CN111718910A

CN111718910A - FAD-dependent oxidase Ma-1 in Diels-Alder adduct anabolic pathway and application

Info

Publication number: CN111718910A
Application number: CN201910212227.5A
Authority: CN
Inventors: 王瑞杉; 戴均贵; 王升; 郭娟; 康传志; 黄璐琦
Original assignee: Institute of Materia Medica of CAMS
Current assignee: Institute of Materia Medica of CAMS
Priority date: 2019-03-20
Filing date: 2019-03-20
Publication date: 2020-09-29
Anticipated expiration: 2039-03-20
Also published as: CN111718910B

Abstract

The invention discloses FAD dependent oxidase Ma-1 in a Diels-Alder adduct anabolic pathway and application thereof. The present invention provides the following proteins: ma-1 protein shown in SEQ ID No.3 and/or Ma-2 protein shown in SEQ ID No. 4. Ma-1 and Ma-2 have FAD dependent oxidase characteristic structural domains, Ma-1 can catalyze the dehydrogenation and rearrangement of an isopentenyl side chain of an isopentenyl phenol compound to form a diene body, catalyze the dehydrogenation of the isopentenyl side chain of the isopentenyl phenol compound and then react with an hydroxyl group at the ortho-position of an isopentenyl group to form a ring; ma-2 can catalyze [4+2] cyclization reaction between diene and chalcone compound double bonds to form Diels-Alder adduct. The invention has important theoretical and practical significance for producing Diels-Alder adducts and researching enzymatic Diels-Alder type [4+2] cyclization reaction mechanisms.

Description

FAD-dependent oxidase Ma-1 in Diels-Alder adduct anabolic pathway and application

Technical Field

The invention relates to the field of medicinal plant genetic engineering, in particular to FAD dependent oxidase Ma-1 in a Diels-Alder adduct anabolism pathway and application thereof.

Background

The formation of the effective components of medicinal plants is the product of specific genes in the secondary metabolic pathway of plants. With the wide and deep research of plant functional genome, the research of medicinal plant secondary metabolism synthesis related functional genes with unique characteristics and wide application prospect gradually becomes a research hotspot, the cloning of the genes provides a theoretical basis for explaining the biosynthesis way and the regulation mechanism of the effective components of medicinal plants, provides a theoretical basis for the formation of medicinal material quality, and simultaneously provides a wide application space for improving the content of the target components or directly producing the effective components or intermediates by utilizing biotechnology.

Mulberry is an important traditional Chinese medicinal material in China, and the number of the traditional Chinese medicine compounds containing mulberry medicinal parts is more than 200. Folium Mori, Mori fructus, cortex Mori, and ramulus Mori can be used as raw materials, wherein folium Mori has effects of dispelling pathogenic wind, clearing heat, cooling blood, and improving eyesight; the mulberry has the effects of enriching blood and nourishing yin, and promoting fluid production and moistening dryness; cortex Mori (dry root bark of mulberry without cortex emboli) has effects of clearing lung-heat, relieving asthma, promoting diuresis and relieving swelling; ramulus Mori can dispel wind-damp and benefit joints. Since the 70 s in the 20 th century, scholars at home and abroad systematically researched the chemical components of white mulberry, mountain mulberry, Chinese holly, Mongolian mulberry and other mulberry species, and separated and identified various compounds with good biological activity, such as aromatics, polyhydroxy alkaloids, coumarins, triterpenes and the like. Wherein the Diels-Alder (D-A) adduct is a characteristic aromatic compound of mulberry. Pharmacological experiments show that the aromatic compounds have various biological activities, such as hypertension resistance, microorganism resistance, tumor resistance, virus resistance, blood sugar reduction, platelet aggregation inhibition, oxidation resistance and the like. The chemical structure of the D-A adduct is novel and unique, and the biological activity is remarkable and diversified, so that the D-A adduct has attracted the common interest of the scientific workers all over the world. Substrate feeding experiment aiming at mulberry suspension culture cells and method for preparing same¹³The C mark experiment shows that the D-A type adduct is formed by the reaction of isopentenyl modified group of aromatic compound with oxidase to form diene and then is in [4+2] with the double bond of chalcone compound]The cyclization reaction between molecules occurs under the action of cyclase. However, at present, the above-mentioned oxidase and[4+2]none of the cyclases was identified.

Berberine Bridge Enzymes (BBEs) are an important subfamily of the FAD-dependent oxidase superfamily and play an important role in the formation of secondary metabolites of bacteria, fungi and plants. The catalytic function of members of this family is similar to the oxidation reactions involved in the biosynthesis of the D-A type adducts. For example, the fungal secondary metabolism-associated berberine bridge enzyme PenH is reported to catalyze the formation of diene structures, and the mechanisms of action of Daurichromenic synthase isolated from Rhododendron (Rhododendron) are similar to that of PenH. Of particular note are the tetrahydroxycannabinoides synthetase (THCA) reaction substrates and catalytic mechanisms isolated from Cannabis sativa (Cannabis) which are similar to the oxidation reactions associated with the biosynthesis of mulberry D-a type adducts. As the relativity between the marijuana and the mulberry is close, the tetrahydroxymarijuana synthetase has important reference value for determining oxidase candidate genes related to the biosynthesis of mulberry D-A type adducts.

Disclosure of Invention

The invention aims to provide FAD dependent oxidase Ma-1 in a Diels-Alder adduct anabolic pathway and application thereof.

In a first aspect, the invention claims a protein or a set of proteins.

The protein claimed by the invention is derived from mulberry (Morus alba L.), is named Ma-1, and can be specifically any one of the following proteins:

(A1) protein with amino acid sequence shown as SEQ ID No. 3;

(A2) a protein obtained by substituting and/or deleting and/or adding one or more amino acid residues to the amino acid sequence defined in (A1) and having the same function;

(A3) a protein having a homology of 99% or more, 95% or more, 90% or more, 85% or more, or 80% or more with the amino acid sequence defined in (A1) or (A2) and having the same function;

(A4) a fusion protein obtained by attaching a tag to the N-terminus and/or C-terminus of the protein defined in any one of (A1) to (A3).

The protein set claimed by the invention consists of protein A and protein B;

the protein A is a protein as shown in any one of (A1) to (A4) above;

the protein B is derived from mulberry (Morus alba L.), is named Ma-2, and can be specifically any one of the following proteins:

(B1) protein with amino acid sequence shown as SEQ ID No. 4;

(B2) a protein obtained by substituting and/or deleting and/or adding one or more amino acid residues to the amino acid sequence defined in (B1) and having the same function;

(B3) a protein having a homology of 99% or more, 95% or more, 90% or more, 85% or more, or 80% or more with the amino acid sequence defined in (B1) or (B2) and having the same function;

(B4) a fusion protein obtained by attaching a tag to the N-terminus and/or C-terminus of the protein defined in any one of (B1) to (B3).

In a second aspect, the invention claims a nucleic acid molecule or a set of nucleic acid molecules.

The nucleic acid molecule as claimed in the present invention is a nucleic acid molecule encoding a protein as described in the first aspect hereinbefore.

The nucleic acid molecule set claimed in the present invention is composed of a nucleic acid molecule A and a nucleic acid molecule B.

The nucleic acid molecule A is a nucleic acid molecule encoding the protein A as described in the first aspect above; the nucleic acid molecule B is a nucleic acid molecule encoding the protein B as described in the first aspect above.

