAACCGCGCAACAGTTTCTGGGTATTGGAAGGCCACAGGGACAGACAAGGCTATTTACAGCAAGTGTAAGCATGTTGGTGTCAAGAAGGCCTTGGTTTTCTACAGGGGTAGACCTCCAAAGGGGATCAAGACTGATTGGATCATGCACGAATATCGTCTTCTTCAACAATCTAATCACAACAGCAGGATCACTGGTTCTATGAGACTGGATGACTGCGTCTTGTGTAGGATATATAAGAAAAAACATGCTGCTAAAGCATTGGATCAAGGACAGGAATACCCAACAACAGTTCAAATTAATCTAAATGCATCAACCAACAATGATGATGAGAAGGAGTTGATGATGATGAAGAATCTTCCAAGGACTTGTTCCCTTACTTATCTTTTGGACATGAATTACTTTGGTCCAATCTCACAGCTATTGTCTGATGGATCCTACAACAAGTCATCAACCTTTGAAATATTTCAACATAGCAATAGTGTTGACAACATTGGAATAGTGGATCCTCTTGTCAAAACTCAAATGGTTGAAATGGATGATAGCTATTATGCTCAAGATTCAGGCAAGTCCCAAGTGATGAAGCAAGGGAATGATTTAAGAGGATATTACTAA。
the amino acid sequence of the AhNAC65a gene is SEQ ID No.2, and the specific sequence is as follows:
MEGSSKSCELLPPGFRFHPTDEELIVYYLCNQATSKPCPASIIPEVDIYKFDPWELPGKAEFGEKEWYFFSPRERKYPNGVRPNRATVSGYWKATGTDKAIYSKCKHVGVKKALVFYRGRPPKGIKTDWIMHEYRLLQQSNHNSRITGSMRLDDCVLCRIYKKKHAAKALDQGQEYPTTVQINLNASTNNDDEKELMMMKNLPRTCSLTYLLDMNYFGPISQLLSDGSYNKSSTFEIFQHSNSVDNIGIVDPLVKTQMVEMDDSYYAQDSGKSQVMKQGNDLRGYY。
in addition, the peanut salt-tolerant gene AhNAC65a can also be applied to improving the salt tolerance of transgenic peanut, soybean and cotton plants by using a transgenic method.
The above description is only an example of the present invention, and is not intended to limit the present invention in any way, and those skilled in the art can make many variations and modifications of the present invention without departing from the scope of the present invention by using the method disclosed above, and the present invention is covered by the claims.
Sequence listing
<110> institute for peanut research in Shandong province
<120> peanut salt-resistant gene and application thereof
<160> 2
<170> SIPOSequenceListing 1.0
<210> 2
<211> 861
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 2
atggaaggaa gtagtaaaag ttgtgaacta ctaccaccag ggtttagatt ccacccaaca 60
gatgaggagc taattgtgta ttacctttgt aaccaagcaa catcaaagcc ctgccctgct 120
tccatcatcc ctgaagttga catctacaaa tttgatccat gggaattgcc agggaaggct 180
gagtttgggg agaaagaatg gtacttcttt agcccaaggg aaaggaagta tcccaatggg 240
gttcggccta accgcgcaac agtttctggg tattggaagg ccacagggac agacaaggct 300
atttacagca agtgtaagca tgttggtgtc aagaaggcct tggttttcta caggggtaga 360
cctccaaagg ggatcaagac tgattggatc atgcacgaat atcgtcttct tcaacaatct 420
aatcacaaca gcaggatcac tggttctatg agactggatg actgcgtctt gtgtaggata 480
tataagaaaa aacatgctgc taaagcattg gatcaaggac aggaataccc aacaacagtt 540
caaattaatc taaatgcatc aaccaacaat gatgatgaga aggagttgat gatgatgaag 600
aatcttccaa ggacttgttc ccttacttat cttttggaca tgaattactt tggtccaatc 660
tcacagctat tgtctgatgg atcctacaac aagtcatcaa cctttgaaat atttcaacat 720
agcaatagtg ttgacaacat tggaatagtg gatcctcttg tcaaaactca aatggttgaa 780
atggatgata gctattatgc tcaagattca ggcaagtccc aagtgatgaa gcaagggaat 840
gatttaagag gatattacta a 861
<210> 2
<211> 286
<212> PRT
<213> Artificial Sequence (Artificial Sequence)
<400> 2
Met Glu Gly Ser Ser Lys Ser Cys Glu Leu Leu Pro Pro Gly Phe Arg
1 5 10 15
Phe His Pro Thr Asp Glu Glu Leu Ile Val Tyr Tyr Leu Cys Asn Gln
20 25 30
