CN111647646B

CN111647646B - CRISPR nucleic acid detection method with anti-pollution capacity

Info

Publication number: CN111647646B
Application number: CN201910159518.2A
Authority: CN
Inventors: 吴坚; 钱程
Original assignee: Zhejiang University ZJU
Current assignee: Zhejiang University ZJU
Priority date: 2019-03-04
Filing date: 2019-03-04
Publication date: 2022-01-11
Anticipated expiration: 2039-03-04
Also published as: CN111647646A

Abstract

The invention provides a CRISPR nucleic acid detection method with anti-pollution capacity, which is characterized in that a PAM site consisting of UUN (N is any base) base clusters is specifically identified by using a Cas protein, and then a DNA double strand containing uracil (U base) is detected. The technical scheme of the invention can carry out detection safely, quickly, simply, efficiently and in an anti-pollution manner with low cost, and thoroughly avoid the problem of aerosol pollution in the detection process.

Description

CRISPR nucleic acid detection method with anti-pollution capacity

Technical Field

The invention belongs to the field of nucleic acid detection, and particularly relates to a method for specifically detecting target nucleic acid by using a CRISPR (clustered regularly interspaced short palindromic repeats) technology and preventing pollution of nucleic acid aerosol.

Background

In the field of nucleic acid detection, in order to improve sensitivity and accuracy, a large amount of target nucleic acid fragments to be detected often need to be amplified for subsequent experimental analysis. At present, the mature nucleic acid amplification method mainly uses Polymerase Chain Reaction (PCR) technology. The PCR technology is used as a gold standard for nucleic acid detection, and has been widely applied to a plurality of fields such as medical diagnosis, quality detection of agricultural products, food safety inspection and the like. The traditional PCR amplification technology is a repeated reaction established at three reaction temperatures and a certain number of cycles. In general, each cycle of PCR amplification requires three different reaction temperatures and corresponding suitable times. The three reaction temperatures correspond to the three stages of PCR reaction, namely, denaturation (95 ℃), annealing (55-65 ℃) and elongation (72 ℃). Currently, detection of nucleic acid amplification by PCR takes a relatively long time, usually 2 hours or more, due to the restriction of some factors. In addition, due to the specificity of the template and the different properties of the amplifying enzyme, the duration of the three phases can also be selectively adjusted, and pre-denaturation and extension phases can be added at the beginning and end of the reaction. For PCR, it is most critical to meet the temperature requirement of each stage, so it requires a very precise thermal cycling device for temperature control, and it also requires a rapid temperature increase and decrease function to reduce the overall reaction time. In this regard, the application of PCR technology in the field of rapid field detection is very limited due to the limitations of instruments and reaction time.

In order to overcome the limitations of PCR technology, isothermal amplification techniques have been developed in recent years. The most important characteristic of the isothermal amplification technology is that the reaction can be carried out at a constant and relatively low temperature, which greatly eliminates the requirement of the PCR technology on a temperature control instrument. Isothermal amplification technologies such as loop-mediated isothermal amplification (LAMP) and recombinase amplification (RPA) can amplify a large number of target nucleic acid fragments in a relatively short time (usually about 30 minutes), save the time from instrument to instrument, and have a very promising application prospect in rapid field detection.

In addition, the most traditional and classical method for detecting nucleic acid amplification products is based on gel electrophoresis, which has many disadvantages although its reliability is high. The chemicals used in gel electrophoresis have large toxicity and are easy to cause large harm to human bodies. The most important point is that the gel electrophoresis needs to be carried out to open the cover and sample the amplification reaction liquid, because the amplification reaction in the prior art can lead the amplicons to be accumulated in a reaction tube in a large amount, once the cover is opened, a large amount of amplicons can overflow the reaction tube and are dispersed in the air to form aerosol pollution, and the nucleic acid is very stable and not easy to degrade under the indoor normal environment, which can cause interference to the detection result in a long period of time. In the field of nucleic acid detection, aerosol contamination is to be avoided as much as possible. At present, besides gel electrophoresis, a detection method of real-time fluorescence is frequently used, and generally, a DNA double-stranded fluorescent intercalator such as SYTO 9, SYBR Green I, Eva Green and the like is utilized, and a real-time fluorescence PCR instrument is utilized to record the magnitude of a fluorescence value in the whole reaction process so as to indirectly characterize the nucleic acid amplification condition. In order to improve the specificity of detection, some molecular probes, such as hydrolysis probe (Taqman probe), hybridization probe (molecular beacon), and composite probe, have been developed. The nucleic acid amplification kit and the template are subjected to complementary pairing by utilizing the base complementary pairing principle in the nucleic acid amplification process, so that the specific real-time detection of the nucleic acid amplification is realized. However, these detection methods using probes generally require a complicated real-time fluorescence PCR instrument to read data, and thus are expensive, time-consuming, and incapable of being developed on site, and thus have limited popularization.

