CN1116416C - Blue-green alga transgene by using gene integration platform system and method for expressing thymosin 'alpha'1 - Google Patents

Abstract

The present invention relates to genetic engineering. A cpc2 promoter region and integration platform homologous fragments L and R are amplified from PCR on chromosome DNA of blue algae Calothrix7601. A donor plasmid pUTK containing the components of the cpc2 promoter region, a UB Talpha1 target gene, an rbcS terminator, a Km<r> reporter gene, a genetic integration platform homologous sequence, etc. is assembled. A new genetic platform integration system of the Calothrix7601 is established to obtain a UB Talpha1 transgenic algae strain, and simultaneously, an expression product of a Talpha1 gene from the UB Talpha1 transgenic algae strain can be detected. The blue algae are used as a novel genetic engineering receptor and a bioreactor in the present invention so that the Talpha1 gene of people is efficiently expressed in the blue algae. Consequently, the Talpha1 can be produced on a large scale, and thus, the present invention has extensive development prospect.

Description

The utilization gene integration platform system carries out blue-green alga transgene and expresses extrasin alpha 1Method

(1) technical field

The present invention relates to a kind of carrier that in genetic engineering, uses.

(2) background technology

Blue-green algae (Cyanophyte) claims cyanobacteria (Cyanobacterium) again, is a kind of special microorganism.The genome of blue-green algae is simple, does not contain chloroplast(id) and Mitochondrial DNA except exposed chromosomal DNA, is convenient to carry out genetic analysis.In recent years, clone a large amount of blue-green algae genes, set up gene transfer system and the heterologous gene expression system of some blue-green algaes.Blue-green algae has been obtained many achievements in research as the recipient bacterium of expression alien gene.Tandeau de Marsac (Mol.Gen.Genet., 1987,209:296～298) to be carrier with pUC303 expressed the prokaryotic organism genus bacillus in unit cell algae Synechococcus sp.PCC7942 (be called for short Synechococcus7942, the rest may be inferred for all the other algae names) kills young mosquito toxin gene; Fukuda etc. (Biotech.Lett., 1994,16:1～6) have expressed the ethylene synthetase gene of plant in Synechococcus 7942; Takeshima (Proc.Natl.Acad.Sci USA 1994,91:9685～9689) in Synechococcus 7942, expressed synthetic people superoxide dismutase gene (h-SOD), product accounts for 3% of total protein concentration, and biological activity in the good born of the same parents is arranged; (biotechnology progress, 1994,14 (6): 39～42) in Anabaena 7120, expressed the metallothionein gene (mt-1) of mouse such as Sun Jun.These research work show that the foreign gene that comprises eukaryotic gene can express in blue-green algae.

Thymus gland (Thymus) is maincenter organ important in the immunity system, is responsible for the differentiation and the maturation of T cell, plays an important role in anti-infective, antitumor and anti-autoimmune disorder.Isolated extrasin alpha from the thymosin mixture ₁(T α ₁), be one 20 octapeptide, it can epidemic prevention suppress the patient infection conditioned pathogen, improves the cell immunocompetent of body, can be used for treating multiple disease such as lupus erythematosus, hepatitis B, acquired immune deficiency syndrome (AIDS) etc., also can be used as the ancillary drug of some cancer of treatment.Present thymosin preparation has been widely used in clinical, but all is polycomponent Zadaxin of extracting from the thymus gland of pig, ox, easily sneaks into some albumen of pig, ox during extraction, may cause the people to produce anaphylaxis after the injection.Though the human thymosin curative effect that adopts the people embryo to extract is pretty good, people's embryonic origin difficulty is difficult to form scale production.But with Peptide synthesizer synthesizing thymosins α ₁, but too expensive.(Zhejiang Medical university journal, 1989,18 (3): such as Wang Zhenxi 106～109) T α ₁Gene imports the PWR590 bacterial strain, detects T α with the SPA-ELISA improved method in the bacterial strain that transforms ₁Expression; The aminoacid sequence synthetic that Wetzel etc. (Biochemistry1980,19:6096～6104) determine according to Low and Goldstein (1979) T α ₁Gene is connected with plasmid pBR322 among the back importing E.coli and expresses, though obtain and natural T α ₁Active identical expression product, but expression amount is low.

