CN111647605A

CN111647605A - crRNA for detecting African swine fever virus and kit

Info

Publication number: CN111647605A
Application number: CN202010662810.9A
Authority: CN
Inventors: 唐小春; 彭小唤; 焦虎平; 逄大欣; 欧阳红生
Original assignee: Jilin University
Current assignee: Jilin University
Priority date: 2020-07-10
Filing date: 2020-07-10
Publication date: 2020-09-11

Abstract

The invention provides crRNA for detecting African swine fever virus and a kit, belonging to the technical field of virus detection. The crRNA is used for guiding CRISPR-Cas12a to specifically bind to African swine fever target DNA; the kit comprises the target DNA, crRNA, CRISPR-Cas12a, optimized detection buffer solution, ssDNA probe and RNase inhibitor; after the CRISPR-Cas12a recognizes the African swine fever DNA as a target molecule under the guidance of the crRNA, the CRISPR-Cas12a, the crRNA and the target DNA molecule are combined into a compound to cut the ssDNA fluorescent probe in a detection system, and a large amount of fluorescence is generated and can be detected. The kit disclosed by the invention has the advantages of good detection specificity, high sensitivity, simplicity in operation and short time consumption.

Description

crRNA for detecting African swine fever virus and kit

Technical Field

The invention belongs to the technical field of virus detection, and particularly relates to crRNA for detecting African swine fever virus and a kit.

Background

African Swine Fever (ASF) is a Swine disease caused by acute and high-contagious fever virus, the disease process is short, but the death rate reaches 100%, and the clinical manifestations of the sick Swine are fever, cyanosis of skin, and obvious bleeding of lymph nodes, kidney and gastrointestinal mucosa.

The African swine fever has great influence on the breeding industry of live pigs in China, but at present, a vaccine of the African Swine Fever (ASF) caused by the African Swine Fever Virus (ASFV) cannot be obtained, and a feasible treatment method is not available, so that the enhancement of epidemic prevention is the key point for effectively controlling the Wenzhou swine fever, and the important point of epidemic prevention is the realization of the rapid and reliable detection of the African swine fever virus.

The traditional African swine fever detection method has the defects of complex operation, need of professional technicians and the like, and is difficult to meet the requirement of efficient detection of African swine fever. Currently, the emerging gene editing tool CRISPR-Cas12a has been applied to nucleic acid detection, which is faster and easier to implement than qPCR and ELISA.

Disclosure of Invention

Therefore, the invention aims to provide crRNA and a kit for detecting African swine fever virus, and the method for detecting the African swine fever virus by adopting CRISPR-Cas12a has the advantages of good specificity, high sensitivity and detection limit up to 10^-18mol/L。

The invention provides a crRNA for detecting African swine fever virus, which is used for guiding CRISPR-Cas12a to be specifically combined with African swine fever target DNA.

Preferably, the nucleotide sequence of the crRNA comprises one of SEQ ID No.1 to SEQ ID No. 30.

The invention provides a kit for detecting African swine fever virus, which comprises crRNA, CRISPR-Cas12a and ssDNA fluorescent probes.

Preferably, the ssDNA fluorescent probe has a nucleotide sequence shown in SEQ ID No.32, and two ends of the ssDNA fluorescent probe are respectively connected with a fluorescent group 6-FAM and a quenching group BHQ-1.

Preferably, the use concentration of the crRNA is 200-300 nmol/L.

Preferably, the CRISPR-Cas12a is used at a concentration of 150-250 nmol/L.

Preferably, the use concentration of the ssDNA fluorescent probe is 150-250 nmol/L.

Preferably, the kit further comprises a detection buffer solution, wherein the detection buffer solution takes water as a solvent and comprises the following components in concentration: 15-25 mmol/L Tris-HCL, 80-120 mmol/L KCL, 4-6 mmol/L MgCl₂0.8-1.2 mmol/L DTT, 4-6% (volume ratio) glycerol and 45-55 mu g/ml heparin.

Preferably, the ssDNA fluorescent probe is replaced by a DNA nano-gold probe, and the DNA nano-gold probe modifies nano-gold at a DNA sulfhydryl group; the nucleotide sequence of the DNA nano-gold probe is shown as SEQ ID No. 37-39.

The invention has the beneficial effects that: the crRNA and the kit for detecting the African swine fever virus provided by the invention are used for detecting the African swine fever virus by adopting a CRISPR-Cas12a method, have high specificity on the African swine fever virus ASFV, have no cross reaction with porcine circovirus type 2 (PCV2), pseudorabies virus (PRV) and mycoplasma bovis PG45 strains, have high detection sensitivity, and have the detection limit of 10^-18mol/L. The kit provided by the invention is simple and convenient to operate; the detection time is short, and the whole detection process is completed within 1 h.

Drawings

FIG. 1 shows the result of pseudorabies virus detection;

FIG. 2 shows the result of detecting African swine fever virus DNA;

FIG. 3 shows the result of detection of Mycoplasma bovis PG 45;

FIG. 4 shows the specific detection result of the kit provided by the present invention;

FIG. 5 shows the results of the sensitivity test using the kit of the present invention;

FIG. 6 is a graph showing the effect of temperature of the detection system on the detection results;

FIG. 7 is the influence of pH value of the detection system on the detection result;

FIG. 8 is a graph showing the effect of the concentration of magnesium ions in the detection system on the detection results;

FIG. 9 shows the effect of ssDNA fluorescent probe species on the assay results;

FIG. 10 is a graph showing the effect of the composition of the assay buffer on assay results;

FIG. 11 is a schematic diagram of the visual detection of DNA nanogold probes.