In recent years, gene editing methods based on the CRISPR system have been gradually developed. Most of the current research on this method is mainly to use its targeted cleavage function for site-directed base editing. Recently, with the development of type V enzyme, researchers have begun to apply this system to nucleic acid detection. The main principle is that type V enzyme can specifically recognize target DNA under the assistance of guide RNA in the system, and simultaneously, can activate the gene editing function of the type V enzyme in the process of recognizing the target object, and can cut any single-stranded DNA in the system. The existing method for detecting nucleic acid by using a CRISPR system generally needs complex and large-scale instruments for fluorescence reading and result judgment, and has certain requirements on experimental environment and operation. In addition, Cas12a protein edited by DNA in CRISPR system needs to specifically recognize TTTN (N is arbitrary base) sequence in target fragment for work, which requires selection of amplification target. Although the detection process of nucleic acid amplification can be improved to some extent by using CRISPR technology, there is still much room for improvement due to its requirement for target fragments and the still unavoidable contamination by aerosols.

Disclosure of Invention

The invention aims to provide a CRISPR nucleic acid detection method with pollution prevention capability. Therefore, the invention adopts the following technical scheme:

a CRISPR nucleic acid detection method with anti-pollution capacity is characterized in that: specifically recognizing a PAM site consisting of a UUN (N is any base) base cluster by using a Cas protein, and further detecting a DNA double strand containing uracil (U base).

The invention relates to a CRISPR nucleic acid detection method with anti-pollution capacity, in particular to an anti-pollution nucleic acid amplification system and a CRISPR detection system containing UDG enzyme; digesting residual pollution amplicon possibly existing in a reaction environment by using an anti-pollution system containing UDG enzyme, then carrying out nucleic acid amplification reaction, and then detecting by using a CRISPR system.

The detection object provided by the invention can be the diagnosis of target nucleic acids such as animal and plant viruses, pathogenic bacteria, gene mutation and the like.

In a nucleic acid amplification system, the dUTP component is used for replacing the traditional dTTP component as a raw material for nucleic acid amplification, so that T bases do not exist in continuously accumulated amplicon products any longer, and U bases are used for replacing the dUTP component; and UDG enzyme is added into a nucleic acid amplification system, and the amplicons containing U basic groups can be digested by the UDG enzyme (purchased from New England Biolabs inc., product number M0372), so that the amplicons are prevented from being reproduced into aerosol pollution, and false positive interference on the subsequent detection is avoided. Then, because the temperature of the subsequent PCR reaction reaches 98 ℃, and the UDG enzyme can be inactivated at 50 ℃, the subsequent amplification reaction is not influenced.

In nucleic acid amplification systems, the dUTP-containing components are selected from the group consisting of dATP, dGTP, dCTP, and dUTP. The concentration of the dUTP-containing component in the nucleic acid amplification system is 0.1-20 mM.

In the nucleic acid amplification system, the dUTP-containing component and the concentration thereof in the nucleic acid amplification system can be 0.1-20 mM dATP, 0.1-20 mM dGTP, 0.1-20 mM dCTP and 0.1-20 mM dUTP; preferably, the components and the concentration thereof in the nucleic acid amplification system can be 1-10 mM dATP, 1-10 mM dGTP, 1-10 mM dCTP and 1-10 mM dUTP; more preferably, the components and their concentration in the nucleic acid amplification system may be 2-5 mM dATP, 2-5 mM dGTP, 2-5 mM dCTP, 2-5 mM dUTP; more preferably, the components are provided at 2.5mM dATP, 2.5mM dGTP, 2.5mM dCTP, 2.5mM dUTP. And the concentrations of these four components are not required to be the same.