(3) summary of the invention

Purpose of the present invention aims to provide a kind of gene integration platform system that utilizes, with extrasin alpha ₁Positioning integration is in the karyomit(e) of filamentous cyanobacteria Calothrix 7601 after gene and ubiquitin (UB) gene fusion, and starts its expression with ruddiness inductive cpc2 promotor, produces extrasin alpha to utilize transgenic technology ₁Method.

Concrete scheme performing step of the present invention is as follows:

The clone of one .cpc2 promoter region P and homologous dna fragment L and R

Contain three kinds of cpc operons in the Calothrix 7601 phycobilisome genes, wherein be subjected to ruddiness inductive Phycocyanins, C-cpc2 operon at about 5kb place, allophycocyanin apc operon downstream, comprise five gene: cpcB2, A2, H, I and D, homologous fragment L and R are chosen in respectively in the middle of cpcB2, the A2 gene.Design three couples of PCR primer P1 and P2 respectively according to the promoter region P of the cpc2 operon of filamentous cyanobacteria Calothrix 7601 and the nucleotide sequence at homologous fragment L and these three fragment two ends of R, L1 and L2, R1 and R2, its sequence is as follows:

P1 (5 ' end primer): 5 '-GC GTCGACGAATTGTAAGAA-3 '

SalI (20Nts)

P2 (3 ' end primer): 5 '-AT GCATGCTCCAGCATCTCCTA-3 '

SphI (22Nts)

L1 (5 ' end primer): 5 '-CG GAATTCTGCTATTAGTCCGC-3 '

EcoRI (22Nts)

L2 (3 ' end primer): 5 '-CG GTCGACGCCCTCGGTTAAAGGTGT-3 '

SalI (26Nts)

R1 (5 ' end primer): 5 '-CG GTCGACTGTAGCTCCTTAATGTC-3 '

SalI (25Nts)

R2 (3 ' end primer): 5 '-CCT AAGCTTTCTTGATATTCGGCTG 3 '

HindIII (25Nts)

Wherein promoter region left end primer P2 has designed a SphI restriction enzyme site, and its sequence is GCATG ↓ C.

Chromosomal DNA with Calothrix 7601 is a template, and round pcr routinely amplifies fragment P (0.6Kb) respectively, fragment L (1.2Kb) and fragment R (1.2Kb).

By design shown in Figure 1,,,, use T then respectively with HindIII and SalI while double digestion fragment R and carrier pUC19 with SphI and SalI while double digestion fragment P and carrier pUC19 according to the restriction enzyme site in the primer ₄Dna ligase connects, and connector transformation receptor bacterium E.coli JM101 obtains white clone with blue white screening, has obtained recombinant plasmid pUCP and pUCR.Press in addition Fig. 1 and design, be connected, obtained recombinant plasmid pULP with behind EcoRI and SalI double digestion fragment L and the above-mentioned recombinant plasmid pUCP.

Two. the clone of external source donor sheet segment DNA

1. reporter gene (Km ^r) and the clone of terminator (rbcS polyA)

Selection contains reporter gene (kalamycin resistance gene-Km ^r) and terminator (rbcS polyA) these two segmental plasmid pKYLX71, by design shown in Figure 2, with XbaI and SalI double digestion pKYLX71, glue reclaims the dna fragmentation of 4.8Kb, be connected with pUCR through same double digestion, connector Transformed E .coli JM101 to contain the two anti-substratum screening of Ap and Km, obtains recombinant plasmid pUKR.

