CN111690643A - DNA extraction reagent, kit and method for detecting corn kernel transgenosis - Google Patents
DNA extraction reagent, kit and method for detecting corn kernel transgenosis Download PDFInfo
- Publication number
- CN111690643A CN111690643A CN202010677028.4A CN202010677028A CN111690643A CN 111690643 A CN111690643 A CN 111690643A CN 202010677028 A CN202010677028 A CN 202010677028A CN 111690643 A CN111690643 A CN 111690643A
- Authority
- CN
- China
- Prior art keywords
- solution
- dna
- corn
- extraction reagent
- detected
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/10—Processes for the isolation, preparation or purification of DNA or RNA
- C12N15/1003—Extracting or separating nucleic acids from biological samples, e.g. pure separation or isolation methods; Conditions, buffers or apparatuses therefor
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/6851—Quantitative amplification
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/6895—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/166—Oligonucleotides used as internal standards, controls or normalisation probes
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Engineering & Computer Science (AREA)
- Organic Chemistry (AREA)
- Health & Medical Sciences (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Genetics & Genomics (AREA)
- Analytical Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Biotechnology (AREA)
- General Engineering & Computer Science (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Physics & Mathematics (AREA)
- Biomedical Technology (AREA)
- Biophysics (AREA)
- Biochemistry (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- General Health & Medical Sciences (AREA)
- Immunology (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Botany (AREA)
- Mycology (AREA)
- Crystallography & Structural Chemistry (AREA)
- Plant Pathology (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention is suitable for the technical field of biology, and provides a DNA extraction reagent, a kit for detecting corn kernel transgenosis and a method thereof, wherein the DNA extraction reagent is used for extracting the DNA of corn kernels and comprises the following components: solution A, solution B, solution C and solution D; the solution A comprises the following components: trihydroxymethyl aminomethane, ethylene diamine tetraacetic acid, sodium chloride, sorbitol, hexadecyl trimethyl ammonium bromide, lauryl sodium sulfate, hydrochloric acid, beta-mercaptoethanol and polyvinylpyrrolidone; the solution B comprises trichloromethane and isoamyl alcohol; the solution C comprises absolute ethyl alcohol and isopropanol; the solution D is a ribonuclease solution. According to the invention, through adjusting the formula of each component, the DNA extraction scheme is optimized, so that high-temperature water bath cracking is not required in the extraction process, the extraction time of DNA can be effectively shortened, and the quality of the extracted DNA is superior to that of the traditional scheme.
Description
Technical Field
The invention belongs to the technical field of biology, and particularly relates to a DNA extraction reagent, a kit and a method for detecting corn kernel transgenosis.
Background
When the corn is stored by an enterprise, whether the corn contains transgenic components or not needs to be detected. According to the industrial standard, detection is carried out in various qualified detection mechanisms, and accurate results can be obtained only after 5-10 working days. In the process of storage, the logistics vehicles need to obtain detection results in about 3 hours, and send the corns to an appointed place, otherwise, the production of enterprises is seriously influenced.
In addition, in the existing corn transgenic component detection scheme, in order to ensure the quality of DNA, a long-time water bath cracking process is generally introduced in the extraction process of the DNA, so that the extraction time of the DNA is long, and the overall speed of corn transgenic component detection is influenced.
Disclosure of Invention
An object of an embodiment of the present invention is to provide a DNA extraction reagent, which aims to solve the problems set forth in the background art.
The embodiment of the invention is realized by that a DNA extraction reagent is used for extracting the DNA of corn kernels, and comprises the following components:
solution A; every 120mL of the solution A comprises the following components: 1-3 g of trihydroxymethyl aminomethane, 0.01-0.05 g of ethylene diamine tetraacetic acid, 6.5-8.5 g of sodium chloride, 2-4 g of sorbitol, 0.8-1.5 g of hexadecyl trimethyl ammonium bromide, 2-3 g of sodium dodecyl sulfate, 600-800 mu L of hydrochloric acid, 0.5-1.5 mL of beta-mercaptoethanol and 0.5-1.5 g of polyvinylpyrrolidone;
solution B; the solution B comprises trichloromethane and isoamyl alcohol;
solution C; the solution C comprises absolute ethyl alcohol and isopropanol;
solution D; the solution D is a ribonuclease solution.
As a preferable scheme of the embodiment of the invention, the concentration of the hydrochloric acid is 10-12 mol/L.
As another preferable scheme of the embodiment of the invention, the volume ratio of the trichloromethane to the isoamyl alcohol in the solution B is (470-490) to (10-30).