Further, the nucleic acid molecule may be a DNA molecule as shown in any one of (a1) to (a3) below:

(a1) DNA molecule with nucleotide sequence shown in SEQ ID No. 1;

(a2) a DNA molecule which hybridizes under stringent conditions to the DNA molecule defined in (a1) and which encodes a protein represented by any one of (A1) to (A4) as described hereinbefore;

(a3) a DNA molecule which has 99% or more, 95% or more, 90% or more, 85% or more or 80% or more homology to the DNA sequence defined in (a1) or (a2) and which encodes a protein represented by any one of (A1) to (A4) described above.

The nucleic acid molecule A may be a DNA molecule as set forth in any one of (a1) to (a3) above; the nucleic acid molecule B can be a DNA molecule shown in any one of (B1) to (B3) as follows:

(b1) DNA molecule with nucleotide sequence shown in SEQ ID No. 2;

(b2) a DNA molecule which hybridizes under stringent conditions with the DNA molecule defined in (B1) and which encodes the protein B as described hereinbefore;

(b3) a DNA molecule having 99% or more, 95% or more, 90% or more, 85% or more or 80% or more homology to the DNA sequence defined in (B1) or (B2) and encoding the protein B as described above.

In the above nucleic acid molecule, the stringent conditions may be as follows: 50 ℃ in 7% Sodium Dodecyl Sulfate (SDS), 0.5M Na₃PO₄Hybridizing with 1mM EDTA, rinsing in 2 × SSC, 0.1% SDS at 50 deg.C, 7% SDS, 0.5M Na at 50 deg.C₃PO₄Hybridizing with 1mM EDTA, rinsing in 1 × SSC, 0.1% SDS at 50 deg.C, 7% SDS, 0.5M Na at 50 deg.C₃PO₄Hybridizing with 1mM EDTA, rinsing in 0.5 × SSC, 0.1% SDS at 50 deg.C, 7% SDS, 0.5M Na at 50 deg.C₃PO₄Hybridizing with 1mM EDTA, rinsing in 0.1% SDS (0.1 × SSC) at 50 deg.C, or 7% SDS and 0.5M Na at 50 deg.C₃PO₄Hybridization with a mixed solution of 1mM EDTA, rinsing in 0.1 × SSC, 0.1% SDS at 65 ℃ or 6 × SSC, 0.5% SDS at 65 ℃ followed by washing once each with 2 × SSC, 0.1% SDS and 1 × SSC, 0.1% SDS.

SEQ ID No.3(Ma-1 protein) consists of 547 amino acids. SEQ ID No.1(Ma-1 gene) is made up of 1644 nucleotides and encodes the protein shown in SEQ ID No. 3. SEQ ID No.4(Ma-2 protein) consists of 550 amino acids. SEQ ID No.2(Ma-2 gene) consists of 1653 nucleotides and encodes the protein shown in SEQ ID No. 4.

In a third aspect, the invention claims any of the following biomaterials:

(c1) a recombinant vector comprising a nucleic acid molecule as described in the second aspect above;

(c2) an expression cassette comprising a nucleic acid molecule as described in the second aspect above;

(c3) a transgenic cell line comprising a nucleic acid molecule as described in the second aspect;

(c4) a recombinant bacterium comprising a nucleic acid molecule as described in the second aspect above;

(c5) the complete set of recombinant vector consists of a recombinant vector A and a recombinant vector B; the recombinant vector A is a recombinant vector containing the nucleic acid molecule A described in the second aspect above; the recombinant vector B is a recombinant vector comprising the nucleic acid molecule B as described in the second aspect above;

(c6) the complete set of expression cassette consists of an expression cassette A and an expression cassette B; the expression cassette A is an expression cassette comprising the nucleic acid molecule A as described in the second aspect above; the expression cassette B is an expression cassette comprising the nucleic acid molecule B as described in the second aspect above;

(c7) the complete set of transgenic cell line consists of a transgenic cell line A and a transgenic cell line B; the transgenic cell line A is a transgenic cell line comprising the nucleic acid molecule A as described above in the second aspect; the transgenic cell line B is a transgenic cell line comprising a nucleic acid molecule B as described in the second aspect above;

(c8) the complete set of recombinant bacteria consists of recombinant bacteria A and recombinant bacteria B; the recombinant bacterium A is a recombinant bacterium containing the nucleic acid molecule A in the second aspect; the recombinant bacterium B is a recombinant bacterium containing the nucleic acid molecule B described in the second aspect.

In a fourth aspect, the invention claims a kit.

The claimed kit of the invention contains any of the following: a protein or protein set as described in the first aspect, a nucleic acid molecule or nucleic acid molecule set as described in the second aspect, a biological material as described in the third aspect.

In the third and fourth aspects, the expression cassette is composed of a promoter, the gene, and a transcription termination sequence, which are linked in this order.

In the third and fourth aspects, the recombinant vector may be a recombinant cloning vector or a recombinant expression vector.

In one embodiment of the present invention, said recombinant vector (or said recombinant vector a) is a vector for inserting said nucleic acid molecule (or said nucleic acid molecule a) into ppic3.5k (Invitrogen)^TMAnd the cargo number: v17320) at the multiple cloning site (e.g., EcoR I and Not I) of the vector. The recombinant vector B is obtained by inserting the nucleic acid molecule B into pPIC3.5K (Invitrogen)^TMAnd the cargo number: v17320) at the multiple cloning site (e.g., EcoR I and Not I) of the vector.

In the third and fourth aspects, the recombinant bacterium (or the recombinant bacterium a) is a recombinant yeast containing the nucleic acid molecule (or the nucleic acid molecule a). The recombinant bacterium B is a recombinant yeast containing the nucleic acid molecule B. Further, the yeast is pichia pastoris. More specifically, the Pichia pastoris is Pichia pastoris SMD1168 (Invitrogen)^TMAnd the cargo number: c17500) In that respect

In a fifth aspect, the invention claims any of the following applications:

(C1) use of a protein or protein set according to the first aspect as a FAD-dependent oxidase in the anabolic pathway as a Diels-Alder adduct.

(C2) Use of a protein according to the first aspect for catalysing the dehydrorearrangement of an isopentenyl side chain of an isopentenyl phenolic compound to form a diene. In the invention, the application is specifically the application of the protein of the first aspect in catalyzing the dehydrorearrangement of a moracin C (Moracin C) isopentenyl side chain to form a diene body.

(C3) The protein of the first aspect is applied to catalyzing dehydrogenation of an isopentenyl side chain of an isopentenyl phenolic compound and then reacting with hydroxyl at an ortho-position of the isopentenyl group to form a ring. In the invention, the application is specifically the application of the protein in the first aspect in catalyzing the dehydrogenation of psoralen B or Morachalcone A isopentenyl side chain and then reacting with ortho-C-4' hydroxyl to form a ring.

(C4) The use of a protein set according to the first aspect in catalyzing a Diels-Alder adduct formed by the Diels-Alder reaction of an isopentenyl phenolic compound and a chalcone compound. In the invention, the application is specifically the application of the complete set of proteins in the first aspect in catalyzing the reaction of the morusin C and the Morachalcone A to generate the Diels-Alder adduct Chalcomoracin.

(C5) Use of a protein or protein set according to the first aspect or a nucleic acid molecule or nucleic acid molecule set according to the second aspect or a biological material according to the third aspect or a kit according to the fourth aspect for the production of a Diels-Alder adduct or for the preparation of a product for the production of a Diels-Alder adduct.