2. goal gene (UBT α ₁) acquisition and clone

At first press T α ₁The sequences Design of gene following PCR primer T1, T2 and T2 ':

T1 (5 ' end fragment): 5 '-GG GCATGCAA GGATCCGACGCAGCTGTT

SphI BamHI

GACACCAGCTCCGAAATCACCACCAAAGACTTAAAGG-3’(65Nts)

T2 (3 ' end fragment): 5 '-GGGTCG ACTAGTTTTCTGCTTCTTCAAC

SpeI

AACTTCTTTTTTTTCCTTTAAGTCTTTGGTGGTGATT-3’(65Nts)

T2 ' (3 ' end primer): be 5 ' preceding 25 Nucleotide of holding of T2.

Pcr amplification obtains T α routinely ₁Fragment.With plasmid pUCUB (with synthetic UB gene clone to constructed plasmid between the SphI/BamHI site of pUC18 plasmid) is template, primer is U1 (universal primer M13/pUC ReverseSequencing Primer (48)) and U2 (universal primer M13/pUC Sequencing Primer (47)), and the PCR method amplification obtains the UB fragment routinely.Cut T α with the BamHI enzyme ₁Be connected after the UB fragment, be template with above-mentioned connector again, be that primer amplification obtains UBT α with U1 and T2 ' ₁Fragment.

By design shown in Figure 3, cut pUKR with XbaI and the incomplete enzyme of HindIII, reclaim the 6.0Kb fragment; With SphI and SpeI double digestion goal gene UBT α ₁With SphI and HindIII double digestion pULP, above three kinds of endonuclease bamhis are mixed the back connect, transform, with Ap and the two anti-screenings of Km, obtain donor plasmid pUTK.

Three, donor plasmid pUTK electricity swashs conversion Calothrix 7601

With EcoRI complete degestion pUTK, obtain wire plasmid pUTK, at voltage 0.4～2.0kv, resistance 100～200 Ω, electricity swashs conversion blue-green algae Calothrix 7601 under the condition of time 2.5～5.0ms, electric capacity 25 μ F, to with the Km screening, obtain to change UBT α through the conversion algae strain after electricity swashs processing through cultivating ₁The algae strain of gene.

The strain of conversion algae all surpasses 40 μ g/ml to the resistance of Km, reaches as high as 80 μ g/ml, and still remains unchanged substantially after the switching several times.Prove goal gene UBT α through PCR ₁Gene has been incorporated on the karyomit(e) of Calothrix 7601, can duplicate with THE REPLICATION OF CHROMOSOME; Confirm that through Western hybridization fusion rotein truly has expression.

The present invention goes out Phycocyanins, C-cpc2 promoter region, integration platform homologous fragment L and R by design pcr amplification from blue-green algae Calothrix 7601 chromosomal DNAs, has assembled to contain cpc2 promotor, UBT α ₁Goal gene, rbcS terminator, Km ^rThe donor plasmid pUTK of elements such as reporter gene and gene platform homologous sequence has set up the new gene integration platform system of Calothrix 7601, has obtained commentaries on classics UBT α ₁The algae strain of gene, and from transform the algae strain, detect T α ₁The expression of gene product.The present invention as novel transgene receptor and bio-reactor, makes extrasin alpha with blue-green algae ₁Gene is expressed therein, for T α is changeed in the mass production exploitation ₁Gene blue algae lays the foundation, and its technology is simple, and cost is low, has very big development prospect.

(4) description of drawings

Fig. 1 is recombinant plasmid pUCP, the structure schema of pULP and pUCR.

Fig. 2 is the structure schema of recombinant plasmid pUKR.

Fig. 3 is the structure schema of donor plasmid pUTK.

Fig. 4 is integrated into Calothrix 7601 karyomit(e) synoptic diagram for donor plasmid pUTK.

