CN111690583A

CN111690583A - Shewanella for expressing functionalized amyloid fiber and construction method and application thereof

Info

Publication number: CN111690583A
Application number: CN202010430308.5A
Authority: CN
Inventors: 雍阳春; 索迪; 方真
Original assignee: Jiangsu University
Current assignee: Jiangsu University
Priority date: 2020-05-20
Filing date: 2020-05-20
Publication date: 2020-09-22
Anticipated expiration: 2040-05-20
Also published as: CN111690583B

Abstract

The invention belongs to the technical field of genetic engineering, and particularly relates to Shewanella capable of expressing functionalized amyloid fibers and a construction method and application thereof. The invention adopts Shewanella shewanella MR-1 as a host of functionalized curli, translates peptide structural domain LACQCL into nucleotide sequence, and finally constructs gene segment csgA-LACQCL for expressing functionalized amyloid fiber curli by connecting flexible sequence with C end of subunit csgA gene of amyloid fiber curli of escherichia coli, thereby realizing the function of peptide structural domain. The invention also provides a heavy metal ion adsorption biomembrane, which has strong tolerance and adsorption effect on various heavy metal ions, still has better metal ion removal rate after repeated adsorption for many times, overcomes the defects of long synthesis time, specific adsorption, high cost and the like of the traditional process, and has better commercial application value in the aspect of metal ion adsorption treatment in water environment.

Description

Shewanella for expressing functionalized amyloid fiber and construction method and application thereof

Technical Field

The invention belongs to the technical field of genetic engineering, and particularly relates to Shewanella capable of expressing functionalized amyloid fibers and a construction method and application thereof.

Background

Heavy metal pollution is one of the important problems of water body pollution, and the main source of the heavy metal pollution is industrial wastewater. Heavy metals in aquatic ecosystems are not degraded, their existence in nature causes them to accumulate in food chain, thus generating toxic action to animals and plants, excessive heavy metals can accumulate in plants, and can enter human and animal bodies through food chain and accumulate, thus causing acute or chronic poisoning and serious threat to human life. Therefore, the removal of toxic heavy metals from wastewater is in need of solution.

Biosorption is the ability of biological materials to accumulate heavy metals from wastewater through metabolic processes or physical chemical adsorption pathways. Compared with a physical and chemical repair method, the biological adsorption method has the advantages of low cost, quick repair, no secondary pollution and the like. The biological materials mainly comprise algae, bacteria, fungi, yeast and the like. At present, the removal of heavy metals from wastewater by biological materials is influenced by physical and chemical parameters, and influences in aspects of competing organic and inorganic substance concentrations, affinity to metal ions and the like exist in the biological adsorption process. In addition, due to the specificity of heavy metal ions, although some biomaterials have very good adsorption capacity for specific heavy metal ions, the efficiency in treating other metal pollutants is very low, and a plurality of different metal ion pollutants cannot be removed simultaneously. The development of the cheap adsorbing material with broad-spectrum heavy metal treatment is of great significance to the treatment and resource utilization of wastewater.

Amyloid fibers (Amyloids) are an insoluble fibrous protein. Curli is a typical functional amyloid fiber, an important component of the complex extracellular matrix produced by many Enterobacteriaceae families, and is involved in bacterial surface adhesion, cell aggregation and biofilm formation, while receiving widespread attention for its powerful extracellular self-assembly capacity. Whether a biomembrane material can be constructed based on the amyloid fiber Curli and applied to the adsorption of metal pollution is not reported in related researches. There is no relevant research report at present.

Disclosure of Invention

The present invention is directed to solving at least some of the above problems or to providing at least one commercial alternative.

In a specific embodiment, the invention provides Shewanella that expresses functionalized amyloid fiber, which takes Shewanella MR-1 as a host, and the genome DNA of the Shewanella contains a gene segment csgA-LACQCL of a connecting peptide domain LACQCL at the C end of an amyloid CsgA sequence. The amino acid sequence of the gene fragment csgA-LACQCL is shown as SEQ ID No. 1.

In a specific embodiment, the present invention also provides a method for constructing shewanella expressing functionalized amyloid fibrils, comprising the steps of:

(1) translating the peptide domain LACQCL into a nucleotide sequence, connecting a flexible sequence GSGGSG with the C end of a subunit csgA gene of amyloid fiber curli of escherichia coli, and finally constructing a gene fragment csgA-LACQCL for expressing functionalized amyloid fiber curli;

(2) connecting the gene fragment csgA-LACQCL in the step (1) with an expression vector pBBR-ParcA through double enzyme digestion to construct a recombinant plasmid pBBR-ParcA-csgA-LACQCL;

(3) and (3) transforming the recombinant plasmid pBBR-ParcA-csgA-LACQCL constructed in the step (2) into a host escherichia coli WM3064, and transferring the recombinant plasmid into Shewanella in a combined manner to form the recombinant Shewanella.

The amino acid sequence of the gene fragment csgA-LACQCL in the step (1) is shown as SEQ ID No. 1.

Preferably, the invention provides a nucleotide sequence for coding the gene fragment csgA-LACQCL, which is shown as SEQ ID No. 2.

In the step (1), the gene segment csgA-LACQCL is a gene segment csgA-LACQCL which is designed and amplified by using an escherichia coli BL21(DE3) genome as a template, an upstream primer for amplifying the gene segment is shown as SEQ ID No.3, and a downstream primer sequence is shown as SEQ ID No.4 and 5.