The UDG enzyme used for digesting the remaining contaminant amplicon in the present invention may be supplied at 0.0001U to 1U, preferably 0.0005U to 0.5U, more preferably 0.001U to 0.5U, and still more preferably 0.01U to 0.5U.

In the present invention, in the nucleic acid amplification system, dUTP component is used as a raw material for amplification instead of conventional dTTP component, so that thymine (T base) is no longer present in the amplicon sequence that is accumulated, but uracil (U base) is used instead. The amplicon containing the U basic group can be digested by UDG enzyme, and cannot influence the subsequent experiment to cause false positive interference and aerosol pollution after digestion. The nucleic acid amplification system can be a PCR amplification system or a nucleic acid isothermal amplification system, such as: and (4) LAMP reaction.

In a CRISPR detection system, the used Cas protein is found to be capable of recognizing a PAM structure with a TTTN (N is any base) sequence in a target double strand, but the inventor finds that after a T base is changed into a U base, the used Cas protein can still successfully perform specific recognition on a UUN base cluster changed by the TTTN, and a single-stranded probe is cut after a complex is formed with crRNA, and a fluorescence signal is released and can be directly observed by naked eyes or interpreted by an instrument. And the double strand containing the U base can be digested by UDG enzyme, so that pollution is prevented.

The Cas protein involved in the present invention is Cas12a or a Cas protein with a similar activity to the alternative single-stranded DNA cleavage of Cas12 a. Cas12a proteins include, but are not limited to, LBCas12a protein or the remaining Cas12a series of proteins.

The CRISPR detection system consists of crRNA, Cas protein, single-stranded fluorescent probe and corresponding buffer solution.

By adopting the technical scheme of the invention, the detection can be carried out safely, quickly, simply, efficiently and in an anti-pollution manner at low cost, and the problem of aerosol pollution is thoroughly avoided in the detection process.

Description of the drawings:

FIG. 1 is a graph showing the results of actual tests conducted in example 1 of the present invention. By means of a fluorescence reader, it is possible to detect very high fluorescence values in the positive sample (number 1 in the figure) and no fluorescence in the negative sample (number 2 in the figure). It can be shown that, after the TTTN sequence cluster in the target nucleic acid chain is replaced by the UUUN sequence, the CRISPR system can still work well, the Cas protein can still recognize the target nucleic acid chain, and after forming a complex with the crRNA, the cutting function of the single strand can be activated to cut the single-strand fluorescent probe. The fluorescent probe will release a fluorescent signal upon cleavage, which can be interpreted by a machine or detected directly by visual inspection. When the examination is carried out by visual observation, it can be seen from the curve No. 1 in FIG. 1 that the accumulated fluorescence value is high enough to be observed by visual observation in about 5 min.

FIG. 2 is a graph showing the amplification curve of the LAMP reaction in example 1. By means of a fluorescence reader, it is possible to detect very high fluorescence values in the positive samples (number 3 in the figure) and no fluorescence in the negative samples (number 4 in the figure). It can be shown that the LAMP reaction can still be well performed after dUTP is used for replacing dTTP, and the Ct value and the fluorescence accumulation are better.

FIG. 3 shows the verification of the melting curve of the amplification product of LAMP reaction in example 1. By means of a fluorescent reading device, it can be found that the positive sample (number 5 in the figure) has a distinct peak at the ideal temperature, which can indicate that the LAMP reaction still performs a very efficient specific amplification of the target fragment after dTTP is replaced by dUTP. Whereas the stealth sample (reference number 6 in the figure) was not observed with any characteristic peaks.

The specific implementation scheme is as follows:

in order to more clearly explain and illustrate the present invention, several specific example embodiments will be given below. The embodiments described hereinafter are some, but not all embodiments of the invention. Embodiments based on the present invention and other embodiments achieved by other workers in the field without inventive faculty are within the scope of the invention.

The invention develops a novel CRISPR working system through repeated research and experiments and deep understanding of a Cas protein cleavage system. The research or the embodiment based on the development system belongs to the protection scope of the invention.

