CN111701019A

CN111701019A - Application of Dmatg5 gene in preparation of anti-salmonella enteritidis medicine

Info

Publication number: CN111701019A
Application number: CN202010473672.XA
Authority: CN
Inventors: 田铃; 李荣松; 吴坤钟; 吴文梅; 黄志君
Original assignee: South China Agricultural University
Current assignee: South China Agricultural University
Priority date: 2020-05-29
Filing date: 2020-05-29
Publication date: 2020-09-25
Anticipated expiration: 2040-05-29
Also published as: CN111701019B

Abstract

The invention relates to the technical field of genetic engineering, in particular to application of a Dmatg5 gene in preparation of a salmonella enteritidis resistant drug. The inventor finds that salmonella enteritidis can infect drosophila cells and induces the expression of a drosophila DmAtg5 gene in research, designs siRNA of the drosophila DmAtg5 gene on the basis and verifies the effect of the siRNA in resisting salmonella enteritidis; meanwhile, a method for rapidly detecting the proliferation condition of salmonella enteritidis in drosophila cells is developed, and a foundation is laid for deeply researching the interaction between intracellular parasitic bacteria such as salmonella enteritidis and the like and a host and further developing and utilizing a target point of salmonella enteritidis resistance.

Description

Application of Dmatg5 gene in preparation of anti-salmonella enteritidis medicine

Technical Field

The invention relates to the technical field of genetic engineering, in particular to application of a Dmatg5 gene in preparation of a salmonella enteritidis resistant drug.

Background

Autophagy (autophag) is an evolutionarily highly conserved process widely existing in eukaryotes, used for degrading and recycling biomacromolecules and damaged organelles in cells, is an important mechanism for maintaining metabolism and self-stabilization of organisms, and is closely related to various physiological and pathological processes of the organisms. Autophagy occurs throughout under the control of different autophagy-related proteins (ATG or ATG). Autophagy is an evolutionarily conserved process of cellular metabolism and breakdown, and at the same time plays an important role as an immune response during pathogen infection. Autophagy is the major type of autophagy and is characterized by the formation of bilayer membrane autophagosomes, which require the involvement of a series of autophagy-related proteins, two important ubiquitin-like protein systems, ATG5-ATG12, ATG16 and LC3/ATG 8-PE. Studies by Radhi et al (Radhi, o.a., Davidson, s., Scott, f., Zeng, r.x., Jones, d.h., Tomkinson, n.c.o., Yu, j., and Chan, e.y.w. (2019) Inhibition of the ULK1protein complex underlying staphylococcus-induced autophagy and cell death.j biol chem294,14289-14307) show that the ATG protein has a certain relationship to the virulence of a bacterium or viral pathogen. In mammals, down-regulation of the ULK1-ATG13 protein complex inhibits intracellular proliferation and host cell death of staphylococcus aureus. Bechelli et al (Bechelli, J., Vergara, L., Smalley, C., Buzhdygan, T.P., Bender, S., Zhang, W., Liu, Y., Popov, V.L., Wang, J., and Garg, N., et al (2019) Atg5supports Rickettsia australis infection in mammophages in vitro and in vivo in animal 87, Paharari, S., Negi, S., Aqdas, M., netArt, E., Schlesinger, L.S., and Agrewala, J.N (2019) examination of organization in vitro, C.S. 4, L.S., and III. in vitro, C.23, Mycobacterium tuberculosis, CN.23, Mycobacterium tuberculosis, Mycobacterium 3, Mycobacterium; ATG5 activates IL-1 β expression in mouse macrophages through a non-classical autophagy pathway, and plays a positive role in defense against rickettsial infections.

Many bacterial diseases are both human and animal diseases, and have great harm to human health and livestock and animal production. Salmonella enteritidis (Salmonella enteritidis) is an important pathogen of zoonosis, which not only affects the development of animal husbandry, but also brings serious harm to human health. In recent years, with the abuse of antibiotics in production and daily life, studies in some pathogenic bacteria such as Salmonella typhimurium have found that they have developed strong resistance and have a tendency toward the evolution of superbacteria. With the requirements of no antibiotic addition, environmental safety and the like in animal husbandry, how to adopt a new method and means to prevent and treat bacterial pathogens becomes an urgent priority.

Disclosure of Invention

The present invention is directed to solving at least one of the problems of the prior art. Therefore, the invention provides the application of the Atg gene in preparing an anti-salmonella enteritidis drug.