The invention provides a heavy metal ion biological adsorption membrane, which comprises the constructed Shewanella expressing functionalized amyloid fiber and a certain amount of activated carbon.

The invention provides a preparation method of the heavy metal ion biological adsorption film, which comprises the following steps:

(1) inoculating recombinant Shewanella expressing functionalized amyloid fibers into a YESCA culture medium, culturing for a period of time, and collecting bacterial liquid;

(2) and (2) adding activated carbon into the bacterial liquid obtained in the step (1) for soaking, and performing suction filtration by using a microporous filter membrane to obtain the recombinant Shewanella adsorption membrane of the functionalized amyloid fiber curli.

The inoculation rate in the step (1) is 1 percent; the microporous filter membrane in the step (2) is a water-based filter membrane, the diameter of the microporous filter membrane is 40-60 mm, and the pore diameter of the microporous filter membrane is 0.45 mm.

The proportion relation of the bacterial liquid and the activated carbon in the step (2) is that 700-800 mg of the activated carbon is added into every 1L of the bacterial liquid; the particle size of the activated carbon is 10-20 mu M; the soaking time is 10-12 h.

In a specific embodiment, the invention also provides application of the shewanella expressing the functionalized amyloid fiber in the field of heavy metal ion adsorption. The application is to adsorb heavy metal ions in water environment. Especially for Cd in water environment²⁺、Pb²⁺、Hg²⁺Filtered adsorption of the plasma.

The invention has the beneficial effects that:

the invention takes functionalized curli as a strategy, realizes the molecular programming of a bacterial extracellular matrix material by adding a peptide structural domain LACQCL on the main protein component of an escherichia coli biological membrane, namely amyloid csgA, wherein the selection of the peptide structural domain can efficiently adsorb Cd²⁺、Pb²⁺、Hg²⁺、Ag⁺、Au³⁺And various metal ions, and has the characteristics of certain metal tolerance and adsorption capacity; in the invention, the dissimilatory metal reducing bacterium Shewanella MR-1 is adopted as a host of the functionalized curli, and the Shewanella MR-1 is based on rapid propagation and better quantitative production. The csgA fusion protein is successfully secreted and self-assembled outside cells into a functionalized amyloid nanofiber network, thereby realizing the function of the peptide domain. The recombinant Shewanella and the activated carbon are subjected to suction filtration to form a heavy metal ion adsorption biological membrane, which has strong tolerance and adsorption effect on various heavy metal ions; verified by the embodiment, for Cd²⁺、Pb²⁺、Hg²⁺The heavy metal ions have better adsorption rate, and the average adsorption rate is more than 95%; the method still has excellent metal ion removal rate after repeated adsorption for many times, overcomes the defects of long synthesis time, specific adsorption, high cost and the like of the traditional process, and has good commercial application value in the aspect of metal ion adsorption treatment in water environment.

Drawings

FIG. 1 is a schematic diagram of the construction of recombinant Shewanella;

FIG. 2 is a graph comparing the binding of Shewanella wildlife, Shewanella recombinans with Congo red at different incubation times;

FIG. 3 is an SEM photograph of the recombinant Shewanella adsorbent membrane prepared in example 3.

Detailed Description

The invention discloses Shewanella for expressing functionalized amyloid fiber and a construction method and application thereof, and a person skilled in the art can realize the Shewanella by properly improving process parameters by referring to the content. It is expressly intended that all such similar substitutes and modifications which would be obvious to one skilled in the art are deemed to be included in the invention. The experimental procedures, in which specific conditions are not specified in the examples below, are generally carried out according to conventional conditions or according to conditions recommended by the manufacturers. Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art. In addition, any methods and materials similar or equivalent to those described herein can be used in the methods of the present invention. The preferred embodiments and materials described herein are intended to be exemplary only.

Shewanella MR-1 was purchased from China center for culture Collection of microorganisms. The YESCA culture medium comprises the following components: 10g/L of casein hydrolysate, 1g/L of yeast powder and 15g/L of agar.

Example 1: synthesis of csgA-LACQCL gene and construction of recombinant Shewanella for expressing functional amyloid fiber curli (csgA-LACQCL)

According to the subunit csgA gene (GenBank: MH264502.1) of amyloid fiber curli of Escherichia coli (E.coli BL21(DE3)) (GenBank: AM946981.2) of NCBI database, additional peptide domain LACQCL is translated into a nucleotide sequence for codon optimization, and is connected with the C end of the csgA gene through a flexible sequence GSGGSG, and finally a gene segment csgA-CQLACL is constructed, wherein the amino acid sequence of the gene segment is shown as SEQ ID No.1, and the nucleotide sequence is shown as SEQ ID No. 2.

Utilizing Primer Premier 5.0 software to design a Primer pair for amplifying a csgA-LACQCL sequence, wherein the forward Primer sequence is shown as SEQ ID NO.3, namely: CGCCATATGAAACTTTTAAAAGTAGCAGCAAT, the reverse primer sequence is two segments, which are respectively shown in SEQ ID NO.4, namely: GTGGTGCGCCTGAGCTGTATGCACCTGAACCACCTGAACCGTACTGATGAGCGGTCGCG and SEQ ID NO.5, namely: CCGCTCGAGTTAACCTGAACCACCTGAACCGAATGGTGGCATTGGTGGTGCGCCTGAGCTG are provided.