Detailed Description

In the present invention, the nucleotide sequence of the crRNA preferably includes one of SEQ ID No.1 to SEQ ID No. 30.

In the invention, after the CRISPR-Cas12a recognizes the target molecule African swine fever DNA under the guidance of crRNA, the CRISPR-Cas12a, the crRNA and the target DNA molecule are combined into a complex; the complex cuts the ssDNA fluorescent probe in the detection system, and after the probe molecule is cut, a large amount of fluorescence is generated and can be detected.

In the invention, the amino acid sequence of the CRISPR-Cas12a is shown as SEQ ID No. 36; the source and the preparation method of the CRISPR-Cas12a are not particularly limited, and conventional Escherichia coli expression or artificial synthesis in the field can be adopted. In the invention, the use concentration of the CRISPR-Cas12a is preferably 150-250 nmol/L, and more preferably 200 nmol/L.

In the invention, two ends of the ssDNA fluorescent probe are respectively connected with a fluorescent group and a fluorescence quenching group. In the present invention, the fluorescent group is preferably FAM, and the fluorescence quenching group is preferably BHQ 1. In the implementation process of the present invention, preferably, the 5 'end of the ssDNA fluorescent probe is labeled with a fluorescent group FAM, and the 3' end is labeled with a quenching group BHQ 1. In the invention, the nucleotide sequence of the ssDNA fluorescent probe is shown as SEQ ID No. 32-33; the method comprises the following specific steps: j Probe sequence: FAM-TTATT-BHQ 1; w probe sequence: FAM-CCGGAAAAAAAAAAAACCGG-BHQ1, preferably a J probe. The preparation method of the ssDNA fluorescent probe is not particularly limited, and a conventional artificial synthesis method in the field can be adopted. In the invention, the use concentration of the ssDNA fluorescent probe is preferably 150-250 nmol/L, and more preferably 200 nmol/L.

In the invention, the use concentration of the crRNA is preferably 200-300 nmol/L, and more preferably 250 nmol/L.

In the invention, the kit further comprises a detection buffer solution, wherein the detection buffer solution takes water as a solvent and comprises the following components in concentration: 15-25 mmol/L Tris-HCL, 80-120 mmol/L KCL, 4-6 mmol/L MgCl₂0.8-1.2 mmol/L DTT, 4-6% glycerol and 45-55 mu g/ml heparin; preferred compositions include the following concentrations: 20mmol/L Tris-HCL, 100mmol/L KCL, 5mmol/L MgCl₂1mmol/L DTT, 5% glycerol and 50. mu.g/ml heparin. In the invention, the pH value of the detection buffer solution is preferably 7.8-8.5, and more preferably 8.0.

In the present invention, the kit preferably further comprises an rnase inhibitor, and the source of the rnase inhibitor is not particularly limited in the present invention, and a commercially available rnase inhibitor may be used.

In the invention, the ssDNA fluorescent probe can be a DNA nano-gold probe, and nano-gold is modified at a DNA sulfhydryl group by the DNA nano-gold probe; the nucleotide sequence of the DNA nano-gold probe is shown in SEQ ID No. 37-39; the concrete steps are as follows: gold 1: TTTTTGCTCGG 5' SHC 6; gold 2: GCTGCGTTTTT3 'SHC 65' P; gold 3: AACGCAGCCCGAGCAA are provided. In the invention, the DNA nano-gold probe is preferably synthesized into a DNA sequence by an artificial synthesis method, and then the nano-gold is modified at the sulfydryl of the DNA sequence by a salt-adding modification method to obtain the DNA nano-gold probe. When the DNA nano-gold probe is used for replacing the ssDNA fluorescent probe for detection, the solution containing the target molecules is red, and if the solution is purple, the visual detection can be realized. The kit provided by the invention can be used for visual detection, and provides a rapid and convenient detection method for field detection.

In the present invention, the method of using the kit preferably comprises the steps of: p54ASFVDNA, crRNA, CRISPR-Cas12a, ssDNA fluorescent probe and detection buffer solution in the kit are mixed and incubated for fluorescence detection.

In the invention, the DNA is SEQ ID No.31 synthesized by Jinzhi corporation, and the fluorescence detection is carried out after the DNA is mixed and incubated with crRNA, CRISPR-Cas12a, ssDNA fluorescent probe and detection buffer solution in the kit. In the invention, the incubation temperature is preferably 35-42 ℃, and more preferably 37 ℃; the incubation time is preferably 25-35 min, and more preferably 30 min. In the invention, the concentration of the DNA in the detection system is preferably 150-250 nmol/L, and more preferably 200 nmol/L. The concentration of the crRNA in a detection system is preferably 200-300 nmol/L, and more preferably 250 nmol/L; the concentration of the CRISPR-Cas12a in a detection system is preferably 150-250 nmol/L, and more preferably 200 nmol/L; the ssDNA fluorescent probe is preferably 150-250 nmol/L, and more preferably 200nmol/L in a detection system. The fluorescence detection is carried out after the incubation, the fluorescence detection is preferably carried out by using a fluorescence spectrometer, the excitation wavelength of the fluorescence detection is preferably 495nm, and the emission wavelength of the fluorescence detection is preferably 515 nm. In the present invention, a blank control is preferably set; the blank system was identical to the above detection system except that no DNA was added. And when the fluorescence value of the detection system is more than or equal to 3 times of the fluorescence value of the blank control system, the target molecule is considered to be present, namely the African swine fever virus exists in the sample.