In CRISPR systems, components generally included are Cas proteins (e.g., Cas12a protein, etc.), crrnas, fluorescent probes (probes), rnase inhibitors, and the like. The working concentration range of Cas protein is 0.2 μ Μ to 2.0 μ Μ; working concentrations of crRNA sequence (gRNA) were higher than Cas12a protease; the working concentration of the single-stranded DNA fluorescent probe is between 0.5 and 8.0. mu.M. The Cas protein may employ Cas12a protein or a Cas protein with similar bypass single-stranded DNA cleavage activity as Cas12a protein; the working concentration is the final concentration of each component in a system in which the CRISPR system and the nucleic acid amplification reaction solution containing the amplicon are mixed. In the case of uncapped detection, the volume of the nucleic acid amplicon can be regarded as the volume of the nucleic acid amplification reaction solution, and the volume of the nucleic acid amplification reaction solution and the volume of the CRISPR system should be between 1: 20 to 2: 1.

in a detection system combining a CRISPR system and PCR/LAMP amplification reaction, UDG enzyme can be added into a nucleic acid amplification system to digest unnecessary amplicons or residual aerosol pollution before the nucleic acid amplification reaction is carried out, so that the anti-pollution purpose is achieved.

In a detection system combining a CRISPR system and a PCR/LAMP amplification reaction, the mixed reaction solution is incubated for a short time and directly irradiated by simple light sources such as an ultraviolet LAMP, so that the detection result can be judged by naked eyes or the record can be observed by a fluorescent instrument. Typically, the incubation time is from 3 to 20 minutes, preferably from 5 to 15 minutes, more preferably from 8 to 12 minutes. Can shorten detection time by a wide margin, realize quick visual and can prevent the contaminated nucleic acid on-the-spot inspection of aerosol.

In the rapid PCR system, the concentration of DNA polymerase is in the range of 4U to 30U, and in a certain range, the higher the concentration of polymerase, the higher the amplification efficiency. Preferably, the concentration range of the DNA polymerase is provided in the range of 12U to 24U, more preferably, the concentration range of the DNA polymerase is provided in the range of 15U to 20U.

In the rapid PCR system, the concentration of the primer is provided at a concentration not lower than that in the standard PCR amplification system. The higher the primer concentration, the higher the amplification efficiency under the same conditions. Preferably, the concentration range of the primer is provided at a concentration of 0.2. mu.M to 8.0. mu.M. More preferably, the primers are provided at 0.6. mu.M to 4.0. mu.M. More preferably, the primer concentration is provided in the range of 0.8. mu.M to 2.0. mu.M.

In the three-temperature rapid PCR system, each cycle comprises three temperature steps of denaturation, annealing and extension. In a dual temperature rapid PCR amplification system, the annealing and extension steps are combined and allowed to proceed at the same temperature. For the denaturation temperature, preferably, a temperature range of 88 ℃ to 98 ℃ is provided. Preferably, a temperature range of 94 ℃ to 98 ℃ is provided. As the annealing temperature, a temperature not higher than the Tm value of the primer is given as an upper limit. Preferably, the annealing temperature is provided in the range of 48 ℃ to 65 ℃. More preferably, the annealing temperature is between 55 ℃ and 62 ℃. If a three temperature system is used, the extension temperature can be given in the range of 65 ℃ to 72 ℃.

In a rapid PCR amplification system, each cycle time is preferably completed within a time of 35 s. More preferably, the time for each cycle is completed within 20 s. More preferably, the time for each cycle is completed within 9 s.

In a rapid PCR system, the amplicon should be selected to be generally less than 300bp, preferably less than 200bp, and more preferably less than 100bp in length.

In the LAMP system, Bst 2.0DNA polymerase concentration ranges from 5U to 32U, and in a certain range, the higher the polymerase concentration, the higher the amplification efficiency. Preferably, the concentration range of the DNA polymerase is provided from 12U to 24U, more preferably, the concentration range of the DNA polymerase is provided from 16U to 18U.

In the LAMP system, the higher the primer concentration is, the higher the amplification efficiency is under the same conditions. Preferably, the concentration range of FIP/BIP primers is provided at a concentration of 0.8. mu.M to 3.0. mu.M. More preferably, the primer is provided at 1.2. mu.M to 2.4. mu.M. More preferably, the primer concentration is provided in the range of 1.5. mu.M to 2.0. mu.M.

In the LAMP system, the higher the primer concentration is, the higher the amplification efficiency is under the same conditions. Preferably, the concentration range of the F3/B3 primer is provided at a concentration of 0.1. mu.M to 1.0. mu.M. More preferably, the primers are provided at 0.1. mu.M to 0.8. mu.M. More preferably, the primer concentration is provided in the range of 0.1. mu.M to 0.4. mu.M.