(C6) Use of a protein or protein set according to the first aspect or a nucleic acid molecule or nucleic acid molecule set according to the second aspect or a biological material set according to the third aspect or a kit according to the fourth aspect for the preparation of a product having FAD-dependent oxidase activity in a Diels-Alder adduct anabolic pathway.

(C7) Use of a protein according to the first aspect or a nucleic acid molecule according to the second aspect or a biological material according to the third aspect or a kit according to the fourth aspect for the preparation of a product capable of catalysing the dehydrorearrangement of an isopentenyl side chain of an isopentenyl phenolic compound to form a diene. In the present invention, the application is specifically the application of the protein of the first aspect, or the nucleic acid molecule of the second aspect, or the biological material of the third aspect, or the kit of the fourth aspect, in the preparation of a product capable of catalyzing dehydrorearrangement of a moracin c (moracin c) isopentenyl side chain to form a diene.

(C8) Use of a protein according to the first aspect or a nucleic acid molecule according to the second aspect or a biological material according to the third aspect or a kit according to the fourth aspect for the preparation of a product capable of catalyzing dehydrogenation of an isopentenyl side chain of an isopentenyl phenolic compound and then reacting the dehydrogenated side chain with an hydroxyl group at the ortho-position of the isopentenyl group to form a ring. In the present invention, the application is specifically an application of the protein of the first aspect, the nucleic acid molecule of the second aspect, the biological material of the third aspect, or the kit of the fourth aspect, in the preparation of a product capable of catalyzing the dehydrogenation of a psoralen B or a Morachalcone A isopentenyl side chain and then reacting with an ortho-C-4' hydroxyl group to form a ring.

(C9) Use of a protein or protein set according to the first aspect or a nucleic acid molecule or nucleic acid molecule set according to the second aspect or a biological material set according to the third aspect or a kit according to the fourth aspect for the manufacture of a product for studying the mechanism of an enzymatic Diels-Alder type [4+2] cyclization reaction.

In a sixth aspect, the invention claims a process for the production of a Diels-Alder adduct.

The method for producing the Diels-Alder adduct provided by the invention can comprise the following steps:

(D1) catalyzing dehydrorearrangement of an isopentenyl side chain of an isopentenyl phenolic compound to form a dienosome with protein a of the protein set of the first aspect;

(D2) catalyzing the Diels-Alder type [4+2] cyclization reaction between the diene body and the double bond of the chalcone compound by using the protein B in the protein set in the first aspect to form a Diels-Alder type adduct.

In the invention, the method is a method for producing a Diels-Alder adduct Chalcomoracin, and specifically comprises the following steps:

(E1) catalyzing dehydrorearrangement of a morusin c (moracin c) isopentenyl side chain to form a dienosome with protein a of the protein set of the first aspect;

(E2) catalyzing a Diels-Alder type [4+2] cyclization reaction between the diene body and a double bond of Morachalcone A by using the protein B in the protein set of the first aspect to form a Diels-Alder type adduct of Chalcomoracin.

Further, in steps (D1) and (E1), the temperature of the catalysis may be 20-40 ℃, specifically, 30 ℃; in steps (D2) and (E1), the temperature of the catalysis may be 20 to 40 ℃, particularly 30 ℃.

Further, in steps (D1) and (E1), the time of the catalysis may be 15min (in fact the reaction speed is extremely fast, occurring immediately); in steps (D2) and (E1), the catalytic time may be 15min (in fact the reaction rate is extremely fast, occurring immediately).

In the invention, the structure of the morin C (moracin C) is shown as a formula I; the structure of the diene body is shown as a formula II; the structure of psoralen B is shown in formula III; the structure of the Morachalcone A is shown as a formula IV; the structure of the Chalcomoracin is shown as a formula V. The product of the psoralen B isoamylene side chain which is dehydrogenated and then reacts with ortho-position C-4' hydroxyl to form a ring is shown as a formula VI; the product of the reaction of the dehydrogenated Morachalcone A isoamylene side chain and the ortho-C-4' hydroxyl to form a ring is shown as a formula VII.

Experiments prove that the proteases Ma-1 and Ma-2 related to the synthesis of the D-A type adduct have characteristic structural domains of FAD dependent oxidase, enzymatic reaction analysis shows that Ma-1 can catalyze Moracin C isoamylene side chain to be dehydrogenated and rearranged to form diene, catalyze psoralen or Morachalcone A isoamylene side chain to be dehydrogenated and then react with ortho-position C-4' hydroxyl to form ring; ma-2 can catalyze [4+2] cyclization reaction between diene and Morachalcone A double bond to form Diels-Alder adduct Chalcomoracin. The invention has important theoretical and practical significance for producing Diels-Alder adducts and researching enzymatic Diels-Alder [4+2] cyclization reaction mechanisms.

Drawings

FIG. 1 shows PCR identification of recombinant plasmids pPIC3.5K-Ma-1 and pPIC3.5K-Ma-2. 1-24 are 12 transformants of pPIC3.5K-Ma-2 and 12 transformants of pPIC3.5K-Ma-1, in that order, and M is DNA marker (DL 2000).

FIG. 2 shows the UPLC detection results when substrates, i.e., moricin C and Morachalcone A, are added simultaneously to the reaction system and contain different combinations of proteases Ma-1 and Ma-2 and no-load protein.

FIG. 3 shows the result of UPLC-TOF analysis when substrates Moracin C and Morachalcone A are added to the reaction system simultaneously and proteases Ma-1 and Ma-2 are contained simultaneously.

FIG. 4 shows the ultraviolet absorption and mass spectrum of the reaction product, Chalcomoracin.

FIG. 5 shows the results of UPLC-TOF analysis when psoralen serving as a substrate is added to a reaction system and protease Ma-1 is contained.

FIG. 6 is a mass spectrum of a product of dehydrogenization of the isoamylene side chain of psoralen and vicinal C-4' hydroxyl.

FIG. 7 shows that the product encoded by Ma-1 catalyzes the dehydrogenation and rearrangement of a moracin C (Moracin C) isopentenyl side chain to form a diene body, catalyzes the dehydrogenation of a psoralen B or Morachalcone A isopentenyl side chain, and then reacts with an ortho-position C-4' hydroxyl group to form a ring; the product encoded by Ma-2 catalyzes the [4+2] cyclization reaction between diene and Morachalcone A double bond to form the D-A adduct, Chalcomoracin.

Detailed Description

The experimental procedures used in the following examples are all conventional procedures unless otherwise specified.

Materials, reagents and the like used in the following examples are commercially available unless otherwise specified.

(Morusin C) Moracin C: product of Xili Biometrics, cat # BBP 01975.

Psoralen B: product of West Living Bio Inc., cat # BBP No.: BBP 02694.

Morachalcone A: product of West Living Bio Inc., cat # BBP No.: BBP 01994.

Pichia pastoris expression vector ppic3.5k: (Invitrogen)^TMAnd the cargo number: v17320).

Pichia pastoris SMD 1168: (Invitrogen)^TMAnd the cargo number: c17500) In that respect

Example 1 screening and cloning of D-A adduct anabolic pathway FAD dependent oxidase Gene

Screening of D-A adduct anabolic pathway FAD dependent oxidase gene

The mulberry (Morus albaL.) transcriptome database constructed in this experiment was searched with Cannabis (Cannabis) tetrahydroxycannabina synthetase (THCA), and FAD-dependent oxidase genes having a low E-Value and a high FPKM Value were selected and analyzed.

Cloning of FAD-dependent oxidase gene in mulberry

1. And (3) taking mulberry suspension culture cells growing to 14d, extracting total RNA of the mulberry by using a Trizol method, and amplifying the 5 'end of the FAD dependent oxidase gene by using a 5' RACE kit of invitrogen to obtain a full-length sequence of the candidate gene.