The technical scheme of the invention is shown as follows.

The invention provides an application of ATG5 gene in preparing anti-Salmonella enteritidis medicine.

According to some embodiments of the invention, the ATG5 gene is drosophila DmAtg5 gene.

Although the prior art has studied the correlation between the expression of the ATG gene and the virulence of a bacterial or viral pathogen, the mechanism is not clear; and is also irregularly related to the pathogenicity of any pathogenic bacteria. The drosophila melanogaster, as a common model organism, provides a very favorable reference and leading effect for human related researches in the researches of analyzing embryonic development, innate immunity and the like. The research shows that the pathogens of many mammals can also infect the cells or living bodies of the drosophila, and the established drosophila-pathogen intermediate research model discovers pathogen-host or action and host defense mechanisms which are not found in many original hosts and provides a basis for explaining the infection, pathogenesis and prevention and treatment of related pathogens. Through a large amount of scientific researches, the inventor discovers that after the Dmagg 5 gene of the drosophila is inhibited, the proliferation of the Salmonella enteritidis in the cell is obviously higher than that of a blank control group by carrying out an infection test of the Salmonella enteritidis, namely, the resistance to the Salmonella enteritidis is reduced by inhibiting the expression of the Dmagg 5; therefore, the Dmatg gene, especially the Dmatg5 gene is expected to be a key target for inhibiting the salmonella enteritidis and plays an important role in preparing anti-salmonella enteritidis drugs.

According to some embodiments of the invention, the anti-salmonella enteritidis drug comprises a substance that enhances expression of the DmAtg5 gene, preferably, the substance is a small molecule substance and compound that enhances expression of the DmAtg5 gene.

The inventor researches and discovers that the bacterial infection resistance of cells can be reduced by inhibiting the expression of the Dmatg5 gene, so that the bacterial infection resistance can be increased by highly expressing the Dmatg5 gene.

According to some embodiments of the invention, the primer sequence used for detecting the salmonella enteritidis is

Dmrp49-F：GACAGTATCTGATGCCCAACA；

Dmrp49-R：CTTCTTGGAGGAGACGCCGT；

InvC-F：TCAAGAATAGAGCGAATTTCATCC；

InvC-R：TGCTTTTTATCGATTCCATGACCC。

The traditional method for detecting the salmonella enteritidis can only detect the existence of the salmonella enteritidis, but cannot be used for evaluating the proliferation condition of the salmonella enteritidis in host cells.

The invention also provides application of the ATG5 gene in screening drugs for inhibiting the activity of Salmonella enteritidis. Preferably, the ATG5 gene is Drosophila DmAtg5 gene.

In another aspect, the invention also provides an siRNA for inhibiting the expression of the Dmatg5 gene.

According to some embodiments of the invention, the nucleotide sequence of the siRNA is

F：GCAUUAAGCCGGAGCCUUUTT；

R：AAAGGCUCCGGCUUAAUGCTT。

The inventor designs siRNA for synthesizing DmaAtg 5 gene of drosophila melanogaster and verifies the function of the siRNA in resisting salmonella enteritidis; the siRNA of the Dmatg5 gene is convenient to synthesize, has obvious interference efficiency on a target gene, and can be used as an effective means and method for future related research and application.

According to some embodiments of the invention, the siRNA may be used in screening for a bacteriostatic active drug.

The invention also provides the application of the siRNA in screening bacteriostatic active medicines.

In still another aspect, the invention provides the use of the siRNA as described above in screening drugs for inhibiting the activity of Salmonella enteritidis.

The inventor finds that the salmonella enteritidis can infect drosophila cells and induces the expression of the drosophila DmAtg5 gene, and the expression of the drosophila DmAtg5 gene has a positive and effective effect on resisting the salmonella enteritidis. The DmAtg5 gene of the drosophila melanogaster is the main DmAtg gene induced after infection of salmonella enteritidis, and siRNA of the DmAtg5 gene of the drosophila melanogaster is designed on the basis to verify the effect of the gene in resisting salmonella enteritidis; meanwhile, a method for rapidly detecting the proliferation condition of salmonella enteritidis in drosophila cells is developed, and a foundation is laid for deeply researching the interaction between intracellular parasitic bacteria such as salmonella enteritidis and the like and a host and further developing and utilizing a target point of salmonella enteritidis resistance.