Ala Thr Ser Lys Pro Cys Pro Ala Ser Ile Ile Pro Glu Val Asp Ile
35 40 45
Tyr Lys Phe Asp Pro Trp Glu Leu Pro Gly Lys Ala Glu Phe Gly Glu
50 55 60
Lys Glu Trp Tyr Phe Phe Ser Pro Arg Glu Arg Lys Tyr Pro Asn Gly
65 70 75 80
Val Arg Pro Asn Arg Ala Thr Val Ser Gly Tyr Trp Lys Ala Thr Gly
85 90 95
Thr Asp Lys Ala Ile Tyr Ser Lys Cys Lys His Val Gly Val Lys Lys
100 105 110
Ala Leu Val Phe Tyr Arg Gly Arg Pro Pro Lys Gly Ile Lys Thr Asp
115 120 125
Trp Ile Met His Glu Tyr Arg Leu Leu Gln Gln Ser Asn His Asn Ser
130 135 140
Arg Ile Thr Gly Ser Met Arg Leu Asp Asp Cys Val Leu Cys Arg Ile
145 150 155 160
Tyr Lys Lys Lys His Ala Ala Lys Ala Leu Asp Gln Gly Gln Glu Tyr
165 170 175
Pro Thr Thr Val Gln Ile Asn Leu Asn Ala Ser Thr Asn Asn Asp Asp
180 185 190
Glu Lys Glu Leu Met Met Met Lys Asn Leu Pro Arg Thr Cys Ser Leu
195 200 205
Thr Tyr Leu Leu Asp Met Asn Tyr Phe Gly Pro Ile Ser Gln Leu Leu
210 215 220
Ser Asp Gly Ser Tyr Asn Lys Ser Ser Thr Phe Glu Ile Phe Gln His
225 230 235 240
Ser Asn Ser Val Asp Asn Ile Gly Ile Val Asp Pro Leu Val Lys Thr
245 250 255
Gln Met Val Glu Met Asp Asp Ser Tyr Tyr Ala Gln Asp Ser Gly Lys
260 265 270
Ser Gln Val Met Lys Gln Gly Asn Asp Leu Arg Gly Tyr Tyr
275 280 285
Claims (5)
1. The application of the peanut salt-tolerant gene in improving the salt tolerance of arabidopsis thaliana and peanuts is characterized in that DNA of young and young peanut leaves is used as a template, primers AhNAC65-F2 and AhNAC65-R2 are used for carrying out PCR amplification to obtain a target fragment, an overexpression vector of AhNAC65a is constructed and used for arabidopsis thaliana genetic transformation, and the salt tolerance of transgenic arabidopsis thaliana is analyzed and identified; the nucleotide sequence of the peanut salt-tolerant gene is SEQ ID NO.1, the amino acid sequence of the peanut salt-tolerant gene is SEQ ID NO.2, the open reading frame of the peanut salt-tolerant gene is 861bp, and 286 amino acids are coded in total.
2. The application of the peanut salt-tolerant gene of claim 1 in improving the salt tolerance of arabidopsis thaliana and peanuts, which is characterized in that: the sequences of the primers AhNAC65-F2 and AhNAC65-R2 are TGGAGAGAACACGGGGGATCCATGGAAGGAAGTAGTAAAAG and CGATCGGGGAAATTCGAGCTCTTAGTAATATCCTCTTAAATCA respectively.
3. The application of the peanut salt-tolerant gene of claim 1 in improving the salt tolerance of arabidopsis thaliana and peanuts, which is characterized in that: the PCR amplification system is ddH2O, containing Mg2+The buffer of (a), dNTP, AhNAC65-F2, AhNAC65-R2, DMSO, Phusion enzyme and genomic DNA template.
4. The application of the peanut salt-tolerant gene of claim 1 in improving the salt tolerance of arabidopsis thaliana and peanuts, which is characterized in that: the reaction conditions of the PCR amplification primer are as follows: pre-denaturation at 90-98 ℃ for 30 s; denaturation at 95-98 ℃ for 10s, annealing at 50-58 ℃ for 10s, and annealing at 65-75 ℃ for 50s, for 30 cycles; extending for 10min at 65-75 ℃.