The technical solutions provided by the present invention are described in detail below with reference to examples, but they should not be construed as limiting the scope of the present invention.

Example 1

Kit for detecting African swine fever virus

Consists of the following components:

1) CRISPR-Cas12a protein;

2) crRNA with nucleotide sequence shown as SEQ ID No. 1-30;

3) ssDNA fluorescent probe J: the nucleotide sequence is shown as SEQ ID No. 32: /56-FAM/CCGG AAAAA AAAAAAACCGG/3BHQ1

4) Detection buffer 20mmol/L Tris-HCL (ph8.0), 100mmol/L KCL, 5mmol/L MgCl₂1mmol/L DTT, 5% glycerol, 50. mu.g/ml heparin.

The CRISPR-Cas12a protein is obtained by expression and purification, and the specific method is as follows:

cas12a expression gene is cloned and recombined on a Pet28a vector by adopting PCR (polymerase chain reaction) method

II OnESTep Cloning Kit, pet-28a vector was linearized by Xho I single digestion, and Cas12 a-pet-28a vector was constructed according to the instructions of the Clon Express IIOne Step Cloning Kit. PCR products of Cas12a gene with pet-28a vector terminal sequences at two ends and enzyme digestion products of pet-28a vector Xho I are mixed according to the molar ratio of 1:3, and then are catalyzed by recombinase Exnase MultiS at 37 ℃ for 30min to complete directional cloning. The pet-28a-LbCas12a plasmid was constructed.

Amplification primers for Cas12a expressed genes were as follows:

Cas12a-pet-F：AGCTTtgcggccgcacatgagcaagctggagaagtttacaaac(SEQ IDNo.34)

Cas12a-pet-R：gtggtggtggtggtggtgggatccctttttcttttttgcctggc(SEQ IDNo.35)。

the pet-28a-LbCas12a plasmid was used to recombinantly express LbCas12a, and the plasmid sequence was confirmed by DNA sequencing (Sangon, China). Expressing LbCas12a protein, eluting with gradient imidazole, eluting the protein on Ni column, repeatedly dialyzing with 1-10kd dialysis bag for 3 times, 2h each time, obtaining protein, and exchanging into protein storage solution (600mM NaCl, 50mM Tris-HCl pH7.5, 5% glycerol, 2mM DTT) for freezing and storing for later use. Transformation of LbCas12a expression vector into Rosetta^TM2(DE3) competent cells (Tiangen), adding the expression plasmid Cas12a into DE3 competent cells (50 μ L), mixing uniformly, standing in ice bath for 30min, water bath at 42 ℃ for 90sec, then quickly transferring the tube into the ice bath for 5min, adding 200 μ L of sterile LB medium, mixing uniformly, placing on a shaker at 37 ℃ for shaking culture for 30min (150rpm), and coating on a plate to obtain the expression strain. 10mL of starter culture was cultured overnight in LB, then inoculated into 200mL of LB for growth, and shaken at 37 ℃ and 200rpm until OD600 was 0.6. At this time, protein expression was induced by adding IPTG (Boster) to a final concentration of 500. mu.M, and the cells were cooled to 16 ℃ for 16h at 150rpm for protein expression. The cells were then centrifuged at 8000g for 20min at 4 ℃. Cell pellets were harvested and stored at-8At 0 ℃ for subsequent purification. The harvested cells were resuspended in lysis buffer (20mmol/L Tris-HCl, pH8.0, 0.5mol/L NaCl), disrupted by sonication (power 200W, 10s each, 10s off, 30 repetitions), and centrifuged at 12,000g for 20min at 4C to collect the protein. The cell pellet was harvested and lysed, then NiSepharose was used^TM6Fastflow (GE) washing and elution, proteins obtained after lysis and NiSepharose^TM6Fastflow (GE) at 4 ℃ conditions of repeated mixing incubation binding for 30min, PBS washing binding protein column, gradient low concentration imidazole elution column to remove mixed protein, and then 200mM imidazole solution can be eluted with the protein of interest collection, and 1-10kd dialysis bag repeated dialysis 3 times, each time 2 hours, protein and exchange to protein storage solution (600mM NaCl, 50mM Tris-HCl pH7.5, 5% glycerol, 2mM DTT). The purified Cas12a protein was purified by dialysis and finally the protein concentration was quantified using BCA protein assay kit (Thermo Fisher).

The design and synthesis method of the crRNA comprises the following steps:

design of crRNA: the method comprises the steps of forming crRNA-F by using a T7 promoter (TAATACGACTCACTATAGG) + a scaffold sequence (aatttctactaagtgtagat) + a target sequence (20-23 bp behind a target DNA PAM sequence, namely, the PAM sequence is removed from a designed crRNA sequence) of LbCas12a, and carrying out reverse complementation to obtain crRNA-R, wherein the T7 promoter enables double strands obtained by annealing to be recognized and transcribed by T7RNA polymerase, and the scaffold sequence can be combined with LbCas12 a. The crRNA was synthesized using HiScribe of NEB^TMT7 ARCA mRNA Kit. T7 in vitro transcription was performed using 1. mu.g DNA template over 4h, then RNA was purified using the miRNeasy Mini Kit (QIAGEN) and quantified using NanoDrop2000C (ThermoFisher Scientific).

Example 2

Kit for detecting African swine fever virus

Consists of the following components:

1) CRISPR-Cas12a protein;

2) crRNA with nucleotide sequence shown as SEQ ID No. 1-30;

3) ssDNA fluorescent probe W: the nucleotide sequence is shown as SEQ ID No. 33: /56-FAM/TTATT/3BHQ1

4) Detection buffer 20mmol/L LTris-HCL (ph8.0), 100mmol/L KCL, 5mmol/L MgCl₂1mmol/L DTT, 5% glycerol, 50. mu.g/ml heparin.