Drawings

FIG. 1 is a graph showing the effect of Salmonella enteritidis infection of Drosophila cells on the Dmatg gene;

FIG. 2 is a diagram showing the interference of siRNA to Dmatg5 gene;

FIG. 3 is a graph showing the inhibitory effect of Drosophila DmaAtg 5 gene on Salmonella enteritidis proliferation.

Detailed Description

The technical solutions and effects of the present invention will be further described and illustrated with reference to the following specific examples, but the present invention is not limited to these specific embodiments. The test methods used in the examples are all conventional methods unless otherwise specified; the materials, reagents and the like used are commercially available reagents and materials unless otherwise specified.

Example 1 Effect of Salmonella enteritidis infection of Drosophila cells on the Dmatg Gene

(1) Salmonella enteritidis infecting Drosophila S2 cells

3 biological replicates were established for each of the control and experimental groups.

Experimental groups were treated as follows: taking a 6-well plate as an example, drosophila S2 cells were plated for 18h in instect SIM SF medium (MSF1-1, sinand biol., china) containing 5% fetal bovine serum (FBS500-S, AusGeneX, australia), incubated with 50nM of water soluble cholesterol (134428, biberery, china) for 30min per well, followed by addition of salmonella enteritidis suspension (approximately 20 bacteria) and incubation at 28 ℃ for 1.5 h. The Drosophila S2 cells were then washed twice with phosphate buffered saline (PBS, pH7.4) in 100. mu.M CuSO₄And 10. mu.g/mL gentamicin in Insect SIM SF medium for 3 h. And washed twice with PBS.

Treatment of the control group: the same experiment group was performed without adding Salmonella enteritidis suspension.

(2) Collection of Drosophila s2 cells

The cell samples were transferred to 1.5mL RNase-free centrifuge tubes, centrifuged at 3,000g for 5min, the supernatant discarded, and the cell pellet retained for further experiments.

(3) RNA extraction is carried out on the precipitate, and interference efficiency is detected by utilizing a qPCR technology, and the method comprises the following specific steps:

(I) 1mL of TRIzol reagent was added to the above precipitate, and the mixture was thoroughly mixed and allowed to stand for 5 min.

(II) adding 200 mu L of trichloromethane, fully and uniformly mixing, and standing for 5 min.

(III) centrifuging at 12,000r/min below 4 deg.C for 15min, slowly transferring supernatant, placing in a new RNA-free enzyme centrifuge tube, adding isopropanol with equal volume, slowly mixing, and placing on ice box for about 20 min.

(IV) centrifuging at 12,000r/min below 4 deg.C for 10min, removing supernatant, adding 75% ethanol, and slowly resuspending and washing the precipitate.

(V) centrifuging at 12,000r/min below 4 deg.C for 10min, removing supernatant, blotting residual liquid, and adding appropriate amount of double distilled water without RNase.

(VI) the quality and concentration of RNA was determined by agarose gel electrophoresis and NanoDrop. After cDNA was generated by reverse transcription of RNA samples qualified in the detection using PrimeScriptTM RT kit (RR047A, TaKaRa, Japan), the change of autophagy genes Dmag 1, Dmag 5 and Dmagg 6 of Drosophila S2 cells in mRNA level was detected by qPCR technique.

The detection results are shown in fig. 1, and it can be seen that compared with the control, the expression levels of Dmatg5 and Dmatg6 are remarkably increased, and the expression levels of Dmatg5 are the most remarkably increased, which indicates that the Dmatg5 gene is the main Dmatg gene after the infection induction of the salmonella enteritidis. (experimental data analyzed by t-test, "+" indicates p <0.05, "+" indicates p <0.01, "+" indicates p < 0.001; values are expressed as mean ± sd of three independent biological replicates)

Example 2 interference of siRNA to Dmatg5 Gene

(1) Designing siRNA of DmAtg5 gene of drosophila S2 cells, wherein the sequence is F: GCAUUAAGCCGGAGCCUUUTT; AAAGGCUCCGGCUUAAUGCTT is added.

(2) siRNA of DmaAtg 5 gene was synthesized.

(3) The siRNA carries out RNA interference treatment on Dmagg 5 gene of Drosophila S2 cells.

Experimental groups: performing RNA interference treatment on DmAtg5 gene of Drosophila S2 cells for 48 h;

the specific operation is as follows:

for example, S2 cells were first plated into 6-well plates using Insect SIM SF medium (MSF1-1, Xinhe Biopsis, China) containing 5% fetal bovine serum (FBS500-S, AusGeneX, Australia). When the density is 60% -70%, transfection is carried out.