2. Cloning and sequencing of full-Length cDNA

Splicing the 5 'RACE results with the 3' ends available in the transcriptome database, searching for ORF regions, and designing two pairs of primers, Ma-1-F1/Ma-1-R1 and Ma-2-F1/Ma-2-R1, for amplification of the full-length gene.

Ma-1-F1：5’-ATGAAGTACTTTTCATTATCTTCGTC-3’；

Ma-1-R1：5’-TTACACAAGAAGAGATGGAATGC-3’。

Ma-2-F1：5’-ATGCAGTACTTTTCCTTCCC-3’；

Ma-2-R1：5’-TCACATTGCTGAATGTAGAGG-3’。

The cDNA of mulberry (Morus alba L.) is used as a template, and primer pairs Ma-1-F1/Ma-1-R1 and Ma-2-F1/Ma-2-R1 are respectively used for amplification. And carrying out agarose gel electrophoresis on the amplified product, wherein an electrophoresis result shows that a specific fragment appears at about 1500bp, and an agarose gel recovery kit (Takara) recovers a target fragment, clones the target fragment into a pGEM-T easy vector (Promega), identifies a positive clone and carries out sequencing verification (Beijing Hua large gene).

The sequencing result shows that: the DNA fragment containing the nucleotide sequence shown in SEQ ID No.1 is obtained by adopting the amplification of a primer pair Ma-1-F/Ma-1-R, and the DNA fragment containing the nucleotide sequence shown in SEQ ID No.2 is obtained by adopting the amplification of a primer pair Ma-2-F/Ma-2-R. The gene shown in SEQ ID No.1 is named as Ma-1 gene, and the gene shown in SEQ ID No.2 is named as Ma-2 gene. SEQ ID No.1 is a complete open reading frame and codes protein (named as Ma-1 protein) shown by SEQ ID No. 3; SEQ ID No.2 is a complete open reading frame and encodes the protein shown in SEQ ID No.4 (named as Ma-2 protein).

The recombinant vector pGEM-T-Ma-1 containing the Ma-1 gene (SEQ ID No.1) and the recombinant vector pGEM-T-Ma-2 containing the Ma-2 gene (SEQ ID No.2) are finally obtained through the steps.

Example 2 analysis of the eukaryotic expression and function of FAD-dependent oxidase Gene

1. Construction of Yeast expression vectors

According to the nucleotide sequences of the Ma-1 gene (SEQ ID No.1) and the Ma-2 gene (SEQ ID No.2), two pairs of primers Ma-1-F2/Ma-1-R2 and Ma-2-F2/Ma-2-R2 with EcoR I and Not I enzyme cutting sites are respectively designed.

Ma-1-F2：5’-ATCCTACGTAGAATTCAAAAATGTCT-AAGTACTTTTCATTATCTT CGTCATTTG-3’；

Ma-1-R2：5’-AATTAATTCGCGGCCGCTTAATGATGATGATGATGATG-CACAAGAAGAGATGGAATGC-3’。

Ma-2-F2：5’-ATCCTACGTAGAATTCAAAAATGTCT-CAGTACTTTTCCTTCCCT TCAT-3’；

Ma-2-R2：5’-AATTAATTCGCGGCCGCTCAATGATGATGATGATGATG-CATTGCTGAATGTAGAGG-3’。

PCR amplification is carried out by taking the recombinant vector pGEM-T-Ma-1 obtained in example 1 as a template and Ma-1-F2/Ma-1-R2 as a primer, then products are amplified by double enzyme digestion of restriction enzymes EcoR I and Not I, and after glue is recovered, the products are connected with a large skeleton fragment of a Pichia pastoris expression vector pPIC3.5K subjected to the same double enzyme digestion to obtain the recombinant expression vector pPIC3.5K-Ma-1.

The recombinant vector pGEM-T-Ma-2 obtained in the example 1 is used as a template, Ma-2-F2/Ma-2-R2 is used as a primer for PCR amplification, then the products are subjected to double enzyme digestion amplification by using restriction enzymes EcoR I and Not I, and after glue is recovered, the products are connected with a large skeleton fragment of a Pichia pastoris expression vector pPIC3.5K subjected to the same double enzyme digestion, so that the recombinant expression vector pPIC3.5K-Ma-2 is obtained.

Then directly converting the ligation reaction system into Trans1-T1 (Beijing Quanjin Biotechnology Co., Ltd.)

PCR identification is carried out on the recombinant expression vector pPIC3.5K-Ma-1 transformant by adopting a primer pair 5 'AOX 1/3' AOX 1; PCR identification is carried out on the transformant of the recombinant expression vector pPIC3.5K-Ma-2 by adopting a primer pair 5 'AOX 1/3' AOX 1.

5’AOX1：5’-GACTGGTTCCAATTGACAAGC-3’；

3’AOX1：5’-GCAAATGGCATTCTGACATCC-3’。

The results are shown in FIG. 1. The positive result of PCR amplification is about 2000bp, which is the length of the exogenous gene plus part of the carrier fragment.

After sequencing verification of the PCR detection positive recombinant expression vector pPIC3.5k-Ma-1, the structure description is as follows: the recombinant plasmid is obtained by inserting a DNA fragment shown in 4-1641+ CATCATCATCATCATCATTAA-3 '"of 5' -AAAAATGTCT + SEQ ID No.1 into the restriction site EcoR I and Not I of the pPIC3.5K vector. After sequencing verification of the PCR detection positive recombinant expression vector pPIC3.5K-Ma-2, the structure description is as follows: the recombinant plasmid is obtained by inserting a DNA fragment shown in the 4 th-1650 th + CATCATCATCATCATCATTGA th-3 "' of ' 5 ' -AAAAATGTCT + SEQ ID No.2 into the restriction enzyme site EcoR I and Not I of the pPIC3.5K vector.

2. Inducible expression

The pPIC3.5K-Ma-1 plasmid constructed in the step 1 is transformed and expressed to express host bacteria Pichia pastoris SMD1168, methanol is used for induction expression at 16 ℃ and 180rpm for 5 days, methanol is supplemented every 24 hours to ensure that the final concentration of the methanol in the culture medium is 1 percent (volume percentage content), 10000 × g of the culture medium is centrifuged for 20min to remove the thallus, and a 15mL ultrafiltration tube (an ultra-filtration tube)

Ultra-15, 10K)3000 × g was concentrated by centrifugation and the medium was replaced with reaction buffer (50 mM Tric-HCl, pH 7.4, 10% (volume percent) glycerol) to give a concentrate containing Ma-1 protein.

The pPIC3.5K-Ma-2 plasmid constructed in the step 1 is transformed and expressed to express host bacteria Pichia pastoris SMD1168, methanol is used for induction expression at 16 ℃ and 180rpm for 5 days, methanol is supplemented every 24 hours to ensure that the final concentration of the methanol in the culture medium is 1 percent (volume percentage content), 10000 × g of the culture medium is centrifuged for 20min to remove the thallus, and a 15mL ultrafiltration tube (an ultra-filtration tube)

Ultra-15, 10K)3000 × g was concentrated by centrifugation and the medium was replaced with reaction buffer (50 mM Tric-HCl, pH 7.4, 10% (volume percent) glycerol) to give a concentrate containing the Ma-2 protein.

And simultaneously setting a no-load control group for converting and expressing the host bacteria Pichia pastoris SMD1168 by the pPIC3.5K empty vector to obtain a no-load control concentrated solution.