As another preferable scheme of the embodiment of the invention, the volume ratio of the absolute ethyl alcohol to the isopropanol in the solution C is (70-90): 10-30.
As another preferable aspect of the embodiment of the present invention, the solution D includes a TE buffer and ribonuclease a; the concentration of the ribonuclease A in the solution D is 8-12 mu g/mL.
As another preferred aspect of the embodiments of the present invention, the moisture content of the corn kernel is not higher than 45%.
The invention also aims to provide a kit for detecting corn kernel transgenosis, which comprises standard DNA of corn kernels, an internal reference gene primer pair, a target gene primer pair and the DNA extraction reagent.
As another preferable scheme of the embodiment of the invention, the nucleotide sequence of the reference gene primer pair is shown in a sequence table SEQ ID NO. 1-2.
Another objective of the embodiments of the present invention is to provide a method for detecting transgene of corn kernel by using the above kit, which comprises the following steps:
extracting the DNA of the corn kernel to be detected by using the DNA extraction reagent to obtain a DNA template;
carrying out qPCR (quantitative polymerase chain reaction) test on the DNA template and the reference gene primer pair to obtain an amplification Ct value of the reference gene in the corn kernel to be detected;
carrying out qPCR test on the DNA template and the target gene primer pair to obtain an amplification Ct value of a target gene in the corn kernel to be detected;
calculating the difference value between the amplified Ct value of the target gene in the corn grain to be detected and the amplified Ct value of the reference gene in the corn grain to be detected, and recording the difference value as delta CtA；
Carrying out qPCR (quantitative polymerase chain reaction) test on the standard DNA of the corn grains and the internal reference gene primer pair to obtain a standard amplification Ct value of the internal reference gene;
carrying out qPCR (quantitative polymerase chain reaction) test on the standard DNA of the corn grains and the target gene primer pair to obtain a standard amplification Ct value of a target gene;
calculating the difference value of the standard amplification Ct value of the target gene and the standard amplification Ct value of the reference gene, and recording as delta CtB；
According to Δ CtAAnd Δ CtBAnd judging the content of the target transgenic component in the corn kernels to be detected.
As another preferred embodiment of the present invention, the step of extracting the DNA of the corn kernel to be detected by using the DNA extraction reagent to obtain the DNA template specifically includes:
crushing the corn kernels to be detected, and then uniformly mixing the crushed corn kernels with the solution A to obtain a mixture;
uniformly mixing the mixture with the solution B, and then performing centrifugal treatment to obtain a supernatant;
uniformly mixing the supernatant with the solution C, and then performing centrifugal treatment to obtain a first precipitate;
uniformly mixing the first precipitate with an ethanol aqueous solution, and then performing centrifugal treatment to obtain a second precipitate;
and drying the second precipitate, and uniformly mixing the second precipitate and the solution D at the temperature of 50-70 ℃ to obtain the DNA template.
According to the DNA extraction reagent provided by the embodiment of the invention, the formula of each component is adjusted, the DNA extraction scheme is optimized, high-temperature water bath cracking is not required in the extraction process, and the DNA extraction time can be effectively shortened to be within 30 minutes.
In addition, the embodiment of the invention also establishes a set of method for detecting the specific transgenic components of the sample based on the fluorescent quantitative PCR. According to the method, whether the sample to be detected contains specific transgenic components or not can be accurately identified, and the detection limit is 1 per thousand. The detection result of the method can reach the detection level of relevant industrial standards, and the total time for completing sample detection can be shortened to within 3 hours, thereby completely meeting the production requirements of enterprises.
Detailed Description
In order to make the objects, technical solutions and advantages of the present invention more apparent, the present invention is further described in detail with reference to the following embodiments. It should be understood that the specific embodiments described herein are merely illustrative of the invention and are not intended to limit the invention.
Example 1
The embodiment provides a kit for detecting corn kernel transgenosis, which comprises standard DNA of corn kernels, an internal reference gene primer pair, a target gene primer pair and a DNA extraction reagent for extracting the DNA of the corn kernels with the water content not higher than 45%. The standard DNA of the corn kernel refers to a reference DNA, or a DNA extracted from a traceable standard substance, or a DNA extracted from a sample (or organism) with a known sequence positive. The internal reference gene primer pair comprises TUB-F and TUB-R, and the nucleotide sequences of the internal reference gene primer pair are respectively TUB-F: CTACCTCACGGCATCTGCTATGT, respectively; TUB-R: GTCACACACACTCGACTTCACG (shown in sequence table SEQID NO: 1-2), but is not limited thereto. The target gene primer pair is designed aiming at transgenic components in the corn kernels, can be designed according to the actually required detected transgenic components, and is not limited; for example, for the pCaMV35S transgene component, the target gene primer pair may comprise 35S-F and 35S-R, the nucleotide sequences of which are 35S-F: GCTCCTACAAATGCCATCATTGC, respectively; 35S-R: GATAGTGGGATTGTGCGTCATCCC (shown in SEQ ID NO: 3-4 of the sequence list), but is not limited thereto.