The transfection procedure was as follows:

step 1, serum-free SIM-SF culture medium and transfection reagent are put to room temperature in advance;

step 2, 200. mu.L of culture medium was taken from each well in a 1.5mL centrifuge tube according to the siRNA and transfection reagent: (

HD Transfection Reagent Promega, Madison, WI Cat # E2311) in a mass-to-volume ratio of 1:3, mixing in a centrifuge tube, standing for 10-15 min;

and 3, suspending and dripping the transfection mixed solution into a 6-well plate, changing the solution after 12 hours, and carrying out next treatment after 48 hours.

The control group is added with the siRNA of egfp gene, other operations are the same as those of the experimental group, and the subsequent treatment is also the same.

(4) The cell samples were transferred to 1.5mL RNase-free centrifuge tubes, centrifuged at 3,000g for 5min, the supernatant discarded, and the cell pellet retained for further experiments.

(5) RNA extraction is carried out on the precipitate, and interference efficiency is detected by utilizing a qPCR technology, and the method comprises the following specific steps:

(VI) the quality and concentration of RNA was determined by agarose gel electrophoresis and NanoDrop. After the RNA sample which is qualified for detection is subjected to reverse transcription by a PrimeScriptTM RT kit (RR047A, TaKaRa, Japan) to generate cDNA, the copy numbers of the Dmatg5 and Dmrp49 genes are detected by a qPCR technology, and the RNA interference efficiency of an experimental group relative to a control group can be visually seen after calculation. The interference efficiency was calculated to be 69.1%.

As shown in fig. 2, the results of siRNA interference with DmAtg5 gene are shown in the graph, where the ordinate represents the change in expression level of DmAtg5 gene after siRNA treatment of egfp gene and DmAtg5 gene in drosophila S2 cells, the abscissa represents different treatment groups, NC represents a control group (siRNA treatment of egfp gene on drosophila S2 cells), and DmAtg5RNAi represents an experimental group (siRNA treatment of DmAtg5 gene on drosophila S2 cells). As shown in the figure, after RNA interference is carried out on DmAtg5 gene of Drosophila by the siRNA, compared with a control group, the expression level of the DmAtg5 gene in an experimental group is obviously reduced, and the interference efficiency is obvious. (experimental data analyzed by t-test, "+" indicates p <0.05, "+" indicates p <0.01, "+" indicates p < 0.001; values are expressed as mean ± sd of three independent biological replicates)

Example 3 inhibitory Effect of Drosophila DmaAtg 5 Gene on Salmonella enteritidis proliferation

(1) RNA interference of Drosophila DmaAtg 5 gene

The experimental group and the control group are respectively provided with 3 biological replicates, and the operation of the experimental group is as follows: the RNA interference treatment of DmAtg5 gene of Drosophila S2 cells was performed for 48h by using siRNA of DmAtg5 in the present invention, and the specific procedure was the same as that of example 2.

Egfp siRNA was added to the control group, and the other operations were the same as those of the experimental group, and the subsequent treatments were the same.

(2) Salmonella enteritidis treatment

Adding 50nM water-soluble cholesterol into each well of the 6-well plate, and incubating for 30 min; adding the bacterial suspension in an amount of 20 bacteria/cell; culturing at 28 ℃ for 1.5h, and then washing the cells twice with PBS; liquid changing; adding a solution containing 100 μ M CuSO₄And SIM-SF culture medium of 10 mu g/mL gentamicin for 3 h; washing twice with PBS; mixing the aboveThe cell samples were transferred to a 1.5mL centrifuge tube, centrifuged at 3,000g for 5min, the supernatant discarded, and the pellet retained for further experiments.

(3) Detecting the proliferation condition of salmonella enteritidis: extracting the genome DNA of the precipitate by using a genome extraction kit (D3129-01, magenta, China), and detecting the proliferation condition of the salmonella enteritidis by using a qPCR technology, wherein the specific operations are as follows:

(I) 20 mu.L of protease K, 230 mu.L of buffer ITL and 180 mu.L of lysozyme (prepared into 20mg/mL by using buffer TE) are added into the precipitate, and the mixture is bathed for 2 hours at 37 ℃ to achieve the effects of digesting cells and cracking parasitic bacteria.