Subsequent protein purification was performed with 1mL nickelColumn Ni-NTA (GE, USA). After loading, the sample was eluted with a gradient of 10mL of buffers containing different concentrations of imidazole (20mM phosphate buffer, 0.5M NaCl, 50-200mM imidazole, pH 7.4). With 15mL ultrafilter tube (

Ultra-15, 10K)3000 × g centrifuge concentrate protein and exchange elution buffer for reaction buffer>80% and the concentration measured by Bradford method (all-gold) was about 2 mg/mL.

3. Activity assay of Mulberry FAD-dependent oxidase

Different combinations of the substrates, sanguinin C (Moracin C), psoralen B and/or Morachalcone A, were added to a buffer containing about 0.1mg/mL Ma-1 protein and/or Ma-2 protein to catalyze the reaction, the buffer comprising 50mM Tric-HCl (pH 7.4), 10% (volume fraction) glycerol and 100. mu.M substrate. And (3) simultaneously setting an idle load control group in the experiment, namely replacing the Ma-1 protein and the Ma-2 protein in the reaction system by the idle load control obtained in the step (2). The catalytic reaction temperature was 30 ℃ for 15 minutes. After the reaction is completed, three times of volume of ethyl acetate is added to extract the catalytic product, and LC-MS analysis is carried out.

The LC-MS instrument was a Waters ACQUITY UPLC H-Class ultra performance liquid chromatography system (Watts corporation, USA) equipped with a Waters Separations Module 2695, a Waters 2996Photodiode Array Detector, a Waters Millennium 32 workstation; waters Q-TOF time-of-flight tandem mass spectrometer (Watts corporation, USA). Chromatographic conditions are as follows: the column was a Waters BEH C18 column (2.1 mm. times.50 mm, 1.7 μm). The mobile phase A is 0.05 percent (volume percentage content) of formic acid aqueous solution; mobile phase B was acetonitrile containing 0.05% (volume percent) formic acid. Gradient elution conditions were 0min, 5% B; 0-1 min, 5% -50% B; 1-3 min, 50% -60% B; for 3-4.5 min, 60% -70% of B; 4.5-5 min, 70% -98% B; 5-6 min, 98% B (% represents volume percentage). The flow rate is 0.5mL/min, the sample chamber temperature is 4 ℃, and the column temperature is 25 ℃. The sample injection amount is 3 μ L, and the detection wavelength is 190-400 nm.

Mass spectrum conditions: the ion source is an ESI source, and is in a positive ion detection mode, wherein the ion source temperature is 100 ℃, the atomization pressure is 206.8kPa, and the collision voltage is 175V. The temperature of the atomized gas is 350 ℃, the flow rate of the atomized gas is 10L/min, the voltage of the capillary is 3500V, and the scanning range m/z is 50-1000.

The results show that:

under the coexistence of the morusin C (Moracin C) (the structural formula is shown in figure 7) and the Morachalcone A (the structural formula is shown in figure 7), different combinations of protease Ma-1 and/or Ma-2 and an unloaded UPLC spectrum in a reaction system are shown in figure 2. Moracin C catalyzed by protease Ma-1, the substrate disappeared but no obvious product could be detected (no Ma-2 in the reaction system), presumably because Moracin C dehydrogenated and rearranged to form diene (the structural formula is shown in figure 7), but diene could not exist stably in the reaction buffer. When Moracin C and Morachalcone A exist independently or together, the substrate is not changed under the catalysis of the protease Ma-2 (Ma-1 is not in the reaction system).

Under the coexistence condition of Moracin C and Morachalcone A, protease Ma-1 and Ma-2 are simultaneously added into a reaction system to generate a new substance with the molecular weight of 648(m/z), and by analyzing the ultraviolet absorption and the main cracking mode of the new product, the product is considered to be a product of Charcomoracin (the structural formula is shown in figure 7) which reacts with the double bond of Morachalcone A for cyclization under the condition that the Moracin C isopentenyl side chain is dehydrogenated and rearranged to form a diene body (the structural formula is shown in figure 3), and the ultraviolet absorption and the mass spectrogram of the product of Charcomoracin are shown in figure 4.

With psoralen B as a substrate, a new substance is generated at 321(m/z) of a total ion flow diagram by the Ma-1 protein catalytic group (figure 5), a mass spectrum diagram of the new substance is shown in figure 6, and the product is identified as a product of the dehydrogenization of an isoamylene side chain of the psoralen B and the cyclization of an ortho-C-4' hydroxyl group.

The above results show that: the product coded by Ma-1 can catalyze the dehydrogenation and rearrangement of a moracin C (Moracin C) isopentenyl side chain to form a diene body, catalyze the dehydrogenation of a psoralen B or Morachalcone A isopentenyl side chain and then react with an ortho-position C-4' hydroxyl group to form a ring; the product encoded by Ma-2 catalyzes the [4+2] cyclization reaction between diene and Morachalcone A double bond to form the D-A adduct, Chalcomoracin (see FIG. 7).

<110> institute of traditional Chinese medicine of Chinese academy of traditional Chinese medicine

<120> FAD-dependent oxidase Ma-1 in Diels-Alder adduct anabolic pathway and application