PCR was carried out using the above primer set using the genome of Escherichia coli BL21(DE3) as a template, and PrimerStar HS DNA Polymerase (Takara) high fidelity enzyme was selected under conditions of pre-denaturation at 98 ℃ for 10 s; the amplification stage is carried out for 30 cycles at 98 ℃, 10s, 58.5 ℃, 5s, 72 ℃ and 50 s; extension 72 ℃ for 10 min. The resulting PCR product was purified to obtain a gene fragment csgA-LACQCL (sequence shown by SEQ ID NO. 1), the vector pBBR-ParcA (synthesized by the laboratory and sequence shown by SEQ ID NO. 6) and the gene fragment csgA-LACQCL were cleaved with KpnI and BamHI and purified, ligated with T4 DNA Ligase (Takara) Ligase to obtain a recombinant plasmid pBBR-ParcA-csgA-LACQCL (sequence shown by SEQ ID NO. 7), the recombinant plasmid pBBR-ParcA-csgA-LACQCL was introduced into E.coli 3064 (purchased from Invitrogen, Life technologies, USA) by chemical transformation, resistant colonies were collected and transferred to wild Shewanella MR-1 by conjugation and transfer to construct a recombinant Shewanella expressing the csgA-LACQCL gene. FIG. 1 is a schematic diagram of the construction of recombinant Shewanella.

Example 2: high-efficiency expression of functionalized amyloid fiber curli (csgA-LACQCL)

In this example, amyloid expression was identified by Congo Red (CR) staining, and the concentration of amyloid fibrils was determined by analyzing the amount of CR bound.

1 mL of Shewanella wild culture and the recombinant Shewanella culture obtained in example 1 were centrifuged (5000 rpm, 10 minutes) at different incubation times (12 h, 24h, 36h, 48 h), the centrifuged pellet was suspended with 0.025 mmol/L CR (dissolved in pH 7.4 phosphate buffer) at 30 ℃ for 10 minutes and then centrifuged (5000 rpm, 10 minutes), and the supernatants were collected and the amount of CR bound in the supernatants was measured, respectively. The absorbance of CR was measured by an ultraviolet-visible spectrophotometer at a wavelength of 490 nm. And calculating the CR binding capacity of the wild Shewanella and the recombinant Shewanella by taking the absorbance of 0.025 mmol/L CR at 490 nm as comparison.

FIG. 2 is a graph comparing the binding of Shewanella wildlife, Shewanella recombinans with Congo red at different incubation times. As can be seen from FIG. 2, the binding amount of congo red was not detected in Shewanella wildlife, while the prepared recombinant Shewanella showed good CR binding ability compared to Shewanella wildlife, indicating that amyloid fiber curli (csgA-LACQCL) was synthesized on the cell surface of the recombinant Shewanella. The CR binding capacity increased significantly with prolonged incubation time, with higher CR binding capacity observed at 48 hours.

Example 3: preparation of recombinant Shewanella adsorption membrane

In this example, a recombinant shewanella adsorption membrane of functionalized amyloid fiber curli (csgA-LACQCL) was prepared, and the adsorption membrane included recombinant shewanella and activated carbon. The preparation method comprises the following steps:

(1) the recombinant Shewanella prepared in example 1 was inoculated into YESCA medium at a ratio of 1%, and shake-cultured at 30 ℃ and 200rpm to OD₆₀₀=2；

(2) Adding 700-800 mg of activated carbon powder into 1L of bacterial liquid after culture, soaking for 10-12 h, and then performing suction filtration through a water system microporous filter membrane with the aperture of 0.45mm to obtain the recombinant Shewanella adsorption membrane for expressing the functionalized amyloid fiber curli (csgA-LACQCL).

FIG. 3 is an SEM image of the prepared recombinant Shewanella adsorbing membrane; in the figure, the right picture is a partial enlarged view, and as can be seen from fig. 3, the recombinant shewanella bacteria are uniformly distributed on the activated carbon adsorption film, and the assembly of amyloid fiber curli (csgA-LACQCL) on the surface of the activated carbon can be clearly seen through the partial enlarged view.

Example 4: adsorption of multiple heavy metal ions (Cd)²⁺、Pb²⁺、Hg²⁺) Test (2)

In this example, the adsorption performance of the recombinant Shewanella adsorption membrane of the functionalized amyloid fiber curli (csgA-LACQCL) prepared in example 3 on various heavy metal ions is verified.

Simulated water samples of cadmium chloride (10 mM, 500 mM), lead chloride (0.5mM, 300 mM) and mercury chloride (0.5mM, 300 mM) with different ion concentrations are respectively prepared by adopting a simulated water sample method. 50mL of prepared simulated water samples with different concentrations are taken, the recombinant Shewanella adsorption membranes of the functionalized amyloid fiber curli are prepared in example 3 and then vacuum filtration is carried out, the ion concentration in the filtrate is measured by adopting a spectrophotometry, and Table 1 is a heavy metal pollutant concentration comparison table before and after the adsorption membrane filtration.