In the LAMP system, the higher the primer concentration is, the higher the amplification efficiency is under the same conditions. Preferably, the concentration range of the loop primer LF/LB primer is provided at a concentration of 0.1. mu.M to 1.0. mu.M. More preferably, the primers are provided at 0.2. mu.M to 0.8. mu.M. More preferably, the primer concentration is provided in the range of 0.3. mu.M to 0.6. mu.M.

In the LAMP system, the reaction temperature is performed at a constant temperature, preferably, the reaction temperature is provided in the range of 61 ℃ to 69 ℃, preferably, the reaction temperature is provided in the range of 63 ℃ to 67 ℃, and more preferably, the reaction temperature is provided in the range of 64 ℃ to 66 ℃.

Besides the PCR and LAMP amplification technologies, the method is also suitable for detecting other products after isothermal amplification. In other isothermal amplifications, the method can keep the separation of the amplicon from the external link in the reaction system, and effectively prevent the problem of aerosol pollution caused by uncovering.

In the system of the present invention, the reaction tube and the thermoblock used are not particularly limited, and need only be capable of ensuring that a normal nucleic acid reaction is completed.

Example 1 detection of Citrus Huanglongbing Using CRISPR System in combination with LAMP amplification

LAMP amplification system: LAMP reaction was performed in a volume of 25. mu.L, and contained Bst 2.0DNA polymerase 16U, Tris-HCl 20mM, KCl 10mM, (NH4)₂SO₄ 10mM，MgSO₄2.0mM, 0.1% Triton @ x-100, 1.4mM mixed fraction containing dUTP, Betaine 5.0M, UDG enzyme 0.5U or paraffin oil 40. mu.L (approximately 10mM in thickness), and primer concentrations of 1.6. mu.M, 0.2. mu.M and 0.4. mu.M, respectively. The UDG enzyme or the paraffin oil in the system mainly plays a role in pollution prevention.

Wherein UDG enzyme can be directly added into the amplification reaction solution, pollution digestion is carried out at 37 ℃ for about 10min before LAMP amplification reaction is carried out, and then LAMP amplification reaction is carried out.

LAMP reaction program: the reaction was carried out at 63 ℃ for 30 min.

Fig. 2 shows real-time fluorescence amplification curves of LAMP reaction after replacing dTTP with dUTP, and it can be seen that after the replacement, the LAMP reaction still has Ct 36 amplification for the positive sample, and the negative sample has no amplification. FIG. 3 shows the result of the amplification judged by the dissolution curve, and the dissolution peak at about 85 ℃ indicates that the amplification curve of the positive sample in FIG. 2 is indeed the result of the accumulation of the target product.

Cas12a protein-based CRISPR reaction system: the total volume is 20. mu.L, and the working concentration of each reagent in the system is as follows: Tris-HCl 10mM, NaCl 50mM, MgCl₂10mM, 100. mu.g/mL BSA, Cas12a 0.75. mu.M, crRNA 1.5. mu.M, single-stranded DNA fluorescent probe 2.5. mu.M, RNA inhibitor 10U and DNA amplicon. (Cas12a was purchased from New England Biolabs inc., cat # M0653).

CRISPR nucleic acid detection procedure: the mixed reaction solution was allowed to react at 37 ℃ for 25min, and then the enzyme was inactivated at 95 ℃ for 10 min. Then the picture is taken by the naked eye or the mobile phone with a simple observation device under the irradiation of an ultraviolet lamp or other simple light sources (the main wavelength is 365 nm). The result shows that the positive sample of the yellow dragon germ shows a positive result, and the negative sample shows a negative result. FIG. 1 is a graph showing the results of practical tests performed in example 1. By means of a fluorescence reader, it is possible to detect very high fluorescence values in the positive sample (number 1 in the figure) and no fluorescence in the negative sample (number 2 in the figure). And as can be seen from the curve in the figure, the accumulated fluorescence value is very high in the time of about 5min, and the fluorescence value can be directly observed by naked eyes.