(5) embodiment

The invention will be further described by embodiment below.Clone's 1. each segmental pcr amplification of step 1, cpc2 promoter region P and homologous dna fragment L and R

1.1 the pcr amplification of cpc2 promoter region P (630bp)

At first according to the synthetic cpcB2A2 promoter region of known array design P primer, SalI and SphI on primer, have been designed

Restriction enzyme site.：

P1 (5 ' end primer): 5 '-GC GTCGACGAATTGTAAGAA-3 '

SalI (20Nts)

P2 (3 ' end primer): 5 '-AT GCATGCTCCAGCATCTCCTA-3 '

SphI (22Nts)

In the aseptic centrifuge tube of 0.5ml, add successively: ddH ₂O 37 μ l, 10 * Taq enzyme buffer liquid, 5 μ l,

4 * dNTP (2.5mmol/L), 4 μ l, P1 primer 1 μ l, P2 primer 1 μ l, template (blue-green algae genomic dna) 1 μ l,

Taq enzyme (1u/ μ l) 1 μ l, cumulative volume 50 μ l add paraffin oil 50 μ l at last in addition and cover.

The PCR reaction parameter is provided with: 94 ℃ of pre-sex change, 5min;

94 ℃ of sex change then, 45S; 50 ℃ of renaturation, 45S; 72 ℃ of extensions, 45S; 30 circulations

Last 72 ℃ of extensions, 5min.

After reaction finishes, get 5 μ l and carry out 1% agarose gel electrophoresis evaluation, on electrophoretogram, occur unique

Article one, meet the 0.6Kb fragment of expection size, show that this amplified fragments is exactly a desired promoter region fragment.

1.2 the pcr amplification of homologous fragment L (1.2Kb)

Design cpc2 left side homologous region (L) primer equally, also designed SalI and EcoRI site respectively:

L1 (5 ' end): 5 '-CG GAATTCTGCTATTAGTCCGC-3 '

EcoRI (22Nts)

L2 (3 ' end): 5 '-CG GTCGACGCCCTCGGTTAAAGGTGT-3 '

SalI (26Nts)

Remove primer and change L1 into, L2, the extension time changes into outside the 75S, and all the other occur unique on electrophoretogram all with 1.1

A 1.2Kb fragment that meets expection size, show that this amplified fragments is exactly desired L fragment.

1.3 the pcr amplification of homologous fragment R (1.2Kb)

Design cpc2 right side homologous region (R) primer equally, also designed SalI and HindIII site respectively:

R1 (5 ' end): 5 '-CG GTCGACTGTAGCTCCTTAATGTC-3 '

SalI (25Nts)

R2 (3 ' end): 5 '-CCT AAGCTTTCTTGATATTCGGCTG 3 '

HindIII (25Nts)

Remove primer and change R1 into, outside the R2, all the other are all with 1.2.A unique 1.2Kb fragment that meets the expection size on electrophoretogram, occurs, show that this amplified fragments is exactly desired R fragment.2. the clone of each fragment PCR products

2.1 from sepharose, reclaim dna fragmentation

The PCR product under ultraviolet lamp, downcuts and contains the segmental gel of required DNA size behind agarose gel electrophoresis,

Reclaim test kit with glue and reclaim dna fragmentation ,-20 ℃ of preservations are standby.2.2 the connection of PCR product and conversion

(1) according to the restriction enzyme site of PCR fragment two ends design, carries out the segmental double digestion of PCR, with carrying of same double digestion

Body (as the pUC19 plasmid) mixes, and adds T ₄12 ℃ of connections of dna ligase are spent the night.

Wherein press Fig. 1 design, according to the restriction enzyme site in the primer, with SphI and SalI while double digestion fragment P

With carrier pUC19,, use T then respectively with HindIII and SalI while double digestion fragment R and carrier pUC19 ₄

Dna ligase connects, connector transformation receptor bacterium E.coli JM101.Press in addition Fig. 1 design, with EcoRI with

SalI double digestion fragment L has the segmental plasmid of P to be connected with above-mentioned reorganization, transforms.

(2) (adopt CaCl at 200 μ l competent cells ₂The method preparation) adds the DNA that 5 μ l connect, mixing, ice bath 30min in.

(3) 42 ℃ of water-bath 2min, ice bath 2min adds 800 μ l LB liquid nutrient mediums, 37 ℃ of jog 1hr again.