TABLE 1 comparison table of heavy metal contaminant concentration before and after adsorption membrane filtration

Table 1 shows that the recombinant Shewanella adsorption membrane of functionalized amyloid fiber curli (csgA-LACQCL) prepared by the invention can adsorb Cd²⁺、Pb²⁺、Hg²⁺The ions have higher adsorption effect, and the average adsorption rate is more than 95%. The adsorption device can realize the rapid adsorption of various heavy metal ions, is suitable for the adsorption of toxic heavy metal ions in various sewage in the living industry, has good adsorption effect and simple preparation method, and has remarkable and stable technical effect.

Example 5: test of continuous 5-cycle filtration of mercury ions by the same adsorption membrane

In this example, the reusability of the recombinant Shewanella adsorbent membrane of functionalized amyloid fiber curli (csgA-LACQCL) prepared in example 3 was verified.

The recombinant Shewanella adsorbent membrane of the functionalized amyloid fiber curli (csgA-LACQCL) prepared in example 3 was continuously filtered for 5 times with 50ml of HgCl₂(300 mM), taking the filtrate after each filtration, and measuring the mercury ion concentration in the filtrate by adopting a spectrophotometry method to examine the reusability of the membrane, wherein the table 2 is a mercury ion concentration comparison table after 5 continuous cycles.

TABLE 2 Mercury ion concentration comparison table after 5 continuous cycles

As can be seen from Table 2, after continuously treating 0.25L of mercury ion wastewater with the concentration of 300mM for 5 cycles, the removal rate of the prepared adsorption membrane on mercury ions can still be maintained to 90%, the adsorption membrane has an excellent effect of repeatedly adsorbing heavy metal ions, and the filtration efficiency of the adsorption membrane can be up to more than 5 times.

The present invention is not limited to the above-described embodiments, and any obvious improvements, substitutions or modifications can be made by those skilled in the art without departing from the spirit of the present invention.

Sequence listing

<110> university of Jiangsu

<120> Shewanella expressing functionalized amyloid fiber and construction method and application thereof

<160>7

<170>SIPOSequenceListing 1.0

<210>1

<211>120

<212>PRT

<213> Artificial Sequence (Artificial Sequence)