The primer sequences used in the above reaction:

F3 5’GTCCCATGCATACGCACAT 3’

B3 5’CCCCGAAATCGGACACTTC 3’

FIP 5’ACCTCCGCTGAGGCAAAGTTTTAAGGATTACGGCGAAGAGC3’

BIP 5’TCGACATTGAAACCCGCAGTCCCTCCGCATAAGCCCAAACC3’

LF 5’GACTCCGATACCTCGGTC 3’

LB 5’CTACCTTAGGCAAGGGTTG 3’

Probe 5’6-FAM-TTATT-BHQ1 3’

crRNA sequence

5’UAAUUUCUACUAAGUGUAGAU-ACAUUGAUCAGUUCCACGGCA3’

Amplified template sequence:

5’CCCCGAAATCGGACACTTCGGAGTTTAAGGATTACGGCGAAGAGCAAGACTCCGATACCTCGGTCTCAAAACTTTGCCTCAGCGGAGGTGGACTCCGACGCTCTGCCGTGGAACTGATCAATGTCAAAGCTGTTTATCGACATTGAAACCCGCAGTCCTCAACCCTTGCCTAAGGTAGGGGTTTGGGCTTATGCGGAGCAGGCGGTTATCACTTTATGTGCGTATGCATGGGAC 3’

example 2 detection of Citrus Huanglongbing Using CRISPR System in combination with PCR amplification

PCR amplification System: the PCR reaction was performed in a 10. mu.L volume containing 12.5U of Taq HS polymerase, 10mM Tris-HCl, 50mM KCl, MgCl₂1.5mM, mix fraction containing dUTP 1mM, UDG enzyme 0.5U or paraffin oil 40. mu.L (ca. total thickness 10mM), primer concentrations 0.4. mu.M each (purchased from Dalian)Baobao bioengineering ltd, cat # R007A). The UDG enzyme or the paraffin oil in the system mainly plays a role in pollution prevention.

Wherein UDG enzyme can be directly added into the amplification reaction solution, pollution digestion is carried out at 37 ℃ for about 10min before PCR amplification reaction is carried out, and then PCR amplification reaction is carried out.

PCR amplification procedure: the hot start at 95 ℃ is carried out for 30s, 35 cycles are carried out, each cycle comprises 2s of denaturation reaction at 95 ℃ and 3s of annealing extension reaction at 55 ℃, and the total time of amplification is 3 min.

The primer sequences used were:

FP 5’GTCCCATGCATACGCACAT 3’

BP 5’CCCCGAAATCGGACACTTC 3’

CRISPR nucleic acid detection procedure: the mixed reaction solution was allowed to react at 37 ℃ for 25min, and then the enzyme was inactivated at 95 ℃ for 10 min. Then the picture is taken by the naked eye or the mobile phone with a simple observation device under the irradiation of an ultraviolet lamp or other simple light sources (the main wavelength is 365 nm). The result shows that the positive sample of the yellow dragon germ shows a positive result, and the negative sample shows a negative result.

Example 3, citrus yellow shoot is detected using the CRISPR system in combination with LAMP.

In this example, the dUTP mix was provided at 1mM and the other operating conditions were the same as in example 1. The result shows that the positive sample of the yellow dragon germ shows a positive result, and the negative sample shows a negative result.

Example 4 citrus yellow shoot disease was detected using the CRISPR system in combination with LAMP.

In this example, the dUTP mix components were provided at 2mM and the other operating conditions were the same as in example 1. The result shows that the positive sample of the yellow dragon germ shows a positive result, and the negative sample shows a negative result.

Example 5, citrus yellow shoot is detected using the CRISPR system in combination with LAMP.

In this example, the dUTP mix was provided at 4mM and the other operating conditions were the same as in example 1. The result shows that the positive sample of the yellow dragon germ shows a positive result, and the negative sample shows a negative result.

Example 6 citrus yellow shoot disease was detected using the CRISPR system in combination with LAMP.

In this example, the dUTP mix components were provided at 10mM and the other operating conditions were the same as in example 1. The result shows that the positive sample of the yellow dragon germ shows a positive result, and the negative sample shows a negative result.

Example 7 citrus yellow shoot disease was detected using the CRISPR system in combination with LAMP.

In this example, the UDG enzyme was supplied at 0.1U, and the other working conditions were the same as in example 1. The result shows that the positive sample of the yellow dragon germ shows a positive result, and the negative sample shows a negative result.

Example 8 citrus yellow shoot disease was detected using the CRISPR system in combination with LAMP.