<130>GNCLN190725

<160>4

<170>PatentIn version 3.5

<210>1

<211>1644

<212>DNA

<213>Morus alba

<400>1

atgaagtact tttcattatc ttcgtcattt gccagaatta tcatcgttct ttattcaatt 60

tcgttagcaa attcagcgcg cactcatgaa gactttcttc aatgcctcac cactcgtata 120

tccgagaact ctaccaacac ttctaaaacc tttccctaca tcactccaaa taatccgtcg 180

tattccacta cattgaattc atccatacaa aacaaacgtt tttcttctcc ttcgacccca 240

aaaccatttg ccattatcac tccatttcat ttctcccacg ttcaagctac tgttttttgc 300

tccaagaaac atagcattca aattagaacc cgaagtggtg gccatgatta tgagggtctt 360

tcttatgtgt ccagtgtctc gtttgtccta attgacttga gaaatttaag ttcaattagt 420

gtagacgtgg agagcaaatc tgcgtgggtt caagctggag ctacactggg tgagctttat 480

tataagattg gtgagaaaag tgaaaacctt gccttccctg ctggtgattg ccattctgta 540

ggtgttggtg gacatatcag cggaggaggc tacggttact taactcgaaa atatggcctc 600

tcagctgata atgttcttga cgcgaaatta atcgatgcta aaggaagaat tcttgatcgg 660

aaatctatgg gcgaagattt gttttgggcc ttacgtggtg gtggagctgc gagcttcgga 720

atcgttcttg catggaaact tcgactggtt cctgtgccat caacagtgac tgtgtttgat 780

attaagcgga atatgagcga tgctgcaaca aagaagttcg ttcatcagtg gcaaaggcga 840

gcagacaaag tcgatgagga tctgtcaatc tacatcacat tcagaactgc gagttctatt 900

gataaagaag ggaataaaaa aattatacta gaagctctcc cccgagggac attccatggc 960

agcgtggatc ggctccttca attaatgcaa aaggagtttc ctgagttagg tttgctaaga 1020

caggagtgca ccgaaatgaa atgggtggag tcctttctct atttcaactt cttcagaaat 1080

ggagaatcct tggatgtttt acttaatagg aaatctagtt acaacgtcgc gtatttcaag 1140

gcaaaatctg accatgtgaa agagcctatt ccagatgacg tgtttgaagg aatgttggaa 1200

aagttatatg aagaagaggt aggaagtact tcgattgatg tatttcctta cggaggaaaa 1260

atgaatgaga tttcagaatc cgtaatccca ttcccacacc gagtcgggaa cctctactac 1320

atccattact tcgtgcaatg gcaagaggaa gaagtggata ttacatcacc caacaaacat 1380

ataacttggt taaaaagact ttacgattac atgactcctt atgtgtctaa aaatccaagg 1440

actgcatttt tcaatttcag agaccttgat cttgggatgg ataacaacaa ggatggcaac 1500

acttataaca atatttctca tgcaagcatt tggggcacca agtatttcaa gagtaatttc 1560

aataggttgg ttcgtgtaaa gactatagtt gatccaacta atttctttac aaacgaacaa 1620

agcattccat ctcttcttgt gtaa 1644

<210>2

<211>1653

<212>DNA

<213>Morus alba

<400>2

atgcagtact tttccttccc ttcatcgtta gccaaaatca ccatctttct gatcttttca 60

tttgtattcg caagttcagc taacgacact catgaagcct ttcttgagtg cctgaccact 120

cgtataccct ccaactccac cttcaccccg caatccatca tctacactcc agataatccg 180

tcgtattcaa ctatattgga ttcaacgact caaaatcctc gttttctttc ttcttcgaca 240

agaaatccat ttgccatcat cacaccactt cacgcctccc acatacaagc cgctctttat 300

tgttcccaga aacatggcga gcagatgaga atccgaagcg gcggccatga ttatgaaggc 360

ctttcttacc agtccagtgt gccgtttttc atacttgact tgagaaactt gagttctatt 420

agtattgacg cgaagagcaa gtctgcgtgg gttcaggccg gagcgacgat tggtgaactt 480

tattatggga tagctaaaac gagcctgaat cttagctttc ccggcggcgt tgctcacact 540

atcggcgttg ggggacagtt aggtggagga ggctatggct attcgacgag aaaatatggg 600

ctcgcgtccg ataacgtcat cgacgcacag ttaatcgatg ctcgaggaag aattctcgat 660

cgaaaaacca tgggggaaga tttgttttgg gccatccgcg gtggtggagc gggaagcttc 720

ggaatcgttc ttgcctggaa aattcgcctt gttaacacac catcgacagt gactatattt 780

gaagccgtga ggagttggga aaacaataca acaaaaaagt tcatccgtcg atatcaacgt 840

cgcgcttcca aaaccgataa ggatctaacc atcttcgtcg gattccgaac tacgagttct 900

acagatgaag aagggaatga gagaatttca atactaacta tcgtctcggc cacattccac 960

ggcagcaagg ataggctcct tcagttagtg caaaaggagt ttcccgactt gggtttggtt 1020

agtgaagagt gcaccgaaat gtcatgggtt cgatccatta tccatttcaa tttattcggg 1080

gacgaagtac ccttggaggt tctactcaat agaacgctca atttcgaaat gaaggctttt 1140

aaattgagat ctgactatgt acaaaagcct attccagatg acgtgttaga aaaattattg 1200

agtaagttgt atgatgaaga gacaggagaa ggttacatcg aattttttcc ttatggagga 1260

aaaatgagta agatttcaga atctgaaatc ccgttcccat accgagccgg aaacctctac 1320

aaccttcggt acatggtgtc atggaaggat gatggaaaca ttacaagaac caacatgcat 1380

cttagctgga taaaagatgc ttacgattac atgacacctt acgtgtcaaa agatccgagg 1440

ggcgcatatc tgaacttcag agatctcgac atcggagtta atgtcaatga gagcgactac 1500

gattacgtcg cgaaagcaag cgtttggggt actaagtatt ttaggaataa tttttataga 1560

ttagttgata taaagacaat agttgatcca actaatttct ttaaatacga gcaaagtatc 1620

ccacctcttc ctcctctaca ttcagcaatg tga 1653

<210>3

<211>547

<212>PRT

<213>Morus alba

<400>3

Met Lys Tyr Phe Ser Leu Ser Ser Ser Phe Ala Arg Ile Ile Ile Val

1 5 10 15

Leu Tyr Ser Ile Ser Leu Ala Asn Ser Ala Arg Thr His Glu Asp Phe

20 2530

Leu Gln Cys Leu Thr Thr Arg Ile Ser Glu Asn Ser Thr Asn Thr Ser

35 40 45

Lys Thr Phe Pro Tyr Ile Thr Pro Asn Asn Pro Ser Tyr Ser Thr Thr

50 55 60

Leu Asn Ser Ser Ile Gln Asn Lys Arg Phe Ser Ser Pro Ser Thr Pro

65 70 75 80

Lys Pro Phe Ala Ile Ile Thr Pro Phe His Phe Ser His Val Gln Ala

85 90 95

Thr Val Phe Cys Ser Lys Lys His Ser Ile Gln Ile Arg Thr Arg Ser

100 105 110

Gly Gly His Asp Tyr Glu Gly Leu Ser Tyr Val Ser Ser Val Ser Phe

115 120 125

Val Leu Ile Asp Leu Arg Asn Leu Ser Ser Ile Ser Val Asp Val Glu

130 135 140

Ser Lys Ser Ala Trp Val Gln Ala Gly Ala Thr Leu Gly Glu Leu Tyr

145 150 155 160

Tyr Lys Ile Gly Glu Lys Ser Glu Asn Leu Ala Phe Pro Ala Gly Asp

165 170 175

Cys His Ser Val Gly Val Gly Gly His Ile Ser Gly Gly Gly Tyr Gly

180 185 190

Tyr Leu Thr Arg Lys Tyr Gly Leu Ser Ala Asp Asn Val Leu Asp Ala

195 200 205

Lys Leu Ile Asp Ala Lys Gly Arg Ile Leu Asp Arg Lys Ser Met Gly

210 215 220

Glu Asp Leu Phe Trp Ala Leu Arg Gly Gly Gly Ala Ala Ser Phe Gly

225 230 235 240

Ile Val Leu Ala Trp Lys Leu Arg Leu Val Pro Val Pro Ser Thr Val

245 250 255

Thr Val Phe Asp Ile Lys Arg Asn Met Ser Asp Ala Ala Thr Lys Lys

260 265 270

Phe Val His Gln Trp Gln Arg Arg Ala Asp Lys Val Asp Glu Asp Leu

275 280 285

Ser Ile Tyr Ile Thr Phe Arg Thr Ala Ser Ser Ile Asp Lys Glu Gly

290 295 300

Asn Lys Lys Ile Ile Leu Glu Ala Leu Pro Arg Gly Thr Phe His Gly

305 310 315 320

Ser Val Asp Arg Leu Leu Gln Leu Met Gln Lys Glu Phe Pro Glu Leu

325 330 335

Gly Leu Leu Arg Gln Glu Cys Thr Glu Met Lys Trp Val Glu Ser Phe

340 345 350

Leu Tyr Phe Asn Phe Phe Arg Asn Gly Glu Ser Leu Asp Val Leu Leu

355 360 365