<400>1

Tyr Gly Gly Gly Asn Ser Ala Leu Ala Leu Gln Thr Asp Ala Arg Asn

1 5 10 15

Ser Asp Leu Thr Ile Thr Gln His Gly Gly Gly Asn Gly Ala Asp Val

20 25 30

Gly Gln Gly Ser Asp Asp Ser Ser Ile Asp Leu Thr Gln Arg Gly Phe

35 40 45

Gly Asn Ser Ala Thr Leu Asp Gln Trp Asn Gly Lys Asn Ser Glu Met

50 55 60

Thr Val Lys Gln Phe Gly Gly Gly Asn Gly Ala Ala Val Asp Gln Thr

65 70 7580

Ala Ser Asn Ser Ser Val Asn Val Thr Gln Val Gly Phe Gly Asn Asn

85 90 95

Ala Thr Ala His Gln Tyr Gly Ser Gly Gly Ser Gly Leu Ala Cys Gln

100 105 110

Cys Leu Gly Ser Gly Gly Ser Gly

115 120

<210>2

<211>504

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>2

aaacttttaa aagtagcagc aattgcagca atcgtattct ccggtagcgc tctggcaggt 60

gttgttcctc agtacggcgg cggcggtaac cacggtggtg gcggtaataa tagcggccca 120

aattctgagc tgaacattta ccagtacggt ggcggtaact ctgcacttgc tctgcaaact 180

gatgcccgta actctgactt gactattacc cagcatggcg gcggtaatgg tgcagatgtt 240

ggtcagggct cagatgacag ctcaatcgat ctgacccaac gtggcttcgg taacagcgct 300

actcttgatc agtggaacgg caaaaattct gaaatgacgg ttaaacagtt cggtggtggc 360

aacggtgctg cagttgacca gactgcatct aactcctccg tcaacgtgac tcaggttggc 420

tttggtaaca acgcgaccgc tcatcagtac ggttcaggtg gttcaggtct ggcgtgccag 480

tgcctgggtt caggtggttc aggt 504

<210>3

<211>32

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>3

cgccatatga aacttttaaa agtagcagca at 32

<210>4

<211>59

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>4

gtggtgcgcc tgagctgtat gcacctgaac cacctgaacc gtactgatga gcggtcgcg 59

<210>5

<211>61

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>5

ccgctcgagt taacctgaac cacctgaacc gaatggtggc attggtggtg cgcctgagct 60

g 61

<210>6

<211>4895

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>6

accttcggga gcgcctgaag cccgttctgg acgccctggg gccgttgaat cgggatatgc 60

aggccaaggc cgccgcgatc atcaaggccg tgggcgaaaa gctgctgacg gaacagcggg 120

aagtccagcg ccagaaacag gcccagcgcc agcaggaacg cgggcgcgca catttccccg 180

aaaagtgcca cctggcggcg ttgtgacaat ttaccgaaca actccgcggc cgggaagccg 240

atctcggctt gaacgaattg ttaggtggcg gtacttgggt cgatatcaaa gtgcatcact 300

tcttcccgta tgcccaactt tgtatagaga gccactgcgg gatcgtcacc gtaatctgct 360

tgcacgtaga tcacataagc accaagcgcg ttggcctcat gcttgaggag attgatgagc 420

gcggtggcaa tgccctgcct ccggtgctcg ccggagactg cgagatcata gatatagatc 480

tcactacgcg gctgctcaaa cctgggcaga acgtaagccg cgagagcgcc aacaaccgct 540

tcttggtcga aggcagcaag cgcgatgaat gtcttactac ggagcaagtt cccgaggtaa 600

tcggagtccg gctgatgttg ggagtaggtg gctacgtctc cgaactcacg accgaaaaga 660

tcaagagcag cccgcatgga tttgacttgg tcagggccga gcctacatgt gcgaatgatg 720

cccatacttg agccacctaa ctttgtttta gggcgactgc cctgctgcgt aacatcgttg 780

ctgctgcgta acatcgttgc tgctccataa catcaaacat cgacccacgg cgtaacgcgc 840

ttgctgcttg gatgcccgag gcatagactg tacaaaaaaa cagtcataac aagccatgaa 900

aaccgccact gcgccgttac caccgctgcg ttcggtcaag gttctggacc agttgcgtga 960

gcgcatacgc tacttgcatt acagtttacg aaccgaacag gcttatgtca actgggttcg 1020

tgccttcatc cgtttccacg gtgtgcgtcc atgggcgtga actcgctcac aagaattaga 1080

aatacattag ttatactaat caatgactaa agtaaatatc atggtaaatt aacgcctaat 1140

ccagaaattt gttaacattt catttgttaa caaatgccta aaacgagtac aatgtcgtca 1200

ttggccagtt aagcagataa cattaagttt gcttaatctt gacaagggtt tgttagattc 1260

ctctgcgaaa tcaccttatg ctggccggac atcttttaaa atgtgttcta catttgattt 1320

atcatttaaa cattttaaaa aaaacaatag ttaaggaact attcttaact attgcttatc 1380

gaagttgata ctggttacgt tttatcgtat tacactttaa acgttcactt atatacatcc 1440

tgacgtgtag ccgtaaagat cttccctttg aagcacagag cagtgagtgg aagtatcaac 1500

aatttatgaa tataagaatc cgatgtaagt gattcttatg gttagaatat tggttaaaat 1560

ttaggtactt aaaggtaccg ggccccccct cgaggtcgac ggtatcgata agcttgatat 1620

cgaattcctg cagcccgggg gatccactag ttctagagcg gccgccaccg cggtggagct 1680

ccaattcgcc ctatagtgag tcgtattacg cgcgctcact ggccgtcgtt ttacaacgtc 1740

gtgactggga aaaccctggc gttacccaac ttaatcgcct tgcagcacat ccccctttcg 1800

ccagctggcg taatagcgaa gaggcccgca ccgatcgccc ttcccaacag ttgcgcagcc 1860

tgaatggcga atggaaattg taagcgttaa tattttgtta aaattcgcgt taaatttttg 1920

ttaaatcagc tcatttttta accaataggc cgactgcgat gagtggcagg gcggggcgta 1980

atttttttaa ggcagttatt ggtgccctta aacgcctggt gctacgcctg aataagtgat 2040