In addition, the DNA extraction reagent includes solution A, solution B, solution C and solution D.
The preparation method of the solution A comprises the following steps: uniformly mixing 2g of tris (hydroxymethyl) aminomethane, 0.03g of ethylene diamine tetraacetic acid, 7.63g of sodium chloride, 3.2g of sorbitol, 1.2g of hexadecyl trimethyl ammonium bromide, 2.4g of sodium dodecyl sulfate, 700 mu L of 12mol/L hydrochloric acid, 1mL of beta-mercaptoethanol and 1.2g of polyvinylpyrrolidone, and then carrying out constant volume to 120mL by using pure water to obtain a solution A.
Solution B was prepared by mixing 480mL of chloroform with 20mL of isoamyl alcohol.
Solution C was prepared by mixing 80mL of absolute ethanol and 20mL of isopropanol.
The solution D is a ribonuclease A solution prepared from ribonuclease A and 1 XTE buffer solution, wherein the concentration of ribonuclease A is 10 mug/mL, and the rest is 1 XTE buffer solution.
Example 2
The embodiment provides a kit for detecting corn kernel transgenes, which is different from the kit in embodiment 1 in that the adopted DNA extraction reagent is different.
Specifically, the DNA extraction reagent comprises a solution A, a solution B, a solution C and a solution D.
The preparation method of the solution A comprises the following steps: uniformly mixing 1g of tris (hydroxymethyl) aminomethane, 0.01g of ethylenediamine tetraacetic acid, 6.5g of sodium chloride, 2g of sorbitol, 0.8g of hexadecyl trimethyl ammonium bromide, 2g of sodium dodecyl sulfate, 600 mu L of 10mol/L hydrochloric acid, 0.5mL of beta-mercaptoethanol and 0.5g of polyvinylpyrrolidone, and then carrying out constant volume to 120mL by using pure water to obtain a solution A.
Solution B was prepared by mixing 470mL of chloroform with 30mL of isoamyl alcohol.
Solution C was prepared by mixing 70mL of absolute ethanol with 30mL of isopropanol.
The solution D is a ribonuclease A solution prepared from ribonuclease A and 1 XTE buffer solution, wherein the concentration of ribonuclease A is 8 mug/mL, and the rest is 1 XTE buffer solution.
Example 3
The embodiment provides a kit for detecting corn kernel transgenes, which is different from the kit in embodiment 1 in that the adopted DNA extraction reagent is different.
Specifically, the DNA extraction reagent comprises a solution A, a solution B, a solution C and a solution D.
The preparation method of the solution A comprises the following steps: uniformly mixing 3g of tris (hydroxymethyl) aminomethane, 0.05g of ethylenediamine tetraacetic acid, 8.5g of sodium chloride, 4g of sorbitol, 1.5g of hexadecyl trimethyl ammonium bromide, 3g of sodium dodecyl sulfate, 800 mu L of 11mol/L hydrochloric acid, 1.5mL of beta-mercaptoethanol and 1.5g of polyvinylpyrrolidone, and then carrying out constant volume to 120mL by using pure water to obtain a solution A.
Solution B was prepared by mixing 490mL of chloroform with 10mL of isoamyl alcohol.
Solution C was prepared by mixing 90mL of absolute ethanol with 10mL of isopropanol.
The solution D is a ribonuclease A solution prepared from ribonuclease A and 1 XTE buffer solution, wherein the concentration of ribonuclease A is 12 μ g/mL, and the rest is 1 XTE buffer solution.
Example 4
This embodiment provides a method for detecting a maize grain transgene (pCaMV35S) using the kit provided in example 1 above, comprising the steps of:
s1, extracting the DNA of the corn kernel to be detected by using the DNA extraction reagent provided by the embodiment 1:
s11, putting 1kg of corn kernels with water content not higher than 45% into a pulverizer to pulverize for 40S to obtain sample powder; then, 0.1g of the sample powder was put into a 1.5mL centrifuge tube, and 400. mu.L of the above solution A was added to the centrifuge tube, the centrifuge tube was closed, and the mixture was vigorously shaken and mixed (about 30s) to obtain a mixture.