Example 3

Kit for detecting African swine fever virus

Consists of the following components:

1) CRISPR-Cas12a protein;

2) crRNA with nucleotide sequence shown as SEQ ID No. 28-30;

3) ssDNA fluorescent probe J: the nucleotide sequence is shown as SEQ ID No. 32: 56-FAM/TTATTTTATTTT/3BHQ 1/;

Example 4

African swine fever virus DNA detection

CRISPR-Cas12a and crRNA-1 with the nucleotide sequence as SEQ ID No.28, and adding African swine fever virus DNA to start fluorescence detection

In a 50 μ L assay system, crRNA-1 and Cas12a were both added to final concentrations of 250nmol/L and 200nmol/L, DNA to 200nmol/L, followed by DNA fluorescence quenching probe J: FAM-CCGGAAAAAAAAAAAACCGG-BHQ1(SEQ ID No.32) at a final concentration of 200nmol/L, followed by addition of 0.5. mu.L of LRNaseInhibitor, Murine (NEB), and buffer supplementation to 50. mu.L. The detection system is first incubated at 37 ℃ for 30min, then diluted to 200. mu.L, transferred to a glass dish and detected by a fluorescence spectrometer with an excitation wavelength of 495nm and an emission wavelength of 515 nm.

The above was ASFV experimental group, and the neg control group was identical to the experimental group except that African swine fever virus DNA was not added.

Example 5

African swine fever virus DNA sample detection

CRISPR-Cas12a and crRNA-2 with the nucleotide sequence as SEQ ID No.29, and adding African swine fever virus DNA to start fluorescence detection

In a 50 μ L assay system, crRNA-2 and Cas12a were both added to final concentrations of 250nmol/L and 200nmol/L, african swine fever virus DNA was added to 200nmol/L, followed by ssDNA fluorescence quenching probe J: FAM-CCGGAAAAAAAAAAAACCGG-BHQ1(SEQ ID No.32) at a final concentration of 200nmol/L, followed by addition of 0.5. mu.L of LRiboLock RNase Inhibitor (40U/. mu.L) to make up the buffer to 50. mu.L. The detection system is first incubated at 37 ℃ for 30min, then diluted to 200. mu.L, transferred to a glass dish and detected by a fluorescence spectrometer with an excitation wavelength of 495nm and an emission wavelength of 515 nm.

Example 6

African swine fever virus DNA sample detection

CRISPR-Cas12a and crRNA-3 with the nucleotide sequence as SEQ ID No.31, and the amplified target molecule are added to start fluorescence detection

In a 50 μ L assay system, crRNA-3 and Cas12a were both added to final concentrations of 250nmol/L and 200nmol/L, PCR amplification products were added to 200nmol/L, and then DNA fluorescence quenching probe J: FAM-CCGGAAAAAAAAAAAACCGG-BHQ1(SEQ ID No.32) at a final concentration of 200nmol/L, followed by addition of 0.5. mu.L of LRiboLockRNaseIllinhibitor (40U/. mu.L) to make up the buffer to 50. mu.L. The detection system is first incubated at 37 ℃ for 30min, then diluted to 200. mu.L, transferred to a glass dish and detected by a fluorescence spectrometer with an excitation wavelength of 495nm and an emission wavelength of 515 nm.

The above was an ASFV experimental group, and the neg control group was identical to the ASFV experimental group except that no DNA was added.

The detection results of the embodiments 4 to 6 are shown in FIG. 2, wherein the ASFV1 adopts crRNA-1 SEQ ID No.28, the ASFV2 adopts crRNA-2SEQ ID No.29, and the ASFV3 adopts crRNA-3 SEQ ID No.30, which correspond to the embodiments 4 to 6, respectively; the difference of fluorescence values of the ASFV group and the neg control group is more than 5 times, and the detection method of the kit is reliable.

Example 7

Samples from different sources were detected using the kit of example 1, the detection method is as described in example 4, and the detection results are shown in fig. 4, wherein:

ASFV: cloning ASFV conserved region P54SEQ ID No.31 to PUC57 vector to construct plasmid;

WT: detecting the WT genome of the pig by using the designed crRNA-ASFV1 SEQ ID No. 28;

PCV2 (porcine circovirus type 2): the designed crRNA-ASFV1 SEQ ID No.28 is used for detecting PCV 2;

RPV (pseudorabies virus): the designed crRNA-ASFV1 SEQ ID No.28 is used for detecting the RPV of the pig;

PG45 (mycoplasma bovis): the designed crRNA-ASFV1 SEQ ID No.28 was used to detect PG45 in pigs.

According to the results shown in FIG. 4, the kit provided by the invention can specifically detect African swine fever virus, and has no cross reaction with other viruses or samples.

Example 8

The sensitivity of the kit in example 1 was measured.

The DNA obtained in example 4 was subjected to gradient dilution to obtain concentrations of 10²、10¹、10⁰、10^-1、10^-2……10^-21mol/L。

The detection result is shown in FIG. 5, and the sensitivity reaches 10^-18mol/L。

Example 9

The influence of the temperature, the pH value, the magnesium ion concentration, the type of the ssDNA fluorescent probe and the composition in the detection buffer solution on the detection result is detected.