(II) Add 500. mu.L of buffer IL (diluted with absolute ethanol) to the digest and vortex for 30 s.

(III) HiPureg DNA micro column was loaded into a 2mL collection tube. The resulting mixture (including the precipitate) was transferred to a column. Centrifugation is carried out for 1min at 10000 g.

(IV) the filtrate is discarded and the column is returned to the collection tube. 600 μ L of buffer GW1 (diluted with absolute ethanol) was added to the column. 10000g for 1min, repeat this step 2 times.

(V) the filtrate was decanted and 75% by volume ethanol was added to 10000g of the column and centrifuged for 1 min.

(VI) the filtrate is decanted and the column is returned to the collection tube. 13000g for 3 min.

(VII) pouring off the filtrate, and standing for 3-5 min.

(VIII) the column was placed in a fresh 1.5mL centrifuge tube. Adding 30-50 μ L buffer AE preheated to 65 deg.C to the center of the column membrane, standing for 3min, centrifuging at 10000g for 1min, and collecting DNA

(IX) copy numbers of Drosophila Dmrp49 gene and Salmonella enteritidis InvC gene in the above DNA were determined by qPCR technique.

The sequence of a quantitative primer of the Dmrp49 gene is F: GACAGTATCTGATGCCCAACA, respectively; r: CTTCTTGGAGGAGACGCCGT, respectively;

the quantitative primer sequence of the InvC gene is F: TCAAGAATAGAGCGAATTTCATCC, respectively; r: TGCTTTTTATCGATTCCATGACCC are provided.

(4) Data processing

The expression quantities of the InvC gene and the Dmrp49 gene in the experimental group and the control group are respectively calculated, the ratio of the expression quantities is taken as a vertical coordinate, different processing groups are used as a horizontal coordinate to map, and the relationship between the proliferation condition of the salmonella enteritidis and the copy number of the Dmatg5 gene can be visually seen.

The results are shown in FIG. 3, the ordinate indicates the change in copy number of Salmonella enteritidis InvC gene after siRNA treatment of egfp gene and Dmatg5 gene, the abscissa indicates different treatment groups, NC is control group (SiRNA treatment of egfp gene on Drosophila S2 cells), and Dmatg5RNAi is experimental group (SiRNA treatment of Dmatg5 gene on Drosophila S2 cells). The figure shows that the proliferation of the salmonella enteritidis after the siRNA treatment of the Dmatg5 gene is obviously higher than that of a control group, namely, the drosophila S2 cells are more easily infected by the salmonella enteritidis after the RNA interference is carried out on the Dmatg5 gene. (experimental data analyzed by t-test, "+" indicates p <0.05, "+" indicates p <0.01, "+" indicates p < 0.001; values are expressed as mean ± sd of three independent biological replicates)

While the invention has been disclosed with reference to specific embodiments, it will be apparent that other embodiments and variations of the invention may be devised by those skilled in the art without departing from the true spirit and scope of the invention, and it is intended that the following claims be interpreted to include all such embodiments and equivalent variations. In addition, the contents of all references cited herein are hereby incorporated by reference.

Claims

Use of ATG5 gene in preparation of anti-Salmonella enteritidis medicine.
2. The use as claimed in claim 1, wherein the ATG5 gene is Drosophila DmAtg5 gene.
3. Use according to claim 1 or 2, characterized in that the anti-salmonella enteritidis drug comprises a substance that enhances the expression of the DmAtg5 gene.
4. The use of claim 1 or 2, wherein the primer sequence for detecting Salmonella enteritidis is as follows

Dmrp49-F：GACAGTATCTGATGCCCAACA；

Dmrp49-R：CTTCTTGGAGGAGACGCCGT；

InvC-F：TCAAGAATAGAGCGAATTTCATCC；

InvC-R：TGCTTTTTATCGATTCCATGACCC。
Use of ATG5 gene in screening drugs for inhibiting the activity of Salmonella enteritidis.
6. An siRNA for inhibiting the expression of the Dmatg5 gene, wherein the nucleotide sequence of the siRNA is:

F：GCAUUAAGCCGGAGCCUUUTT；

R：AAAGGCUCCGGCUUAAUGCTT。
7. siRNA according to claim 6, wherein said siRNA is useful in screening for bacteriostatic agents.
8. Use of the siRNA of claim 6 in screening for a bacteriostatic-active drug.
9. The use of the siRNA of claim 6 in screening for drugs that inhibit Salmonella enteritidis activity.