S12, opening the centrifuge tube, adding 500 microliters of the solution B into the mixture, closing the centrifuge tube, turning over and mixing uniformly (about 5 times), then performing centrifugation treatment at 12000rpm for 2min, and taking the supernatant to obtain the supernatant.
S13, opening the centrifuge tube, sucking 200 microliters of supernatant, transferring the supernatant to a new 1.5mL centrifuge tube, adding 200 microliters of the solution C, closing the centrifuge tube, turning the centrifuge tube up and down and mixing the mixture uniformly (about 8 times), then performing centrifugation treatment at 12000rpm for 2min, then opening the centrifuge tube, and discarding the supernatant to obtain a first precipitate.
S14, adding 300 microliters of 70% ethanol aqueous solution into the first precipitate, closing the centrifugal tube, turning the centrifugal tube up and down (about 5 times), then performing centrifugal treatment at 12000rpm for 1min, then opening the centrifugal tube, and discarding the supernatant to obtain a second precipitate.
And S15, inverting and drying the second precipitate for 3min, adding 80 microliters of the solution D preheated at 60 ℃ into the second precipitate, closing the centrifuge tube, and uniformly mixing to obtain the DNA template.
And S2, carrying out qPCR test on the DNA template and the reference gene primer pair to obtain the amplification Ct value of the reference gene in the corn kernel to be detected. Wherein, in the step, the reaction system of the qPCR test is as follows: 10 mu L of 2 XSSYBA GREENMIX, 1 mu L of internal reference gene primer pair (the nucleotide sequences are respectively shown as the sequence table SEQ ID NO: 1-2, the concentration of each of TUB-F and TUB-R is 0.5 mu L, the concentration is 10 pmol/mu L), 1 mu L of the DNA template (the concentration is 0.1 mu g/mu L), and the DNA template is made up to 20 mu L by double distilled water; the qPCR reaction cycle parameters were as follows: 20sec at 95 ℃; the PCR reaction cycle parameters can be adjusted properly according to different gene amplification instruments, such as 95 ℃ 5sec, 60 ℃ 20sec, 40 cycles. In addition, if the amplification signal is not generated in this step, it is indicated that there is a problem in the quality of DNA extraction, or that PCR inhibitory factors exist in the DNA extract solution, and DNA should be re-extracted until the amplification signal of the fragment is collected.
S3, carrying out qPCR test on the DNA template and the target gene primer pair to obtain the amplification Ct value of the target gene in the corn kernel to be detected. Wherein, in the step, the reaction system of the qPCR test is as follows: 10 mu L of 2 XSSYBA GREEN MIX, 1 mu L of internal reference gene primer pair (the nucleotide sequences are respectively 0.5 mu L of 35S-F and 35S-R shown in SEQ ID NO: 3-4 of a sequence table, the concentrations of the two are 10 pmol/mu L), 1 mu L of the DNA template (the concentration is 0.1 mu g/mu L), and the DNA template is made up to 20 mu L by double distilled water; the qPCR reaction cycle parameters were as follows: 20sec at 95 ℃; the PCR reaction cycle parameters can be adjusted properly according to different gene amplification instruments, such as 95 ℃ 5sec, 60 ℃ 20sec, 40 cycles. In addition, if no amplification signal is generated in the step, the corn kernel to be detected does not contain transgenic components such as pCaMV35S and the like.
S4, calculating the difference value between the amplification Ct value of the target gene in the corn grain to be detected and the amplification Ct value of the reference gene in the corn grain to be detected, and recording the difference value as delta CtA。
S5, carrying out qPCR test on the standard DNA of the corn grains and the internal reference gene primer pair to obtain a standard amplification Ct value of the internal reference gene. Wherein, in the step, the reaction system of the qPCR test is as follows: 10 mu L of 2 XSSYBA GREEN MIX, 1 mu L of internal reference gene primer pair (the nucleotide sequences are respectively shown as the sequence table SEQ ID NO: 1-2, the concentration of each of TUB-F and TUB-R is 0.5 mu L, the concentration is 10 pmol/mu L), 1 mu L of standard DNA (the concentration is 0.1 mu g/mu L), and the solution is made up to 20 mu L by double distilled water; the qPCR reaction cycle parameters were as follows: 20sec at 95 ℃; the PCR reaction cycle parameters can be adjusted properly according to different gene amplification instruments, such as 95 ℃ 5sec, 60 ℃ 20sec, 40 cycles.