Setting the detection incubation temperature at 20 ℃, 25 ℃, 30 ℃, 37 ℃, 42 ℃ and 50 ℃; the rest steps are the same as example 4; as shown in FIG. 6, the fluorescence was higher when the cells were incubated at 37 ℃ as compared with the other groups, and 37 ℃ was the optimum working temperature of the protein.

The results of setting the pH of the detection system to 6.0, 6.5, 6.8, 7.0, 7.5, 8.0, 8.5, 9.0 or 9.5 and the rest of the procedure as in example 4 are shown in FIG. 7, which indicates that the fluorescence intensity is higher when the pH is 8.0.

Mg of the system to be detected²⁺The concentrations were set to 1,3,4,5,6,7,8,9,10,15,20,50,100 and 200nmol/L for the detection in the same manner as in example 4, and the results are shown in FIG. 8, 5mmol/L Mg²⁺The reaction buffer of (3) is Cas12a for detecting ASFVSuitable for reaction conditions.

The detection is carried out by adopting two ssDNA fluorescent probes J and W respectively, the rest steps are the same as the example 4, and the result is shown in FIG. 9; the fluorescence value detected by using the ssDNA fluorescent probe J is higher, and the hairpin structure of the ssDNA fluorescent probe J enables a fluorophore and a quencher to be closely adjacent, so that a larger fluorescence difference is released after the ssDNA is cut, and therefore, when the ssDNA is broken, the fluorescence intensity difference is greatly improved.

Detecting the components of the detection buffer solution after the components lack dithiothreitol, glycerol and heparin respectively; the rest steps are the same as example 4; the results are shown in FIG. 10, where DTT: dithiothreitol, adding DTT into the flow group buffer solution, and adding no DTT into the flow group buffer solution; GI is glycerol, glycerol is added into the buffer solution of the stream group, and no stream buffer solution has no glycerol; hep, flow group buffer with heparin, no flow buffer without heparin, thus it can be seen that DTT, glycerol and heparin are present in the buffer, which provides the optimal reaction conditions for the assay.

Example 10

The ssDNA fluorescent probe in example 1 was replaced with a nanogold probe.

And (3) synthesis and design of nano gold: gold 1: TTTTTGCTCGG 5' SHC6(SEQ ID No.37), Gold 2: GCTGCGTTTTT3 'SHC 65' P (SEQ ID No.38), Gold 3: AACGCAGCCCGAGCAA (SEQ ID No.39), firstly synthesizing three DNA single chains with modified sulfydryl, modifying nanogold at the sulfydryl of the DNA by a salt modification method to obtain a DNA chain with nanogold modification, and adding the solution to the detection reaction solution instead of the ssDNA fluorescent probe.

The detection method is the same as example 4, the schematic diagram of the detection result is shown in FIG. 11, and the solution containing the African swine fever DNA target molecule is red, otherwise, the solution is purple. The visual detection of the African swine fever virus is realized, and the visual detection direction provides a quick and convenient detection method for field detection.

The foregoing is only a preferred embodiment of the present invention, and it should be noted that, for those skilled in the art, various modifications and decorations can be made without departing from the principle of the present invention, and these modifications and decorations should also be regarded as the protection scope of the present invention.