aataagcgga tgaatggcag aaattcgaaa gcaaattcga cccggtcgtc ggttcagggc 2100

agggtcgtta aatagccgct tatgtctatt gctggtttac cggtttattg actaccggaa 2160

gcagtgtgac cgtgtgcttc tcaaatgcct gaggccagtt tgctcaggct ctccccgtgg 2220

aggtaataat tgacgatatg atcatttatt ctgcctccca gagcctgata aaaacggtga 2280

atccgttagc gaggtgccgc cggcttccat tcaggtcgag gtggcccggc tccatgcacc2340

gcgacgcaac gcggggaggc agacaaggta tagggcggcg aggcggctac agccgatagt 2400

ctggaacagc gcacttacgg gttgctgcgc aacccaagtg ctaccggcgc ggcagcgtga 2460

cccgtgtcgg cggctccaac ggctcgccat cgtccagaaa acacggctca tcgggcatcg 2520

gcaggcgctg ctgcccgcgc cgttcccatt cctccgtttc ggtcaaggct ggcaggtctg 2580

gttccatgcc cggaatgccg ggctggctgg gcggctcctc gccggggccg gtcggtagtt 2640

gctgctcgcc cggatacagg gtcgggatgc ggcgcaggtc gccatgcccc aacagcgatt 2700

cgtcctggtc gtcgtgatca accaccacgg cggcactgaa caccgacagg cgcaactggt 2760

cgcggggctg gccccacgcc acgcggtcat tgaccacgta ggccgacacg gtgccggggc 2820

cgttgagctt cacgacggag atccagcgct cggccaccaa gtccttgact gcgtattgga 2880

ccgtccgcaa agaacgtccg atgagcttgg aaagtgtctt ctggctgacc accacggcgt 2940

tctggtggcc catctgcgcc acgaggtgat gcagcagcat tgccgccgtg ggtttcctcg 3000

caataagccc ggcccacgcc tcatgcgctt tgcgttccgt ttgcacccag tgaccgggct 3060

tgttcttggc ttgaatgccg atttctctgg actgcgtggc catgcttatc tccatgcggt 3120

agggtgccgc acggttgcgg caccatgcgc aatcagctgc aacttttcgg cagcgcgaca 3180

acaattatgc gttgcgtaaa agtggcagtc aattacagat tttctttaac ctacgcaatg 3240

agctattgcg gggggtgccg caatgagctg ttgcgtaccc ccctttttta agttgttgat 3300

ttttaagtct ttcgcatttc gccctatatc tagttctttg gtgcccaaag aagggcaccc 3360

ctgcggggtt cccccacgcc ttcggcgcgg ctccccctcc ggcaaaaagt ggcccctccg 3420

gggcttgttg atcgactgcg cggccttcgg ccttgcccaa ggtggcgctg cccccttgga 3480

acccccgcac tcgccgccgt gaggctcggg gggcaggcgg gcgggcttcg ccttcgactg 3540

cccccactcg cataggcttg ggtcgttcca ggcgcgtcaa ggccaagccg ctgcgcggtc 3600

gctgcgcgag ccttgacccg ccttccactt ggtgtccaac cggcaagcga agcgcgcagg 3660

ccgcaggccg gaggcttttc cccagagaaa attaaaaaaa ttgatggggc aaggccgcag 3720

gccgcgcagt tggagccggt gggtatgtgg tcgaaggctg ggtagccggt gggcaatccc 3780

tgtggtcaag ctcgtgggca ggcgcagcct gtccatcagc ttgtccagca gggttgtcca 3840

cgggccgagc gaagcgagcc agccggtggc cgctcgcggc catcgtccac atatccacgg 3900

gctggcaagg gagcgcagcg accgcgcagg gcgaagcccg gagagcaagc ccgtagggcg 3960

ccgcagccgc cgtaggcggt cacgactttg cgaagcaaag tctagtgagt atactcaagc 4020

attgagtggc ccgccggagg caccgccttg cgctgccccc gtcgagccgg ttggacacca 4080

aaagggaggg gcaggcatgg cggcatacgc gatcatgcga tgcaagaagc tggcgaaaat 4140

gggcaacgtg gcggccagtc tcaagcacgc ctaccgcgag cgcgagacgc ccaacgctga 4200

cgccagcagg acgccagaga acgagcactg ggcggccagc agcaccgatg aagcgatggg 4260

ccgactgcgc gagttgctgc cagagaagcg gcgcaaggac gctgtgttgg cggtcgagta 4320

cgtcatgacg gccagcccgg aatggtggaa gtcggccagc caagaacagc aggcggcgtt 4380

cttcgagaag gcgcacaagt ggctggcgga caagtacggg gcggatcgca tcgtgacggc 4440

cagcatccac cgtgacgaaa ccagcccgca catgaccgcg ttcgtggtgc cgctgacgca 4500

ggacggcagg ctgtcggcca aggagttcat cggcaacaaa gcgcagatga cccgcgacca 4560

gaccacgttt gcggccgctg tggccgatct agggctgcaa cggggcatcg agggcagcaa 4620

ggcacgtcac acgcgcattc aggcgttcta cgaggccctg gagcggccac cagtgggcca 4680

cgtcaccatc agcccgcaag cggtcgagcc acgcgcctat gcaccgcagg gattggccga 4740

aaagctggga atctcaaagc gcgttgagac gccggaagcc gtggccgacc ggctgacaaa 4800

agcggttcgg caggggtatg agcctgccct acaggccgcc gcaggagcgc gtgagatgcg 4860

caagaaggcc gatcaagccc aagagacggc ccgag 4895

<210>7

<211>5345

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>7

accttcggga gcgcctgaag cccgttctgg acgccctggg gccgttgaat cgggatatgc 60

aggccaaggc cgccgcgatc atcaaggccg tgggcgaaaa gctgctgacg gaacagcggg 120

aagtccagcg ccagaaacag gcccagcgcc agcaggaacg cgggcgcgca catttccccg 180

aaaagtgcca cctggcggcg ttgtgacaat ttaccgaaca actccgcggc cgggaagccg 240

atctcggctt gaacgaattg ttaggtggcg gtacttgggt cgatatcaaa gtgcatcact 300

tcttcccgta tgcccaactt tgtatagaga gccactgcgg gatcgtcacc gtaatctgct 360

tgcacgtaga tcacataagc accaagcgcg ttggcctcat gcttgaggag attgatgagc 420

gcggtggcaa tgccctgcct ccggtgctcg ccggagactg cgagatcata gatatagatc 480

tcactacgcg gctgctcaaa cctgggcaga acgtaagccg cgagagcgcc aacaaccgct 540

tcttggtcga aggcagcaag cgcgatgaat gtcttactac ggagcaagtt cccgaggtaa 600