S6, carrying out qPCR test on the standard DNA of the corn grains and the target gene primer pair to obtain a standard amplification Ct value of the target gene. Wherein, in the step, the reaction system of the qPCR test is as follows: 10 mu L of 2 XSSYBA GREEN MIX, 1 mu L of internal reference gene primer pair (the nucleotide sequences are respectively 0.5 mu L of 35S-F and 35S-R shown in SEQ ID NO: 3-4 of a sequence table, the concentrations of the two are 10 pmol/mu L), 1 mu L of standard DNA (the concentration is 0.1 mu g/mu L), and the solution is made up to 20 mu L by double distilled water; the qPCR reaction cycle parameters were as follows: 20sec at 95 ℃; the PCR reaction cycle parameters can be adjusted properly according to different gene amplification instruments, such as 95 ℃ 5sec, 60 ℃ 20sec, 40 cycles.
S7, calculating the difference between the standard amplification Ct value of the target gene and the standard amplification Ct value of the reference gene, and recording the difference as delta CtB。
S8, according to Delta CtAAnd Δ CtBAnd judging the content of the target transgenic component in the corn kernels to be detected. Specifically, comparison of Δ CtAAnd Δ CtBIf Δ CtA＞ΔCtBIf so, indicating that the content of the specific transgenic component in the corn kernel to be detected is less than that in the standard DNA; if Δ CtA＝ΔCtBIf so, indicating that the content of the specific transgenic component in the corn kernel to be detected is equal to the content of the specific transgenic component in the standard DNA; if Δ CtA＜ΔCtBAnd then, the content of the specific transgenic component in the corn kernel to be detected is larger than that in the standard DNA.
In the above method, a blank control group may be provided; the blank control included all the reagents except for the test sample DNA template, and the qPCR test was performed in a PCR system with the same volume of water (without nucleic acid) replacing the template DNA.
Example 5
This embodiment provides a method for detecting transgene of corn kernel by using the kit provided in the above embodiment 2, which is different from embodiment 4 in step S1, specifically, in this embodiment, step S1 includes the following steps:
s11, putting 1kg of corn kernels with water content not higher than 45% into a powdering machine, and crushing for 50S to obtain sample powder; then, 0.1g of the sample powder was put into a 1.5mL centrifuge tube, and 500. mu.L of the above solution A was added to the centrifuge tube, the centrifuge tube was closed, and the mixture was vigorously shaken and mixed (about 30s) to obtain a mixture.
S12, opening the centrifuge tube, adding 600 microliters of the solution B into the mixture, closing the centrifuge tube, turning over and mixing uniformly (about 5 times), then performing centrifugation treatment at 12000rpm for 2min, and taking the supernatant to obtain the supernatant.
S13, opening the centrifuge tube, sucking 250 microliters of supernatant, transferring the supernatant into a new 1.5mL centrifuge tube, adding 250 microliters of the solution C, closing the centrifuge tube, turning the centrifuge tube up and down to mix uniformly (about 8 times), then centrifuging the mixture at 12000rpm for 2min, then opening the centrifuge tube, and discarding the supernatant to obtain a first precipitate.
S14, adding 400 microliters of 80% ethanol aqueous solution into the first precipitate, closing the centrifugal tube, turning the centrifugal tube up and down (about 5 times), then performing centrifugal treatment at 12000rpm for 1min, then opening the centrifugal tube, and discarding the supernatant to obtain a second precipitate.
And S15, inverting and drying the second precipitate for 3min, adding 90 microliters of the solution D preheated at 70 ℃ into the second precipitate, closing the centrifuge tube, and uniformly mixing to obtain the DNA template.
Example 6
This embodiment provides a method for detecting transgene of corn kernel by using the kit provided in the above embodiment 3, which is different from embodiment 4 in step S1, specifically, in this embodiment, step S1 includes the following steps:
s11, putting 1kg of corn kernels with water content not higher than 45% into a powdering machine, and crushing for 50S to obtain sample powder; then, 0.1g of the sample powder was put into a 1.5mL centrifuge tube, and 300. mu.L of the above solution A was added to the centrifuge tube, the centrifuge tube was closed, and the mixture was vigorously shaken and mixed (about 30s) to obtain a mixture.
S12, opening the centrifuge tube, adding 400 microliters of the solution B into the mixture, closing the centrifuge tube, turning over and mixing uniformly (about 5 times), then performing centrifugation treatment at 12000rpm for 2min, and taking the supernatant to obtain the supernatant.
S13, opening the centrifuge tube, sucking 150 microliters of supernatant, transferring the supernatant to a new 1.5mL centrifuge tube, adding 150 microliters of the solution C, closing the centrifuge tube, turning the centrifuge tube up and down and mixing the mixture uniformly (about 8 times), then performing centrifugation treatment at 12000rpm for 2min, then opening the centrifuge tube, and discarding the supernatant to obtain a first precipitate.