5. The application of the peanut salt-tolerant gene of claim 1 in improving the salt tolerance of arabidopsis thaliana and peanuts, which is characterized in that: the expression level of the peanut salt-tolerant gene in the peanut is increased after salt stress treatment.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202010620229.0A CN111718944B (en) | 2020-07-01 | 2020-07-01 | Peanut salt-tolerant gene and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202010620229.0A CN111718944B (en) | 2020-07-01 | 2020-07-01 | Peanut salt-tolerant gene and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN111718944A CN111718944A (en) | 2020-09-29 |
| CN111718944B true CN111718944B (en) | 2022-02-22 |
Family
ID=72570799
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202010620229.0A Active CN111718944B (en) | 2020-07-01 | 2020-07-01 | Peanut salt-tolerant gene and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN111718944B (en) |
Families Citing this family (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN114836434A (en) * | 2022-04-21 | 2022-08-02 | 山东省花生研究所 | Peanut salt-tolerant gene AhERF115 and cloning and application thereof |
Family Cites Families (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20070240243A9 (en) * | 1999-03-23 | 2007-10-11 | Mendel Biotechnology, Inc. | Plant transcriptional regulators of drought stress |
| US20150337328A1 (en) * | 2014-05-23 | 2015-11-26 | Clemson University | Methods and Constructs for Conferring Enhanced Abiotic Stress Resistance in Plants |
| CN109337915A (en) * | 2018-11-23 | 2019-02-15 | 中国农业科学院油料作物研究所 | Albumen and the application of sesame drought resisting and resistant gene of salt SiMYB75 and its coding |
-
2020
- 2020-07-01 CN CN202010620229.0A patent/CN111718944B/en active Active
Also Published As
| Publication number | Publication date |
|---|---|
| CN111718944A (en) | 2020-09-29 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN103103168B (en) | Protein for promoting plant growth and flowering and application of coding gene of protein | |
| CN112831478B (en) | Protein OsCAT8 for regulating rice chalkiness and coding gene and application thereof | |
| CN110872598A (en) | Cotton drought-resistant related gene GhDT1 and application thereof | |
| CN111235165A (en) | Lily susceptible fungal gene LrWRKY-S1 and application thereof | |
| CN111718944B (en) | Peanut salt-tolerant gene and application thereof | |
| CN101280007A (en) | Protein related to cold resistance of plant, coding genes and application thereof | |
| CN102899333B (en) | Rice salt stress related gene SIDP364 and coding protein and application thereof | |
| JP2015171326A (en) | Gene that provides plants with disease resistance, drought resistance, salinity tolerance, increased photosynthesis efficiency and increased number of tillers | |
| CN115873867A (en) | Rice blast resistant gene Pi69, and coding protein and application thereof | |
| CN111303262B (en) | Plant heat resistance and root development related protein and coding gene and application thereof | |
| CN109722441B (en) | Cucumber small heat shock protein Cu-sHSP gene and application thereof | |
| CN114507674A (en) | Application of tea tree circadian rhythm gene LUX in improving cold resistance of plants | |
| CN109371036B (en) | An alfalfa salt tolerance gene MsPIP 2; 2 and uses thereof | |
| CN111926035A (en) | Application of two WRKY transcription factor genes in rice and coding protein thereof | |
| CN106967732B (en) | Cotton glutathione peroxidase GhGPX8 and application thereof | |
| CN102558321B (en) | Protein AtLPT4 related to deficient-phosphorus stress tolerance of plants, and coding gene and application thereof | |
| CN101671676A (en) | Peanut C2H2 type salt-resistance zine finger protein gene AhZFP1 and coded protein and gene cloning method thereof | |
| CN116732048B (en) | Application of rice transcription factor gene OsbZIP48 in obtaining high-zinc rice grains and/or regulating nitrogen absorption | |
| CN112210545B (en) | Salicornia europaea SeSMT2 protein and coding gene and application thereof | |
| CN110499322B (en) | Peanut gene AhYP for improving disease resistance of peanuts and application thereof | |
| CN114836434A (en) | Peanut salt-tolerant gene AhERF115 and cloning and application thereof | |
| CN110129338B (en) | Corn transcription factor ZmEREB160 gene and application thereof | |
| CN102952786A (en) | Plant stress tolerance associated protein and application of coding gene thereof | |
| CN115354035B (en) | Parthenium schneiderianum phenylalanine ammonia lyase SgPAL2 and encoding gene and application thereof | |
| CN106480068B (en) | Duckweed transcription factor LmMYB gene and its application |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| CB03 | Change of inventor or designer information | ||
| CB03 | Change of inventor or designer information |
Inventor after: Yuan Cuiling Inventor after: Shan Shihua Inventor after: Sun Quanxi Inventor after: Li Chunjuan Inventor after: Yan Caixia Inventor after: Zhao Xiaobo Inventor after: Wang Juan Inventor after: Zhang Hao Inventor before: Sun Quanxi Inventor before: Shan Shihua Inventor before: Yuan Cuiling Inventor before: Li Chunjuan Inventor before: Yan Caixia Inventor before: Zhao Xiaobo Inventor before: Wang Juan Inventor before: Zhang Hao |
|
| GR01 | Patent grant | ||
| GR01 | Patent grant |