tcggagtccg gctgatgttg ggagtaggtg gctacgtctc cgaactcacg accgaaaaga 660

tcaagagcag cccgcatgga tttgacttgg tcagggccga gcctacatgt gcgaatgatg 720

cccatacttg agccacctaa ctttgtttta gggcgactgc cctgctgcgt aacatcgttg 780

ctgctgcgta acatcgttgc tgctccataa catcaaacat cgacccacgg cgtaacgcgc 840

ttgctgcttg gatgcccgag gcatagactg tacaaaaaaa cagtcataac aagccatgaa 900

aaccgccact gcgccgttac caccgctgcg ttcggtcaag gttctggacc agttgcgtga 960

gcgcatacgc tacttgcatt acagtttacg aaccgaacag gcttatgtca actgggttcg 1020

tgccttcatc cgtttccacg gtgtgcgtcc atgggcgtga actcgctcac aagaattaga 1080

aatacattag ttatactaat caatgactaa agtaaatatc atggtaaatt aacgcctaat 1140

ccagaaattt gttaacattt catttgttaa caaatgccta aaacgagtac aatgtcgtca 1200

ttggccagtt aagcagataa cattaagttt gcttaatctt gacaagggtt tgttagattc 1260

ctctgcgaaa tcaccttatg ctggccggac atcttttaaa atgtgttcta catttgattt 1320

atcatttaaa cattttaaaa aaaacaatag ttaaggaact attcttaact attgcttatc 1380

gaagttgata ctggttacgt tttatcgtat tacactttaa acgttcactt atatacatcc 1440

tgacgtgtag ccgtaaagat cttccctttg aagcacagag cagtgagtgg aagtatcaac 1500

aatttatgaa tataagaatc cgatgtaagt gattcttatg gttagaatat tggttaaaat 1560

ttaggtactt aaaggtacca tgaaactttt aaaagtagca gcaattgcag caatcgtatt 1620

ctccggtagc gctctggcag gtgttgttcc tcagtacggc ggcggcggta accacggtgg 1680

tggcggtaat aatagcggcc caaattctga gctgaacatt taccagtacg gtggcggtaa 1740

ctctgcactt gctctgcaaa ctgatgcccg taactctgac ttgactatta cccagcatgg 1800

cggcggtaat ggtgcagatg ttggtcaggg ctcagatgac agctcaatcg atctgaccca 1860

acgtggcttc ggtaacagcg ctactcttga tcagtggaac ggcaaaaatt ctgaaatgac 1920

ggttaaacag ttcggtggtg gcaacggtgc tgcagttgac cagactgcat ctaactcctc 1980

cgtcaacgtg actcaggttg gctttggtaa caacgcgacc gctcatcagt acggttcagg 2040

tggttcaggt ctggcgtgcc agtgcctggg tagtggtggt tcaggttaag gatccactag 2100

ttctagagcg gccgccaccg cggtggagct ccaattcgcc ctatagtgag tcgtattacg 2160

cgcgctcact ggccgtcgtt ttacaacgtc gtgactggga aaaccctggc gttacccaac 2220

ttaatcgcct tgcagcacat ccccctttcg ccagctggcg taatagcgaa gaggcccgca 2280

ccgatcgccc ttcccaacag ttgcgcagcc tgaatggcga atggaaattg taagcgttaa 2340

tattttgtta aaattcgcgt taaatttttg ttaaatcagc tcatttttta accaataggc 2400

cgactgcgat gagtggcagg gcggggcgta atttttttaa ggcagttatt ggtgccctta 2460

aacgcctggt gctacgcctg aataagtgat aataagcgga tgaatggcag aaattcgaaa 2520

gcaaattcga cccggtcgtc ggttcagggc agggtcgtta aatagccgct tatgtctatt 2580

gctggtttac cggtttattg actaccggaa gcagtgtgac cgtgtgcttc tcaaatgcct 2640

gaggccagtt tgctcaggct ctccccgtgg aggtaataat tgacgatatg atcatttatt 2700

ctgcctccca gagcctgata aaaacggtga atccgttagc gaggtgccgc cggcttccat 2760

tcaggtcgag gtggcccggc tccatgcacc gcgacgcaac gcggggaggc agacaaggta 2820

tagggcggcg aggcggctac agccgatagt ctggaacagc gcacttacgg gttgctgcgc 2880

aacccaagtg ctaccggcgc ggcagcgtga cccgtgtcgg cggctccaac ggctcgccat 2940

cgtccagaaa acacggctca tcgggcatcg gcaggcgctg ctgcccgcgc cgttcccatt 3000

cctccgtttc ggtcaaggct ggcaggtctg gttccatgcc cggaatgccg ggctggctgg 3060

gcggctcctc gccggggccg gtcggtagtt gctgctcgcc cggatacagg gtcgggatgc 3120

ggcgcaggtc gccatgcccc aacagcgatt cgtcctggtc gtcgtgatca accaccacgg 3180

cggcactgaa caccgacagg cgcaactggt cgcggggctg gccccacgcc acgcggtcat 3240

tgaccacgta ggccgacacg gtgccggggc cgttgagctt cacgacggag atccagcgct 3300

cggccaccaa gtccttgact gcgtattgga ccgtccgcaa agaacgtccg atgagcttgg 3360

aaagtgtctt ctggctgacc accacggcgt tctggtggcc catctgcgcc acgaggtgat 3420

gcagcagcat tgccgccgtg ggtttcctcg caataagccc ggcccacgcc tcatgcgctt 3480

tgcgttccgt ttgcacccag tgaccgggct tgttcttggc ttgaatgccg atttctctgg 3540

actgcgtggc catgcttatc tccatgcggt agggtgccgc acggttgcgg caccatgcgc 3600

aatcagctgc aacttttcgg cagcgcgaca acaattatgc gttgcgtaaa agtggcagtc 3660

aattacagat tttctttaac ctacgcaatg agctattgcg gggggtgccg caatgagctg 3720

ttgcgtaccc ccctttttta agttgttgat ttttaagtct ttcgcatttc gccctatatc 3780

tagttctttg gtgcccaaag aagggcaccc ctgcggggtt cccccacgcc ttcggcgcgg 3840

ctccccctcc ggcaaaaagt ggcccctccg gggcttgttg atcgactgcg cggccttcgg 3900

ccttgcccaa ggtggcgctg cccccttgga acccccgcac tcgccgccgt gaggctcggg 3960

gggcaggcgg gcgggcttcg ccttcgactg cccccactcg cataggcttg ggtcgttcca 4020

ggcgcgtcaa ggccaagccg ctgcgcggtc gctgcgcgag ccttgacccg ccttccactt 4080