Asn Arg Lys Ser Ser Tyr Asn Val Ala Tyr Phe Lys Ala Lys Ser Asp

370 375 380

His Val Lys Glu Pro Ile Pro Asp Asp Val Phe Glu Gly Met Leu Glu

385 390 395 400

Lys Leu Tyr Glu Glu Glu Val Gly Ser Thr Ser Ile Asp Val Phe Pro

405 410 415

Tyr Gly Gly Lys Met Asn Glu Ile Ser Glu Ser Val Ile Pro Phe Pro

420 425 430

His Arg Val Gly Asn Leu Tyr Tyr Ile His Tyr Phe Val Gln Trp Gln

435 440 445

Glu Glu Glu Val Asp Ile Thr Ser Pro Asn Lys His Ile Thr Trp Leu

450 455 460

Lys Arg Leu Tyr Asp Tyr Met Thr Pro Tyr Val Ser Lys Asn Pro Arg

465 470 475 480

Thr Ala Phe Phe Asn Phe Arg Asp Leu Asp Leu Gly Met Asp Asn Asn

485 490 495

Lys Asp Gly Asn Thr Tyr Asn Asn Ile Ser His Ala Ser Ile Trp Gly

500 505 510

Thr Lys Tyr Phe Lys Ser Asn Phe Asn Arg Leu Val Arg Val Lys Thr

515 520 525

Ile Val Asp Pro Thr Asn Phe Phe Thr Asn Glu Gln Ser Ile Pro Ser

530 535 540

Leu Leu Val

545

<210>4

<211>550

<212>PRT

<213>Morus alba

<400>4

Met Gln Tyr Phe Ser Phe Pro Ser Ser Leu Ala Lys Ile Thr Ile Phe

1 5 10 15

Leu Ile Phe Ser Phe Val Phe Ala Ser Ser Ala Asn Asp Thr His Glu

20 25 30

Ala Phe Leu Glu Cys Leu Thr Thr Arg Ile Pro Ser Asn Ser Thr Phe

35 40 45

Thr Pro Gln Ser Ile Ile Tyr Thr Pro Asp Asn Pro Ser Tyr Ser Thr

50 55 60

Ile Leu Asp Ser Thr Thr Gln Asn Pro Arg Phe Leu Ser Ser Ser Thr

65 70 75 80

Arg Asn Pro Phe Ala Ile Ile Thr Pro Leu His Ala Ser His Ile Gln

85 90 95

Ala Ala LeuTyr Cys Ser Gln Lys His Gly Glu Gln Met Arg Ile Arg

100 105 110

Ser Gly Gly His Asp Tyr Glu Gly Leu Ser Tyr Gln Ser Ser Val Pro

115 120 125

Phe Phe Ile Leu Asp Leu Arg Asn Leu Ser Ser Ile Ser Ile Asp Ala

130 135 140

Lys Ser Lys Ser Ala Trp Val Gln Ala Gly Ala Thr Ile Gly Glu Leu

145 150 155 160

Tyr Tyr Gly Ile Ala Lys Thr Ser Leu Asn Leu Ser Phe Pro Gly Gly

165 170 175

Val Ala His Thr Ile Gly Val Gly Gly Gln Leu Gly Gly Gly Gly Tyr

180 185 190

Gly Tyr Ser Thr Arg Lys Tyr Gly Leu Ala Ser Asp Asn Val Ile Asp

195 200 205

Ala Gln Leu Ile Asp Ala Arg Gly Arg Ile Leu Asp Arg Lys Thr Met

210 215 220

Gly Glu Asp Leu Phe Trp Ala Ile Arg Gly Gly Gly Ala Gly Ser Phe

225 230 235 240

Gly Ile Val Leu Ala Trp Lys Ile Arg Leu Val Asn Thr Pro Ser Thr

245 250 255

Val Thr Ile Phe GluAla Val Arg Ser Trp Glu Asn Asn Thr Thr Lys

260 265 270

Lys Phe Ile Arg Arg Tyr Gln Arg Arg Ala Ser Lys Thr Asp Lys Asp

275 280 285

Leu Thr Ile Phe Val Gly Phe Arg Thr Thr Ser Ser Thr Asp Glu Glu

290 295 300

Gly Asn Glu Arg Ile Ser Ile Leu Thr Ile Val Ser Ala Thr Phe His

305 310 315 320

Gly Ser Lys Asp Arg Leu Leu Gln Leu Val Gln Lys Glu Phe Pro Asp

325 330 335

Leu Gly Leu Val Ser Glu Glu Cys Thr Glu Met Ser Trp Val Arg Ser

340 345 350

Ile Ile His Phe Asn Leu Phe Gly Asp Glu Val Pro Leu Glu Val Leu

355 360 365

Leu Asn Arg Thr Leu Asn Phe Glu Met Lys Ala Phe Lys Leu Arg Ser

370 375 380

Asp Tyr Val Gln Lys Pro Ile Pro Asp Asp Val Leu Glu Lys Leu Leu

385 390 395 400

Ser Lys Leu Tyr Asp Glu Glu Thr Gly Glu Gly Tyr Ile Glu Phe Phe

405 410 415

Pro Tyr Gly Gly Lys Met SerLys Ile Ser Glu Ser Glu Ile Pro Phe

420 425 430

Pro Tyr Arg Ala Gly Asn Leu Tyr Asn Leu Arg Tyr Met Val Ser Trp

435 440 445

Lys Asp Asp Gly Asn Ile Thr Arg Thr Asn Met His Leu Ser Trp Ile

450 455 460

Lys Asp Ala Tyr Asp Tyr Met Thr Pro Tyr Val Ser Lys Asp Pro Arg

465 470 475 480

Gly Ala Tyr Leu Asn Phe Arg Asp Leu Asp Ile Gly Val Asn Val Asn

485 490 495

Glu Ser Asp Tyr Asp Tyr Val Ala Lys Ala Ser Val Trp Gly Thr Lys

500 505 510

Tyr Phe Arg Asn Asn Phe Tyr Arg Leu Val Asp Ile Lys Thr Ile Val

515 520 525

Asp Pro Thr Asn Phe Phe Lys Tyr Glu Gln Ser Ile Pro Pro Leu Pro

530 535 540

Pro Leu His Ser Ala Met

545 550

Claims

1. A protein or set of proteins characterized by:

the protein is a protein shown in any one of (A1) to (A4) as follows:

(A1) protein with amino acid sequence shown as SEQ ID No. 3;

(A4) a fusion protein obtained by attaching a tag to the N-terminus and/or C-terminus of a protein defined in any one of (A1) to (A3);

the protein set consists of protein A and protein B;

the protein A is a protein as shown in any one of (A1) to (A4) above;

the protein B is a protein shown in any one of the following (B1) to (B4):

(B1) protein with amino acid sequence shown as SEQ ID No. 4;

2. A nucleic acid molecule or a set of nucleic acid molecules, characterized in that: the nucleic acid molecule is a nucleic acid molecule encoding the protein of claim 1 or 2;

the nucleic acid molecule set consists of a nucleic acid molecule A and a nucleic acid molecule B;

the nucleic acid molecule A is a nucleic acid molecule encoding the protein A of claim 1 or 2;

the nucleic acid molecule B is a nucleic acid molecule encoding the protein B according to claim 1 or 2.

3. A nucleic acid molecule or a set of nucleic acid molecules according to claim 2, characterized in that:

the nucleic acid molecule is a DNA molecule shown in any one of (a1) to (a3) as follows:

(a1) DNA molecule with nucleotide sequence shown in SEQ ID No. 1;

(a2) a DNA molecule which hybridizes with the DNA molecule defined in (a1) under stringent conditions and encodes a protein represented by any one of (A1) - (A4) described in claim 1;

(a3) a DNA molecule which has 99% or more, 95% or more, 90% or more, 85% or more, or 80% or more homology to the DNA sequence defined in (a1) or (a2) and which encodes the protein represented by any one of (A1) to (A4) of claim 1;

the nucleic acid molecule A is a DNA molecule as shown in any one of (a1) to (a3) above;

the nucleic acid molecule B is a DNA molecule shown as any one of (B1) to (B3) as follows:

(b1) DNA molecule with nucleotide sequence shown in SEQ ID No. 2;

(b2) a DNA molecule which hybridizes under stringent conditions to the DNA molecule defined in (B1) and which encodes the protein B as claimed in claim 1;

(b3) a DNA molecule which has 99% or more, 95% or more, 90% or more, 85% or more or 80% or more homology with the DNA sequence defined in (B1) or (B2) and which encodes the protein B of claim 1.