Sequence listing

<110> Jilin university

<120> crRNA for detecting African swine fever virus and kit

<160>39

<170>SIPOSequenceListing 1.0

<210>1

<211>24

<212>DNA

<213>Artificial Sequence

<400>1

ttttttcaac cggtttatcc gcgg 24

<210>2

<211>24

<212>DNA

<213>Artificial Sequence

<400>2

tttttcaacc ggtttatccg cggc 24

<210>3

<211>24

<212>DNA

<213>Artificial Sequence

<400>3

ttttcaaccg gtttatccgc ggca 24

<210>4

<211>24

<212>DNA

<213>Artificial Sequence

<400>4

tttcaaccgg tttatccgcg gcat 24

<210>5

<211>24

<212>DNA

<213>Artificial Sequence

<400>5

tttatccgcg gcattatggt gagt 24

<210>6

<211>24

<212>DNA

<213>Artificial Sequence

<400>6

tttgtcacca gtcaccccac caag 24

<210>7

<211>24

<212>DNA

<213>Artificial Sequence

<400>7

tttcttgaag agaatagata gatt 24

<210>8

<211>24

<212>DNA

<213>Artificial Sequence

<400>8

tttctttctt gaagagaata gata 24

<210>9

<211>24

<212>DNA

<213>Artificial Sequence

<400>9

ttttctttct tgaagagaat agat 24

<210>10

<211>24

<212>DNA

<213>Artificial Sequence

<400>10

tttttctttc ttgaagagaa taga 24

<210>11

<211>24

<212>DNA

<213>Artificial Sequence

<400>11

ttttttcttt cttgaagaga atag 24

<210>12

<211>24

<212>DNA

<213>Artificial Sequence

<400>12

tttataaatc cttatcaaga tcag 24

<210>13

<211>24

<212>DNA

<213>Artificial Sequence

<400>13

tttataaact gtatatcttc ctcc 24

<210>14

<211>24

<212>DNA

<213>Artificial Sequence

<400>14

tttagaggta cctggttgtg gagt 24

<210>15

<211>24

<212>DNA

<213>Artificial Sequence

<400>15

tttgcctgca cttgctgtag tcgc 24

<210>16

<211>24

<212>DNA

<213>Artificial Sequence

<400>16

tttgttgccg gtctgcccgt gact 24

<210>17

<211>24

<212>DNA

<213>Artificial Sequence

<400>17

tttgttgctg gtctgtttgt tgcc 24

<210>18

<211>24

<212>DNA

<213>Artificial Sequence

<400>18

tttgtttgtt gctggtctgt ttgt 24

<210>19

<211>24

<212>DNA

<213>Artificial Sequence

<400>19

tttgtgaagc agtgttctga gtag 24

<210>20

<211>24

<212>DNA

<213>Artificial Sequence

<400>20

tttcaatagc cgacattgtt tgtg 24

<210>21

<211>24

<212>DNA

<213>Artificial Sequence

<400>21

ttttcaatag ccgacattgt ttgt 24

<210>22

<211>24

<212>DNA

<213>Artificial Sequence

<400>22

tttacgacaa agaaacacct atac 24

<210>23

<211>24

<212>DNA

<213>Artificial Sequence

<400>23

tttgtcgtaa attttcaata gccg 24

<210>24

<211>24

<212>DNA

<213>Artificial Sequence

<400>24

tttctttgtc gtaaattttc aata 24

<210>25

<211>24

<212>DNA

<213>Artificial Sequence

<400>25

tttatgcgta taggtgtttc tttg 24

<210>26

<211>24

<212>DNA

<213>Artificial Sequence

<400>26

tttctaggtc tttatgcgta tagg 24

<210>27

<211>24

<212>DNA

<213>Artificial Sequence

<400>27

ttttctaggt ctttatgcgt atag 24

<210>28

<211>24

<212>DNA

<213>Artificial Sequence

<400>28

tttcttataa tatacaacag tatg 24

<210>29

<211>24

<212>DNA

<213>Artificial Sequence

<400>29

tttaatttaa aattacaagg agtt 24

<210>30

<211>24

<212>DNA

<213>Artificial Sequence

<400>30

tttaagatac tattataaat aata 24

<210>31

<211>707

<212>DNA

<213>Artificial Sequence

<400>31

gagaatactt ggaaagttgg tccataaatt ctgtaatttc attgcgccac aacattttta 60

tatattattt ataatagtat cttaaatgga ttctgaattt tttcaaccgg tttatccgcg 120

gcattatggt gagtgtttgt caccagtcac cccaccaagc ttcttctcca cacatatgta 180

tactattctc attgctatcg tggtcttagt cattattatc atcgttctaa tctatctatt 240

ctcttcaaga aagaaaaaag ctgctgccgc tattgaggag gaagatatac agtttataaa 300

tccttatcaa gatcagcaat gggcagaagt cactccacaa ccaggtacct ctaaaccggc 360

tggagcgact acagcaagtg caggcaaacc agtcacgggc agaccggcaa caaacagacc 420

agcaacaaac aaaccagtca cggacaaccc agttacggac agactagtca tggcaactgg 480

cgggccagcg gccgcacctg cggccgcgag tgctcatccg actgagcctt acacgacagt 540

cactactcag aacactgctt cacaaacaat gtcggctatt gaaaatttac gacaaagaaa 600

cacctatacg cataaagacc tagaaaactc cttgtaattt taaattaaag actcaacata 660

ctgttgtata ttataagaaa atgaagacgt ttattacatg cacttcg 707

<210>32

<211>20

<212>DNA

<213>Artificial Sequence

<400>32

ccggaaaaaa aaaaaaccgg 20

<210>33

<211>5

<212>DNA

<213>Artificial Sequence

<400>33

ttatt 5

<210>34

<211>43

<212>DNA

<213>Artificial Sequence

<400>34

agctttgcgg ccgcacatga gcaagctgga gaagtttaca aac 43