In this example, the UDG enzyme was supplied at 0.01U, and the other working conditions were the same as in example 1. The result shows that the positive sample of the yellow dragon germ shows a positive result, and the negative sample shows a negative result.

Example 9 citrus yellow shoot disease was detected using the CRISPR system in combination with LAMP.

In this example, the UDG enzyme was supplied at 0.001U, and the other working conditions were the same as in example 1. The result shows that the positive sample of the yellow dragon germ shows a positive result, and the negative sample shows a negative result.

Example 10, citrus yellow shoot is detected using CRISPR system in combination with PCR.

In this example, the dUTP mix was provided at 1mM and the other operating conditions were the same as in example 2. The result shows that the positive sample of the yellow dragon germ shows a positive result, and the negative sample shows a negative result.

Example 11, citrus yellow shoot is detected using CRISPR system in combination with PCR.

In this example, the dUTP mix components were provided at 2mM and the other operating conditions were the same as in example 2. The result shows that the positive sample of the yellow dragon germ shows a positive result, and the negative sample shows a negative result.

Example 12, citrus yellow shoot is detected using CRISPR system in combination with PCR.

In this example, the dUTP mix was provided at 4mM and the other operating conditions were the same as in example 2. The result shows that the positive sample of the yellow dragon germ shows a positive result, and the negative sample shows a negative result.

Example 13 citrus yellow shoot is detected using CRISPR system in combination with PCR.

In this example, the dUTP mix components were provided at 10mM and the other operating conditions were the same as in example 2. The result shows that the positive sample of the yellow dragon germ shows a positive result, and the negative sample shows a negative result.

Example 14, citrus yellow shoot is detected using CRISPR system in combination with PCR.

In this example, the UDG enzyme was supplied at 0.1U, and the other working conditions were the same as in example 2. The result shows that the positive sample of the yellow dragon germ shows a positive result, and the negative sample shows a negative result.

Example 15, citrus yellow shoot is detected using CRISPR system in combination with PCR.

In this example, the UDG enzyme was supplied at 0.01U, and the other working conditions were the same as in example 2. The result shows that the positive sample of the yellow dragon germ shows a positive result, and the negative sample shows a negative result.

Example 16, citrus yellow shoot is detected using CRISPR system in combination with PCR.

In this example, the UDG enzyme was supplied at 0.001U, and the other working conditions were the same as in example 2. The result shows that the positive sample of the yellow dragon germ shows a positive result, and the negative sample shows a negative result.

Sequence listing

<110> Zhejiang university

<120> CRISPR nucleic acid detection method with anti-pollution capacity

<160> 11

<170> SIPOSequenceListing 1.0

<210> 1

<211> 19

<212> DNA

<213> Artificial sequence (Candida liberobacter asiaticum)

<400> 1

gtcccatgca tacgcacat 19

<210> 2

<211> 19

<212> DNA

<213> Artificial sequence (Candida liberobacter asiaticum)

<400> 2

ccccgaaatc ggacacttc 19

<210> 3

<211> 41

<212> DNA

<213> Artificial sequence (Candida liberobacter asiaticum)

<400> 3

acctccgctg aggcaaagtt ttaaggatta cggcgaagag c 41

<210> 4

<211> 41

<212> DNA

<213> Artificial sequence (Candida liberobacter asiaticum)

<400> 4

tcgacattga aacccgcagt ccctccgcat aagcccaaac c 41

<210> 5

<211> 18

<212> DNA

<213> Artificial sequence (Candida liberobacter asiaticum)

<400> 5

gactccgata cctcggtc 18

<210> 6

<211> 19

<212> DNA

<213> Artificial sequence (Candida liberobacter asiaticum)

<400> 6

ctaccttagg caagggttg 19

<210> 7

<211> 5

<212> DNA

<213> Artificial sequence (Candida liberobacter asiaticum)

<400> 7

ttatt 5

<210> 8

<211> 42

<212> RNA

<213> Artificial sequence (Candida liberobacter asiaticum)