S14, adding 200 microliters of 60% ethanol aqueous solution into the first precipitate, closing the centrifugal tube, turning the centrifugal tube up and down (about 5 times), then performing centrifugal treatment at 12000rpm for 1min, then opening the centrifugal tube, and discarding the supernatant to obtain a second precipitate.
And S15, inverting and drying the second precipitate for 3min, adding 70 microliters of the solution D preheated at 50 ℃ into the second precipitate, closing the centrifuge tube, and uniformly mixing to obtain the DNA template.
Experimental example:
the Ct values of the target gene and the reference gene of 8 groups of corn kernels to be detected, the standard DNA and the blank control group are respectively detected according to the method provided in the above embodiment 4, and the detection results are shown in table 1.
TABLE 1
| Sample numbering | Ct value of target gene | Ct value of reference gene | ΔCtA | ΔCtB | The result of the detection |
| 1 | 32.981 | 21.659 | 11.3215 | - | ΔCtA＞ΔCtB |
| 2 | 30.317 | 21.973 | 8.3439 | - | ΔCtA＞ΔCtB |
| 3 | 30.395 | 22.092 | 8.3034 | - | ΔCtA＞ΔCtB |
| 4 | 30.421 | 22.266 | 8.1558 | - | ΔCtA＞ΔCtB |
| 5 | 29.993 | 20.939 | 9.0535 | - | ΔCtA＞ΔCtB |
| 6 | 30.133 | 20.983 | 9.1493 | - | ΔCtA＞ΔCtB |
| 7 | 28.983 | 21.348 | 7.6346 | - | ΔCtA＞ΔCtB |
| 8 | 30.020 | 21.231 | 8.7892 | - | ΔCtA＞ΔCtB |
| Standard DNA | 26.321 | 22.290 | - | 4.0304 | - |
| Blank control | 35.909 | 22.674 | - | - | - |
As can be seen from Table 1, the detection results of transgenic detection of 8 groups of corn kernels to be detected by using the method provided in embodiment 4 of the invention are all delta CtA＞ΔCtBNamely, the content of transgenic components (pCaMV35S) in 8 groups of corn kernels to be detected is less than that of standard DNA (deoxyribonucleic acid), and the content is in accordance with relevant industry standardsThe detection results are consistent.
The above-mentioned embodiments only express several embodiments of the present invention, and the description thereof is more specific and detailed, but not construed as limiting the scope of the present invention. It should be noted that, for a person skilled in the art, several variations and modifications can be made without departing from the inventive concept, which falls within the scope of the present invention. Therefore, the protection scope of the present patent shall be subject to the appended claims.
Sequence listing
<110> Jilin province academy of agricultural sciences
<120> DNA extraction reagent, kit and method for detecting corn grain transgenosis
<160>4
<170>SIPOSequenceListing 1.0
<210>1
<211>23
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>1
ctacctcacg gcatctgcta tgt 23
<210>2
<211>22
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>2
gtcacacaca ctcgacttca cg 22
<210>3
<211>23
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>3
gctcctacaa atgccatcat tgc 23
<210>4
<211>24
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>4
gatagtggga ttgtgcgtca tccc 24
Claims (10)
1. A DNA extraction reagent for extracting DNA of corn kernels, which is characterized by comprising:
solution A; every 120mL of the solution A comprises the following components: 1-3 g of trihydroxymethyl aminomethane, 0.01-0.05 g of ethylene diamine tetraacetic acid, 6.5-8.5 g of sodium chloride, 2-4 g of sorbitol, 0.8-1.5 g of hexadecyl trimethyl ammonium bromide, 2-3 g of sodium dodecyl sulfate, 600-800 mu L of hydrochloric acid, 0.5-1.5 mL of beta-mercaptoethanol and 0.5-1.5 g of polyvinylpyrrolidone;
solution B; the solution B comprises trichloromethane and isoamyl alcohol;
solution C; the solution C comprises absolute ethyl alcohol and isopropanol;
solution D; the solution D is a ribonuclease solution.
2. The DNA extraction reagent according to claim 1, wherein the concentration of the hydrochloric acid is 10 to 12 mol/L.
3. The DNA extraction reagent according to claim 1, wherein the volume ratio of chloroform to isoamyl alcohol in the solution B is (470-490) to (10-30).
4. The DNA extraction reagent according to claim 1, wherein the volume ratio of the absolute ethanol to the isopropanol in the solution C is (70-90): (10-30).