<210>35

<211>44

<212>DNA

<213>Artificial Sequence

<400>35

gtggtggtgg tggtggtggg atcccttttt cttttttgcc tggc 44

<210>36

<211>1252

<212>PRT

<213>Artificial Sequence

<400>36

Met Ser Lys Leu Glu Lys Phe Thr Asn Cys Tyr Ser Leu Ser Lys Thr

1 5 10 15

Leu Arg Phe Lys Ala Ile Pro Val Gly Lys Thr Gln Glu Asn Ile Asp

20 25 30

Asn Lys Arg Leu Leu Val Glu Asp Glu Lys Arg Ala Glu Asp Tyr Lys

35 40 45

Gly Val Lys Lys Leu Leu Asp Arg Tyr Tyr Leu Ser Phe Ile Asn Asp

50 55 60

Val Leu His Ser Ile Lys Leu Lys Asn Leu Asn Asn Tyr Ile Ser Leu

65 70 75 80

Phe Arg Lys Lys Thr Arg Thr Glu Lys Glu Asn Lys Glu Leu Glu Asn

85 90 95

Leu Glu Ile Asn Leu Arg Lys Glu Ile Ala Lys Ala Phe Lys Gly Asn

100 105 110

Glu Gly Tyr Lys Ser Leu Phe Lys Lys Asp Ile Ile Glu Thr Ile Leu

115 120 125

Pro Glu Phe Leu Asp Asp Lys Asp Glu Ile Ala Leu Val Asn Ser Phe

130 135 140

Asn Gly Phe Thr Thr Ala Phe Thr Gly Phe Phe Asp Asn Arg Glu Asn

145 150 155 160

Met Phe Ser Glu Glu Ala Lys Ser Thr Ser Ile Ala Phe Arg Cys Ile

165 170 175

Asn Glu Asn Leu Thr Arg Tyr Ile Ser Asn Met Asp Ile Phe Glu Lys

180 185 190

Val Asp Ala Ile Phe Asp Lys His Glu Val Gln Glu Ile Lys Glu Lys

195 200 205

Ile Leu Asn Ser Asp Tyr Asp Val Glu Asp Phe Phe Glu Gly Glu Phe

210 215 220

Phe Asn Phe Val Leu Thr Gln Glu Gly Ile Asp Val Tyr Asn Ala Ile

225 230 235 240

Ile Gly Gly Phe Val Thr Glu Ser Gly Glu Lys Ile Lys Gly Leu Asn

245 250 255

Glu Tyr Ile Asn Leu Tyr Asn Gln Lys Thr Lys Gln Lys Leu Pro Lys

260 265270

Phe Lys Pro Leu Tyr Lys Gln Val Leu Ser Asp Arg Glu Ser Leu Ser

275 280 285

Phe Tyr Gly Glu Gly Tyr Thr Ser Asp Glu Glu Val Leu Glu Val Phe

290 295 300

Arg Asn Thr Leu Asn Lys Asn Ser Glu Ile Phe Ser Ser Ile Lys Lys

305 310 315 320

Leu Glu Lys Leu Phe Lys Asn Phe Asp Glu Tyr Ser Ser Ala Gly Ile

325 330 335

Phe Val Lys Asn Gly Pro Ala Ile Ser Thr Ile Ser Lys Asp Ile Phe

340 345 350

Gly Glu Trp Asn Val Ile Arg Asp Lys Trp Asn Ala Glu Tyr Asp Asp

355 360 365

Ile His Leu Lys Lys Lys Ala Val Val Thr Glu Lys Tyr Glu Asp Asp

370 375 380

Arg Arg Lys Ser Phe Lys Lys Ile Gly Ser Phe Ser Leu Glu Gln Leu

385 390 395 400

Gln Glu Tyr Ala Asp Ala Asp Leu Ser Val Val Glu Lys Leu Lys Glu

405 410 415

Ile Ile Ile Gln Lys Val Asp Glu Ile Tyr Lys Val Tyr Gly Ser Ser

420 425430

Glu Lys Leu Phe Asp Ala Asp Phe Val Leu Glu Lys Ser Leu Lys Lys

435 440 445

Asn Asp Ala Val Val Ala Ile Met Lys Asp Leu Leu Asp Ser Val Lys

450 455 460

Ser Phe Glu Asn Tyr Ile Lys Ala Phe Phe Gly Glu Gly Lys Glu Thr

465 470 475 480

Asn Arg Asp Glu Ser Phe Tyr Gly Asp Phe Val Leu Ala Tyr Asp Ile

485 490 495

Leu Leu Lys Val Asp His Ile Tyr Asp Ala Ile Arg Asn Tyr Val Thr

500 505 510

Gln Lys Pro Tyr Ser Lys Asp Lys Phe Lys Leu Tyr Phe Gln Asn Pro

515 520 525

Gln Phe Met Gly Gly Trp Asp Lys Asp Lys Glu Thr Asp Tyr Arg Ala

530 535 540

Thr Ile Leu Arg Tyr Gly Ser Lys Tyr Tyr Leu Ala Ile Met Asp Lys

545 550 555 560

Lys Tyr Ala Lys Cys Leu Gln Lys Ile Asp Lys Asp Asp Val Asn Gly

565 570 575

Asn Tyr Glu Lys Ile Asn Tyr Lys Leu Leu Pro Gly Pro Asn Lys Met

580 585 590

Leu Pro Lys Val Phe Phe Ser Lys Lys Trp Met Ala Tyr Tyr Asn Pro

595 600 605

Ser Glu Asp Ile Gln Lys Ile Tyr Lys Asn Gly Thr Phe Lys Lys Gly

610 615 620

Asp Met Phe Asn Leu Asn Asp Cys His Lys Leu Ile Asp Phe Phe Lys

625 630 635 640

Asp Ser Ile Ser Arg Tyr Pro Lys Trp Ser Asn Ala Tyr Asp Phe Asn

645 650 655

Phe Ser Glu Thr Glu Lys Tyr Lys Asp Ile Ala Gly Phe Tyr Arg Glu

660 665 670

Val Glu Glu Gln Gly Tyr Lys Val Ser Phe Glu Ser Ala Ser Lys Lys

675 680 685

Glu Val Asp Lys Leu Val Glu Glu Gly Lys Leu Tyr Met Phe Gln Ile

690 695 700

Tyr Asn Lys Asp Phe Ser Asp Lys Ser His Gly Thr Pro Asn Leu His

705 710 715 720

Thr Met Tyr Phe Lys Leu Leu Phe Asp Glu Asn Asn His Gly Gln Ile

725 730 735

Arg Leu Ser Gly Gly Ala Glu Leu Phe Met Arg Arg Ala Ser Leu Lys

740 745 750

Lys Glu Glu Leu Val Val His Pro Ala Asn Ser Pro Ile Ala Asn Lys

755 760 765

Asn Pro Asp Asn Pro Lys Lys Thr Thr Thr Leu Ser Tyr Asp Val Tyr

770 775 780

Lys Asp Lys Arg Phe Ser Glu Asp Gln Tyr Glu Leu His Ile Pro Ile

785 790 795 800