(4) get 200 μ l and place another pipe, add 4 μ l IPTG (200mg/ml) and 40 μ l X-gal (20mg/ml), mix

Even back coating LB flat board (containing Ap 100 μ g/ml) is cultivated about 10hr for 37 ℃.2.3 the screening of recon and evaluation

(1) by blue white screening, tentatively chooses some white colonies, be inoculated in 4ml LB (containing Ap 100 μ g/ml) liquid culture

In the base, 37 ℃ of shaking culture are spent the night.

(2) extract in a small amount plasmid and carry out enzyme and cut evaluation, the result obtained respectively expection recombinant plasmid pUCP, pUCR and

pULP。PUCP can be become the 3.3Kb fragment by the SalI single endonuclease digestion, is become 2.7Kb and 0.6Kb by SphI with the SalI double digestion

Two fragments.PUCR can be become by SalI or PstI (PstI has only single restriction enzyme site in fragment R) single endonuclease digestion

3.9Kb fragment is become two fragments of 2.7Kb and 1.2Kb by HindIII with the SalI double digestion.PULP can be by SalI

Single endonuclease digestion becomes the 3.9Kb fragment, is become two fragments of 2.7Kb and 1.2Kb with the SalI double digestion by EcoRI.Distinguish again

With recombinant plasmid pUCP, pUCR, pULP is template amplification fragment P, R and L, and the result has also obtained expection

The fragment of length scale.Show from above experimental result and to contain cpc2 gene promoter district (P) and homologous dna fragment

Clone's of L and R successfully obtains.The clone 1. reporter gene (kantlex-Km of step 2, external source donor sheet segment DNA ^r) and the clone of terminator (rbcS polyA)

Plasmid pKYLX71 contains this two fragments.Press Fig. 2 design, with XbaI and SalI double digestion pKYLX71, glue reclaims the dna fragmentation of 4.8Kb, mixes with the pUCR of the same double digestion of warp, adds T ₄12 ℃ of connections of dna ligase are spent the night, and connector Transformed E .coli JM101 to contain the two anti-substratum screening of Ap and Km, obtains some clone's.Extract its plasmid respectively and carry out enzyme and cut evaluation, the result has obtained the recombinant plasmid pUKR of the 8.7kb of expection.It can be become the 8.7kb fragment by the SalI single endonuclease digestion, is cut into 6.3Kb and 2.4Kb fragment by HindIII, is cut into 5.3Kb and 3.4Kb fragment by XbaI.2. goal gene (UBT α ₁) acquisition and clone 2.1 extrasin alphas ₁(T α ₁) pcr amplification of gene (110bp):

At first press T α ₁The sequences Design of gene PCR primer T1, T2 and T2 ':

T1 (5 ' end fragment): 5 '-GG GCATGCAA GGATCCGACGCAGCTGTT

SphI BamHI

GACACCAGCTCCGAAATCACCACCAAAGACTTAAAGG-3’(65Nts)

T2 (3 ' end fragment): 5 '-GGGTCG ACTAGTTTTCTGCTTCTTCAAC

SpeI

AACTTCTTTTTTTTCCTTTAAGTCTTTGGTGGTGATT-3’(65Nts)

T2 ' (3 ' end primer): be 5 ' preceding 25 Nucleotide of holding of T2.

Get each 2 μ l of T1 and T2 primer, add ddH ₂O to 10 μ l adds paraffin oil 30 μ l again; Rise to 85 ℃ earlier, 5min

Speed with 1 ℃/1min is cooled to 25 ℃ then; Add successively again: ddH ₂O 30 μ l, 10 * Taq enzyme buffer liquid, 5 μ l

4 * dNTP (2.5mmol/L), 4 μ l, Taq enzyme (1u/ μ l) 1 μ l

PCR reaction parameter: 94 ℃ of pre-sex change 5min of elder generation; Follow 94 ℃ of sex change 30S; 60 ℃ of renaturation are held concurrently and are extended 20S;

10 circulations; Last 60 ℃ of extension 20S again.