5. The DNA extraction reagent according to claim 1, wherein the solution D comprises TE buffer and ribonuclease A; the concentration of the ribonuclease A in the solution D is 8-12 mu g/mL.
6. The DNA extraction reagent of claim 1, wherein the corn kernel has a moisture content of no more than 45%.
7. A kit for detecting corn kernel transgenosis comprises standard DNA of corn kernels, an internal reference gene primer pair and a target gene primer pair, and is characterized by further comprising the DNA extraction reagent as claimed in any one of claims 1 to 6.
8. The kit for detecting corn kernel transgenosis according to claim 7, wherein the nucleotide sequence of the internal reference gene primer pair is shown as SEQ ID NO 1-2 of the sequence table.
9. A method for detecting transgenes of corn kernels by using the kit of claim 7 or 8, comprising the following steps:
extracting the DNA of the corn kernel to be detected by using the DNA extraction reagent to obtain a DNA template;
carrying out qPCR (quantitative polymerase chain reaction) test on the DNA template and the reference gene primer pair to obtain an amplification Ct value of the reference gene in the corn kernel to be detected;
carrying out qPCR test on the DNA template and the target gene primer pair to obtain an amplification Ct value of a target gene in the corn kernel to be detected;
calculating the difference value between the amplified Ct value of the target gene in the corn grain to be detected and the amplified Ct value of the reference gene in the corn grain to be detected, and recording the difference value as delta CtA；
Carrying out qPCR (quantitative polymerase chain reaction) test on the standard DNA of the corn grains and the internal reference gene primer pair to obtain a standard amplification Ct value of the internal reference gene;
carrying out qPCR (quantitative polymerase chain reaction) test on the standard DNA of the corn grains and the target gene primer pair to obtain a standard amplification Ct value of a target gene;
calculating the difference value of the standard amplification Ct value of the target gene and the standard amplification Ct value of the reference gene, and recording as delta CtB；
According to Δ CtAAnd Δ CtBAnd judging the content of the target transgenic component in the corn kernels to be detected.
10. The method for detecting the transgene of corn kernel as claimed in claim 9, wherein the step of extracting the DNA of the corn kernel to be detected by using the DNA extraction reagent to obtain the DNA template specifically comprises:
crushing the corn kernels to be detected, and then uniformly mixing the crushed corn kernels with the solution A to obtain a mixture;
uniformly mixing the mixture with the solution B, and then performing centrifugal treatment to obtain a supernatant;
uniformly mixing the supernatant with the solution C, and then performing centrifugal treatment to obtain a first precipitate;
uniformly mixing the first precipitate with an ethanol aqueous solution, and then performing centrifugal treatment to obtain a second precipitate;
and drying the second precipitate, and uniformly mixing the second precipitate and the solution D at the temperature of 50-70 ℃ to obtain the DNA template.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202010677028.4A CN111690643A (en) | 2020-07-14 | 2020-07-14 | DNA extraction reagent, kit and method for detecting corn kernel transgenosis |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202010677028.4A CN111690643A (en) | 2020-07-14 | 2020-07-14 | DNA extraction reagent, kit and method for detecting corn kernel transgenosis |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN111690643A true CN111690643A (en) | 2020-09-22 |
Family
ID=72485913
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202010677028.4A Pending CN111690643A (en) | 2020-07-14 | 2020-07-14 | DNA extraction reagent, kit and method for detecting corn kernel transgenosis |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN111690643A (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN116287106A (en) * | 2022-12-30 | 2023-06-23 | 上海碧云天生物技术有限公司 | Method and reagent for enhancing firefly luciferase ATP bioluminescence detection performance |
Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20080028482A1 (en) * | 2003-12-15 | 2008-01-31 | Beazley Kim A | Corn Plant Mon88017 and Compositions and Methods for Detection Thereof |
| CN102533728A (en) * | 2011-12-30 | 2012-07-04 | 中国科学院武汉植物园 | Method for extracting high-quality cell nucleus DNA (Deoxyribonucleic Acid) of plant rich in polysaccharide and polyphenol |