<400> 8

uaauuucuac uaaguguaga uacauugauc aguuccacgg ca 42

<210> 9

<211> 234

<212> DNA

<213> Candidatus liberobacter asiaticum

<400> 9

ccccgaaatc ggacacttcg gagtttaagg attacggcga agagcaagac tccgatacct 60

cggtctcaaa actttgcctc agcggaggtg gactccgacg ctctgccgtg gaactgatca 120

atgtcaaagc tgtttatcga cattgaaacc cgcagtcctc aacccttgcc taaggtaggg 180

gtttgggctt atgcggagca ggcggttatc actttatgtg cgtatgcatg ggac 234

<210> 10

<211> 19

<212> DNA

<213> Artificial sequence (Candida liberobacter asiaticum)

<400> 10

gtcccatgca tacgcacat 19

<210> 11

<211> 19

<212> DNA

<213> Artificial sequence (Candida liberobacter asiaticum)

<400> 11

ccccgaaatc ggacacttc 19

Claims

1. A method for CRISPR nucleic acid detection with antipollution capability for non-diagnostic purposes, characterized in that:

the CRISPR nucleic acid detection method uses the following two systems: an anti-pollution nucleic acid amplification system and a CRISPR detection system containing UDG enzyme;

digesting possibly existing residual polluted amplicon in a reaction environment by using UDG enzyme in an anti-pollution nucleic acid amplification system containing the UDG enzyme, then carrying out nucleic acid amplification reaction, and replacing a traditional dTTP component with a component containing dUTP as a raw material for nucleic acid amplification so that T bases do not exist in continuously accumulated amplicon products any longer and are replaced by U bases;

then the CRISPR detection system is used for detection,

the Cas12a protein is used for specifically recognizing a PAM site consisting of UUN base clusters, and further detecting a DNA double strand containing uracil (U base), wherein N is any base.

2. The method for CRISPR nucleic acid detection with antipollution capability of non-diagnostic purpose according to claim 1, characterized in that: in the anti-contamination nucleic acid amplification system containing the UDG enzyme, the dUTP-containing components are dATP, dGTP, dCTP and dUTP, and the concentrations of the dUTP-containing components are 0.1-20 mM dATP, 0.1-20 mM dGTP, 0.1-20 mM dCTP and 0.1-20 mM dUTP.

3. A method of CRISPR nucleic acid detection with antipollution capability for non-diagnostic purposes according to claim 2, characterized in that: in the pollution-preventive nucleic acid amplification system containing the UDG enzyme, the concentration of the dUTP-containing component in the nucleic acid amplification system is 1-10 mM dATP, 1-10 mM dGTP, 1-10 mM dCTP and 1-10 mM dUTP.

4. A method of CRISPR nucleic acid detection with antipollution capability for non-diagnostic purposes according to claim 2, characterized in that: in the contamination-preventive nucleic acid amplification system containing the UDG enzyme, the concentration of the dUTP-containing component in the nucleic acid amplification system is 2-5 mM dATP, 2-5 mM dGTP, 2-5 mM dCTP and 2-5 mM dUTP.

5. A method of CRISPR nucleic acid detection with antipollution capability for non-diagnostic purposes according to claim 2, characterized in that: in the contamination-preventive nucleic acid amplification system containing the UDG enzyme, the concentration of the dUTP-containing component in the nucleic acid amplification system was 2.5mM dATP, 2.5mM dGTP, 2.5mM dCTP, and 2.5mM dUTP.

6. The method for CRISPR nucleic acid detection with antipollution capability of non-diagnostic purpose according to claim 1, characterized in that: in the pollution-prevention nucleic acid amplification system containing the UDG enzyme, the amount of the UDG enzyme used for pollution prevention is 0.0001U-1U.

7. The method for CRISPR nucleic acid detection with antipollution capability of non-diagnostic purpose according to claim 1, characterized in that: in the pollution-preventing nucleic acid amplification system containing the UDG enzyme, the amount of the UDG enzyme used for pollution prevention is 0.0005U-0.5U.

8. The method for CRISPR nucleic acid detection with antipollution capability of non-diagnostic purpose according to claim 1, characterized in that: in the pollution-prevention nucleic acid amplification system containing the UDG enzyme, the amount of the UDG enzyme used for pollution prevention is 0.001U-0.5U.

9. The method for CRISPR nucleic acid detection with antipollution capability of non-diagnostic purpose according to claim 1, characterized in that: in the pollution-prevention nucleic acid amplification system containing the UDG enzyme, the amount of the UDG enzyme used for pollution prevention is 0.01U-0.5U.