After reaction finishes, get 3 μ l and carry out the evaluation of 2% agarose gel electrophoresis, obtain the T α of 110bp ₁Fragment.2.2 the pcr amplification of UB fragment (345bp):

With plasmid pUCUB (by the synthetic UB gene of Dalian Bao Bio-Engineering Company and be cloned into constructed plasmid between the SphI/BamHI site of pUC18 plasmid) is template, primer is U1 (universal primer M13/pUC ReverseSequencing Primer (48)) and U2 (universal primer M13/pUC Sequencing Primer (47)), and the remaining reaction component is with 2.1;

PCR reaction parameter: 94 ℃ of pre-sex change 5min of elder generation;

94 ℃ of sex change 30S; 50 ℃ of renaturation 30S; 72 ℃ are extended 30S; 30 circulations

Last 72 ℃ of extension 3min again.

After reaction finishes, get 5 μ l and carry out the evaluation of 2% agarose gel electrophoresis, obtain the UB fragment of 345bp.2.3 UBT α ₁The PCR and the clone of fragment (388bp):

Cut T α with the BamHI enzyme ₁Be connected after the UB fragment, be template with above-mentioned connector again, be that primer amplification obtains UBT α with U1 and T2 ' ₁Fragment.

UBT α 1 segmental PCR reaction, template is UB and T α ₁Connector, primer is U1 and T2 ', remaining reaction component and reaction parameter are with 2.2.

According to Fig. 3 design, cut pUKR with XbaI and the incomplete enzyme of HindIII, reclaim the 6.0Kb fragment, wherein comprise terminator, Km screening reporter gene and integrate homologous fragment R; With SphI and SpeI double digestion goal gene UB-T α ₁With SphI and HindIII double digestion pULP.Above three kinds of endonuclease bamhis are mixed the back connect, conversion, with Ap and the two anti-screenings of Km, the some transformants of picking extract plasmid and carry out the restriction analysis evaluation, have successfully obtained the donor plasmid pUTK of expection.It can be become the 10.8Kb fragment by XbaI enzyme cutting, is cut into 8.3Kb and 2.5Kb fragment by the HindIII enzyme, is cut into 5.7Kb and 5.1Kb fragment by the SalI enzyme.Step 3, donor plasmid pUTK electricity swash conversion Calothrix 7601

Transform Calothrix 7601 with the wire pUTK through EcoRI (plasmid pUTK goes up this enzyme site and is positioned at homology segment L and pUC19 segment junction) complete degestion gained, establish two contrasts, contrast 1 is blank, does not promptly contain the conversion of plasmid, and contrast 2 is apparatus Km ^rThe conversion of the plasmid pKYLX71 of gene.

At first cultivate blue-green algae to A ₅₅₀About=0.6.Get the centrifugal 3ml of being condensed into of 100ml algae liquid, supersound process 30s (power 3).Centrifugal collection frustule, twice of 1.0mmol/L HEPES (pH7.2) the damping fluid centrifuge washing of usefulness precooling.Frustule is suspended in 1.0mmol/L HEPES (pH7.2) damping fluid of precooling.Add DNA to final concentration be 10 μ g/ml.Get the frustule suspension that 40 μ l contain DNA, the aseptic disposable electricity that joins precooling swashs in the cup (specification 1mm).Preset each parameter (referring to table 1) of electric exciter, load onto electricity and swash cup, electricity swashs.

Table 1 electricity swashs parameter (positive and negative control only uses two kinds of conditions of C, H)

Sample number into spectrum	A	B	C	D	E	F	G	H	I	J
											Voltage (kv)	0.4	0.8	1.2	1.6	2.0	0.4	0.8	1.2	1.6	2.0
Resistance (Ω)	100					200
											Time (ms)	2.5					5.0
Electric capacity (μ F)	25