| CN102876800A (en) * | 2012-03-22 | 2013-01-16 | 中国农业科学院生物技术研究所 | Quantitative detection method of phytase gene in transfer phytase gene corn or feed |
| CN108812298A (en) * | 2018-07-16 | 2018-11-16 | 河北农业大学 | Method for rapidly and accurately breeding sweet and glutinous double recessive maize inbred line |
-
2020
- 2020-07-14 CN CN202010677028.4A patent/CN111690643A/en active Pending
Patent Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20080028482A1 (en) * | 2003-12-15 | 2008-01-31 | Beazley Kim A | Corn Plant Mon88017 and Compositions and Methods for Detection Thereof |
| CN102533728A (en) * | 2011-12-30 | 2012-07-04 | 中国科学院武汉植物园 | Method for extracting high-quality cell nucleus DNA (Deoxyribonucleic Acid) of plant rich in polysaccharide and polyphenol |
| CN102876800A (en) * | 2012-03-22 | 2013-01-16 | 中国农业科学院生物技术研究所 | Quantitative detection method of phytase gene in transfer phytase gene corn or feed |
| CN108812298A (en) * | 2018-07-16 | 2018-11-16 | 河北农业大学 | Method for rapidly and accurately breeding sweet and glutinous double recessive maize inbred line |
Non-Patent Citations (4)
| Title |
|---|
| NIU, C等: "A safe inexpensive method to isolate high quality plant and fungal DNA in an open laboratory environment", 《AFRICAN JOURNAL OF BIOTECHNOLOGY》 * |
| 刘小勇等: "提取植物和微生物DNA的SDS-CTAB改进法", 《北京林业大学学报》 * |
| 杨玉红，刘中深主编: "《生物技术概论》", 31 August 2011, 武汉：武汉理工大学出版社 * |
| 杨瑞等: "一种适于番茄RAPD分析的DNA快速提取方法", 《北京农学院学报》 * |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN116287106A (en) * | 2022-12-30 | 2023-06-23 | 上海碧云天生物技术有限公司 | Method and reagent for enhancing firefly luciferase ATP bioluminescence detection performance |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| EP1891232B1 (en) | Pcr diagnostics of dermatophytes and other pathogenic fungi | |
| CN101492743B (en) | Pathogenic epiphyte detection gene chip | |
| WO2008092016A2 (en) | Methods, compositions, and kits for detection of micro rna | |
| CN114085903B (en) | Primer pair probe combination product for detecting mitochondria 3243A & gtG mutation, kit and detection method thereof | |
| CN108315460B (en) | Synchronous detection kit for six-type mycotoxin producing bacteria | |
| CN111394347B (en) | Preparation method of candida-free nucleic acid sample suitable for PCR (polymerase chain reaction) experiment | |
| CN112980966A (en) | Method for identifying whether body fluid to be detected is peripheral blood, menstrual blood, saliva, semen or vaginal secretion by using discriminant analysis | |
| CN107974511B (en) | Kit for detecting specificity of isaria farinosa and detection method thereof | |
| KR20160106040A (en) | Compositions and methods for multimodal analysis of cmet nucleic acids | |
| CN105087759B (en) | Identify copy number of target genes and the method for screening low-copy plant in genetically modified plants | |
| CN111690643A (en) | DNA extraction reagent, kit and method for detecting corn kernel transgenosis | |
| CN107743521A (en) | The separation of nucleic acid | |
| CN111705149B (en) | Burkholderia gladioli fluorescence quantitative PCR reference gene and screening and application of primer thereof | |
| CN110846433B (en) | KASP marker related to drug resistance of wheat powdery mildew and application thereof | |
| Rueckert et al. | Use of an armored RNA standard to measure microcystin synthetase E gene expression in toxic Microcystis sp. by reverse‐transcription QPCR | |
| CN108103160A (en) | A kind of XPC genes rs2228001 sites SNP nucleic acid Mass Spectrometry detection methods | |
| CN115852033B (en) | Molecular Markers of GS3 Gene and GW5 Gene for Improving Rice Quality | |
| CN101560515A (en) | Specific gene sequence of tilletia controversa kuhn, specific SCAR marker and PCR detection method | |
| CN101575651A (en) | LAMP detection kit of porcine parvovirus and detection method thereof | |
| Minaeva et al. | First detection of fungus Fusarium coffeatum in the territory of the Russian Federation | |
| CN112226532B (en) | Application of substance for detecting polymorphism of SNP in corn genome in identification of corn cadmium content | |
| CN114717352A (en) | Molecular marker of rice high temperature resistance regulation gene Hsp70 and application thereof | |
| KR102147340B1 (en) | A composition for detecting Ganoderma microorganism and diagnosing basal stem rot and a method using the same | |
| CN113136447A (en) | PCR-HRM detection method for rapidly distinguishing mating types of rice blast germs | |
| CN107312775B (en) | Application of hsa _ circRNA _103096 in diagnosis, treatment and prognosis of liver cancer |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20200922 |
|
| RJ01 | Rejection of invention patent application after publication |