ggtgtccaac cggcaagcga agcgcgcagg ccgcaggccg gaggcttttc cccagagaaa 4140

attaaaaaaa ttgatggggc aaggccgcag gccgcgcagt tggagccggt gggtatgtgg 4200

tcgaaggctg ggtagccggt gggcaatccc tgtggtcaag ctcgtgggca ggcgcagcct 4260

gtccatcagc ttgtccagca gggttgtcca cgggccgagc gaagcgagcc agccggtggc 4320

cgctcgcggc catcgtccac atatccacgg gctggcaagg gagcgcagcg accgcgcagg 4380

gcgaagcccg gagagcaagc ccgtagggcg ccgcagccgc cgtaggcggt cacgactttg 4440

cgaagcaaag tctagtgagt atactcaagc attgagtggc ccgccggagg caccgccttg 4500

cgctgccccc gtcgagccgg ttggacacca aaagggaggg gcaggcatgg cggcatacgc 4560

gatcatgcga tgcaagaagc tggcgaaaat gggcaacgtg gcggccagtc tcaagcacgc 4620

ctaccgcgag cgcgagacgc ccaacgctga cgccagcaggacgccagaga acgagcactg 4680

ggcggccagc agcaccgatg aagcgatggg ccgactgcgc gagttgctgc cagagaagcg 4740

gcgcaaggac gctgtgttgg cggtcgagta cgtcatgacg gccagcccgg aatggtggaa 4800

gtcggccagc caagaacagc aggcggcgtt cttcgagaag gcgcacaagt ggctggcgga 4860

caagtacggg gcggatcgca tcgtgacggc cagcatccac cgtgacgaaa ccagcccgca 4920

catgaccgcg ttcgtggtgc cgctgacgca ggacggcagg ctgtcggcca aggagttcat 4980

cggcaacaaa gcgcagatga cccgcgacca gaccacgttt gcggccgctg tggccgatct 5040

agggctgcaa cggggcatcg agggcagcaa ggcacgtcac acgcgcattc aggcgttcta 5100

cgaggccctg gagcggccac cagtgggcca cgtcaccatc agcccgcaag cggtcgagcc 5160

acgcgcctat gcaccgcagg gattggccga aaagctggga atctcaaagc gcgttgagac 5220

gccggaagcc gtggccgacc ggctgacaaa agcggttcgg caggggtatg agcctgccct 5280

acaggccgcc gcaggagcgc gtgagatgcg caagaaggcc gatcaagccc aagagacggc 5340

ccgag 5345

Claims

1. Shewanella for expressing functionalized amyloid fiber is characterized in that Shewanella MR-1 is taken as a host, and the genome DNA of the Shewanella comprises a gene segment csgA-LACQCL of a connecting peptide domain LACQCL at the C end of an amyloid CsgA sequence; the amino acid sequence of the gene fragment csgA-LACQCL is shown in SEQ ID NO. 1.

2. A method for constructing Shewanella that expresses functionalized amyloid fibrils, comprising the steps of:

3. The method according to claim 2, wherein the amino acid sequence of the gene fragment csgA-LACQCL in step (1) is shown in SEQ ID No. 1.

4. The method of claim 3, wherein the nucleotide sequence encoding the csgA-LACQCL of step (1) is shown in SEQ ID NO. 2.

5. The preparation method of claim 2, wherein the gene fragment csgA-LACQCL in step (1) is obtained by using an Escherichia coli genome as a template and designing a primer for PCR amplification, wherein an upstream primer for amplifying the gene fragment is shown as SEQ ID No.3, and a downstream primer sequence is shown as SEQ ID No. 4-5.

6. A heavy metal ion bio-adsorption membrane comprising Shewanella expressing functionalized amyloid fiber constructed according to claim 1 and an amount of activated carbon.

7. The preparation method of the heavy metal ion biological adsorption film is characterized by comprising the following steps:

(1) inoculating Shewanella expressing functionalized amyloid fiber into YESCA culture medium, performing shake culture at 30 ℃ and 200rpm until OD600=2, and collecting bacterial liquid;

(2) and (3) adding activated carbon into the bacterial liquid obtained in the step (1) for soaking, and performing suction filtration by using a microporous filter membrane to obtain the heavy metal ion biological adsorption membrane.

8. The method for preparing the heavy metal ion biological adsorption film according to claim 7, wherein the inoculation rate in the step (1) is 1%; the microporous filter membrane in the step (2) is a water-based filter membrane, the diameter of the microporous filter membrane is 40-60 mm, and the pore diameter of the microporous filter membrane is 0.45 mm.

9. The method for preparing a heavy metal ion bio-adsorption membrane according to claim 7, wherein the particle size of the activated carbon in the step (2) is 10 to 20 μ M, and the ratio of the bacterial liquid to the activated carbon is such that 700 to 800mg of the activated carbon is added to 1L of the bacterial liquid.

10. The use of shewanella expressing functionalized amyloid fibrils according to claim 1 in the field of heavy metal ion adsorption in an aqueous environment.