Ala Ile Asn Lys Cys Pro Lys Asn Ile Phe Lys Ile Asn Thr Glu Val

805 810 815

Arg Val Leu Leu Lys His Asp Asp Asn Pro Tyr Val Ile Gly Ile Asp

820 825 830

Arg Gly Glu Arg Asn Leu Leu Tyr Ile Val Val Val Asp Gly Lys Gly

835 840 845

Asn Ile Val Glu Gln Tyr Ser Leu Asn Glu Ile Ile Asn Asn Phe Asn

850 855 860

Gly Ile Arg Ile Lys Thr Asp Tyr His Ser Leu Leu Asp Lys Lys Glu

865 870 875 880

Lys Glu Arg Phe Glu Ala Arg Gln Asn Trp Thr Ser Ile Glu Asn Ile

885 890 895

Lys Glu Leu Lys Ala Gly Tyr Ile Ser Gln Val Val His Lys Ile Cys

900 905 910

Glu Leu Val Glu Lys Tyr Asp Ala Val Ile Ala Leu Glu Asp Leu Asn

915 920 925

Ser Gly Phe Lys Asn Ser Arg Val Lys Val Glu Lys Gln Val Tyr Gln

930 935 940

Lys Phe Glu Lys Met Leu Ile Asp Lys Leu Asn Tyr Met Val Asp Lys

945 950 955 960

Lys Ser Asn Pro Cys Ala Thr Gly Gly Ala Leu Lys Gly Tyr Gln Ile

965 970 975

Thr Asn Lys Phe Glu Ser Phe Lys Ser Met Ser Thr Gln Asn Gly Phe

980 985 990

Ile Phe Tyr Ile Pro Ala Trp Leu Thr Ser Lys Ile Asp Pro Ser Thr

995 1000 1005

Gly Phe Val Asn Leu Leu Lys Thr Lys Tyr Thr Ser Ile Ala Asp Ser

1010 1015 1020

Lys Lys Phe Ile Ser Ser Phe Asp Arg Ile Met Tyr Val Pro Glu Glu

1025 1030 1035 1040

Asp Leu Phe Glu Phe Ala Leu Asp Tyr Lys Asn Phe Ser Arg Thr Asp

1045 1050 1055

Ala Asp Tyr Ile Lys Lys Trp Lys Leu Tyr Ser Tyr Gly Asn Arg Ile

1060 1065 1070

Arg Ile Phe Arg Asn Pro Lys Lys Asn Asn Val Phe Asp Trp Glu Glu

1075 1080 1085

Val Cys Leu Thr Ser Ala Tyr Lys Glu Leu Phe Asn Lys Tyr Gly Ile

1090 1095 1100

Asn Tyr Gln Gln Gly Asp Ile Arg Ala Leu Leu Cys Glu Gln Ser Asp

1105 1110 1115 1120

Lys Ala Phe Tyr Ser Ser Phe Met Ala Leu Met Ser Leu Met Leu Gln

1125 1130 1135

Met Arg Asn Ser Ile Thr Gly Arg Thr Asp Val Asp Phe Leu Ile Ser

1140 1145 1150

Pro Val Lys Asn Ser Asp Gly Ile Phe Tyr Asp Ser Arg Asn Tyr Glu

1155 1160 1165

Ala Gln Glu Asn Ala Ile Leu Pro Lys Asn Ala Asp Ala Asn Gly Ala

1170 1175 1180

Tyr Asn Ile Ala Arg Lys Val Leu Trp Ala Ile Gly Gln Phe Lys Lys

1185 1190 1195 1200

Ala Glu Asp Glu Lys Leu Asp Lys Val Lys Ile Ala Ile Ser Asn Lys

1205 1210 1215

Glu Trp Leu Glu Tyr Ala Gln Thr Ser Val Lys His Lys Arg Pro Ala

1220 1225 1230

Ala Thr Lys Lys Ala Gly Gln Ala Lys Lys Lys Lys Gly Ser His His

1235 1240 1245

His His His His

1250

<210>37

<211>11

<212>DNA

<213>Artificial Sequence

<400>37

tttttgctcg g 11

<210>38

<211>11

<212>DNA

<213>Artificial Sequence

<400>38

gctgcgtttt t 11

<210>39

<211>16

<212>DNA

<213>Artificial Sequence

<400>39

aacgcagccc gagcaa 16

Claims

1. The crRNA for detecting the African swine fever virus is characterized in that the crRNA is used for guiding CRISPR-Cas12a to specifically bind to African swine fever target DNA.

2. The crRNA of claim 1, wherein the nucleotide sequence of the crRNA comprises one of SEQ ID No.1 to SEQ ID No. 30.

3. A kit for detecting african swine fever virus DNA, comprising the crRNA of claim 1 or 2, CRISPR-Cas12a and ssDNA fluorescent probe.

4. The kit of claim 3, wherein a fluorophore and a fluorescence quenching group are attached to each end of the ssDNA fluorescent probe.

5. The kit according to claim 3, wherein the ssDNA fluorescent probe has the nucleotide sequence shown as SEQ ID No. 32.

6. The kit according to claim 3, wherein the crRNA is used at a concentration of 200 to 300 nmol/L.

7. The kit according to claim 3, wherein the CRISPR-Cas12a is used at a concentration of 150-250 nmol/L.

8. The kit of claim 3, wherein the ssDNA fluorescent probe is used at a concentration of 150-250 nmol/L.

9. The kit according to claim 3, further comprising a detection buffer, wherein the detection buffer uses water as a solvent and comprises the following components in concentration: 15-25 mmol/L Tris-HCL, 80-120 mmol/L KCL, 4-6 mmol/L MgCl₂0.8-1.2 mmol/L DTT, 4-6% glycerol (volume ratio) and 45-55 mu g/ml heparin.

10. The kit of claim 3, wherein the ssDNA fluorescent probes are replaced with DNA nanogold probes, and the DNA nanogold probes modify nanogold at DNA thiol groups; the nucleotide sequence of the DNA nano-gold probe is shown in SEQ ID No. 37-39.