4. Any of the following biological materials:

(c1) a recombinant vector comprising the nucleic acid molecule of claim 2 or 3;

(c2) an expression cassette comprising the nucleic acid molecule of claim 2 or 3;

(c3) a transgenic cell line comprising the nucleic acid molecule of claim 2 or 3;

(c4) a recombinant bacterium comprising the nucleic acid molecule according to claim 2 or 3;

(c5) the complete set of recombinant vector consists of a recombinant vector A and a recombinant vector B; the recombinant vector A is a recombinant vector containing the nucleic acid molecule A in claim 2 or 3; the recombinant vector B is a recombinant vector containing the nucleic acid molecule B of claim 2 or 3;

(c6) the complete set of expression cassette consists of an expression cassette A and an expression cassette B; the expression cassette A is an expression cassette comprising the nucleic acid molecule A of claim 2 or 3; the expression cassette B is an expression cassette comprising the nucleic acid molecule B according to claim 2 or 3;

(c7) the complete set of transgenic cell line consists of a transgenic cell line A and a transgenic cell line B; the transgenic cell line A is a transgenic cell line containing the nucleic acid molecule A according to claim 2 or 3; the transgenic cell line B is a transgenic cell line containing the nucleic acid molecule B according to claim 2 or 3;

(c8) the complete set of recombinant bacteria consists of recombinant bacteria A and recombinant bacteria B; the recombinant bacterium A is a recombinant bacterium containing the nucleic acid molecule A in claim 2 or 3; the recombinant bacterium B is a recombinant bacterium containing the nucleic acid molecule B according to claim 2 or 3.

5. A kit comprising any of: a protein or protein set according to claim 1, a nucleic acid molecule or nucleic acid molecule set according to claim 2 or 3, or a biological material according to claim 4.

6. The biological material of claim 4 or the kit of claim 5, wherein: the recombinant bacterium is a recombinant yeast containing the nucleic acid molecule of claim 2 or 3;

the recombinant bacterium A is a recombinant yeast containing the nucleic acid molecule A of claim 2 or 3; the recombinant bacterium B is a recombinant yeast containing the nucleic acid molecule B of claim 2 or 3;

further, the yeast is pichia pastoris.

7. Any of the following applications:

(C1) use of a protein or protein set according to claim 1 as a FAD-dependent oxidase in the anabolic pathway as a Diels-Alder adduct;

(C2) use of the protein of claim 1 to catalyze the dehydrorearrangement of the isopentenyl side chain of an isopentenyl phenolic compound to form a diene;

further, the isopentenyl phenol compound is morin C;

(C3) use of the protein of claim 1 to catalyze the dehydrogenation of an isopentenyl side chain of an isopentenyl phenolic compound followed by reaction with an ortho-C-4' hydroxyl group to form a ring;

further, the isopentenyl phenol compound is psoralen B or Morachalcone A;

(C4) use of the protein set of claim 1 for catalyzing a Diels-Alder adduct formed by a Diels-Alder reaction of an isopentenyl phenolic compound and a chalcone compound;

further, the application is the application of the protein set of claim 1 in catalyzing the reaction of the morusin C and the Morachalcone A to generate a Diels-Alder adduct, Chalcomoracin;

(C5) use of a protein or protein set according to claim 1 or a nucleic acid molecule or nucleic acid molecule set according to claim 2 or 3 or a biological material set according to claim 4 or a kit according to claim 5 for the production of a Diels-Alder adduct or for the preparation of a product for the production of a Diels-Alder adduct;

(C6) use of a protein or protein set according to claim 1 or a nucleic acid molecule or nucleic acid molecule set according to claim 2 or 3 or a biological material set according to claim 4 or a kit according to claim 5 for the preparation of a product having FAD-dependent oxidase activity in the Diels-Alder adduct anabolic pathway;

(C7) use of the protein of claim 1 or the nucleic acid molecule of claim 2 or 3 or the biological material of claim 4 or the kit of claim 5 for the preparation of a product capable of catalyzing the dehydrorearrangement of the isopentenyl side chain of an isopentenyl phenolic compound to form a diene;

further, the isopentenyl phenol compound is morin C;

(C8) use of the protein of claim 1 or the nucleic acid molecule of claim 2 or 3 or the biological material of claim 4 or the kit of claim 5 for preparing a product capable of catalyzing dehydrogenation of the side chain of an isopentenyl phenol compound followed by reaction with the hydroxyl group at the ortho-position of the isopentenyl group to form a ring;

further, the use of the protein according to claim 1 or the nucleic acid molecule according to claim 2 or 3 or the biological material according to claim 4 or the kit according to claim 5 for preparing a product capable of catalyzing the dehydrogenation of psoralen or a Morachalcone A isopentenyl side chain and then reacting with a vicinal C-4' hydroxyl group to form a ring;

(C9) use of a protein or protein set according to claim 1 or a nucleic acid molecule or nucleic acid molecule set according to claim 2 or 3 or a biological material set according to claim 4 or a kit according to claim 5 for the preparation of a product for studying the mechanism of an enzymatic Diels-Alder type [4+2] cyclization reaction.

8. A process for the production of a Diels-Alder adduct comprising the steps of:

(D1) catalyzing dehydrorearrangement of an isopentenyl side chain of an isopentenyl phenolic compound to form a dienoic body with protein A of the protein set of claim 1;

(D2) catalyzing the Diels-Alder type [4+2] cyclization reaction between the diene and the chalcone double bond in step (D1) with protein B in the protein set of claim 1 to form a Diels-Alder type adduct.

9. The method of claim 8, wherein: the method is a method for producing a Diels-Alder adduct, Chalcomoracin, and comprises the following steps:

(E1) catalyzing dehydrorearrangement of a morin C isopentenyl side chain to a dienosome with protein A of the protein set of claim 1;

(E2) catalyzing the Diels-Alder type [4+2] cyclization reaction between said diene and the Morachalcone a double bond in step (E1) with protein B in said protein set of claim 1 to form the Diels-Alder type adduct Chalcomoracin;

and/or

In steps (D1) and (E1), the temperature of the catalysis is 20-40 ℃; and/or

In steps (D2) and (E2), the temperature of the catalysis is 20-40 ℃.

10. The application of claim 7 or the method of claim 9, wherein: the structure of the morin C is shown as a formula I; and/or

The structure of the diene body is shown as a formula II; and/or

The structure of psoralen B is shown in formula III; and/or

The structure of the Morachalcone A is shown as a formula IV; and/or

The structure of the Chalcomoracin is shown as a formula V; and/or

The product of the psoralen B isoamylene side chain which is dehydrogenated and then reacts with ortho-position C-4' hydroxyl to form a ring is shown as a formula VI; the product of the dehydrogenation of the Morachalcone A isoamylene side chain and the reaction of the dehydrogenation and the ortho-position C-4' hydroxyl to form a ring is shown as a formula VII;