The frustule suspension that electricity is swashed after handling changes cultivation in the 20ml BG-11 liquid nutrient medium (containing Km 20 μ g/ml) immediately over to, replenishes 4 μ g/ml Km every day, to replenish the Km that natural decomposition is fallen in the culturing process.Often shake, cultivated 10 days.Choose well-grown three bottles of algae liquid, each draws 100 μ l algae liquid, is coated on the BG-11 flat board (to contain 1.5% agar, Km 20 μ g/ml), cultivates 10 days.It is sub to choose 5 best clones of growth, changes in the 20ml BG-11 liquid nutrient medium (to contain Km20 μ g/ml), often shakes, and cultivates 10 days.From clone algae strain nutrient solution, respectively draw 1ml algae liquid, join respectively in the 20ml BG-11 liquid nutrient medium that contains different concns Km (being respectively 5,10,20,30,40,50,60,70,80 μ g/ml), often shake, cultivated 10 days.According to upgrowth situation, judge the maximum concentration of respectively cloning the anti-Km of algae strain.Choose the highest clone's of resistance and carry out relatively large cultivation (200ml).Transferring once every 10 days, the guarantor plants.

Choosing is cloned in the sub Km resistance experiment in screening of cloning son and mensuration, and respectively the sub upgrowth situation under different K m concentration of clone differs, and the result shows that five maximum concentrations of cloning the anti-Km of algae strain that supply examination can reach 80 μ g/ml, and minimum concentration also has 40 μ g/ml; And the concentration of the anti-Km of control group algae strain is lower than 5 μ g/ml, and is consistent with the basic resistance of Calothrix 7601.Experimental result shows to have only the blue-green algae that transforms with pUTK clone's of anti-Km to occur, and clone's does not all appear in two contrasts in addition.Though pKYLX71 contains Km ^rGene, but do not possess the initial replicon of blue-green algae plasmid, so can not in blue-green algae, duplicate.Although pUTK does not have the initial replicon of blue-green algae plasmid yet, clone's of anti-Km has appearred, and this shows and contains Km ^rThe donor dna fragment of gene has been incorporated on the karyomit(e) of Calothrix 7601, duplicates with THE REPLICATION OF CHROMOSOME, and gives expression to the Km resistance.

For the whether success of the transgenosis of verifying blue-green algae, we carry out the PCR evaluation to transforming the algae strain, extract the chromosomal DNA of wild algae strain and conversion algae strain 2 respectively, with it is template, with P1 and T2 ' is primer amplification, and the former takes out of now at nothing as a result, and single band appears in the latter, the about 0.9Kb of its length, this result meet cpc2 promotor (P) and foreign gene to be expressed (UBT α ₁) the length sum, tentatively prove P-UBT α ₁Gene has been incorporated on the karyomit(e) of Calothrix 7601.

For further proving the UBT α that is integrated ₁Gene energy effective expression adopts Western hybridization to identify that first antibody adopts T α ₁Antibody.Detection of expression at first will be induced blue-green algae Calothrix 7601, when Calothrix 7601 cultivates A ₅₅₀During=0.8 left and right sides, get 10ml and in ruddiness, handle 30min.Then want sample preparation and electrophoresis detection, the centrifuging and taking frond places a pipe of weighing in advance, and it is heavy to weigh up algae, adds the sample preparation damping fluid of 1 times of amount (V/W) and the sample-loading buffer of 1 times of amount (V/W), and boiling water bath 5min is centrifugal, gets supernatant liquor, and it is standby to put-20 ℃ of preservations.The expression amount of test sample can carry out with SDS-PAGE (SDS-polyacrylamide gel electrophoresis) method:

(1) glue: 15% separation gel, 5% concentrates glue

(2) electrophoresis: will add to behind the sample boiling water bath 3min in the gel point sample hole,, treat that bromjophenol blue runs out of dense earlier with 50V voltage electrophoresis

Contract behind the glue, voltage is increased to 100V, when bromjophenol blue runs to the gel edge, stop electrophoresis.

Electrotransfer (seal stain): take out glue earlier, being soaked in electricity changes in the damping fluid.The pvdf membrane that clip and gel etc. are big, earlier wetting in anhydrous methanol, change in the damping fluid at electricity again and soak; Other cut six with big filter paper such as film, being dipped in electricity changes in the damping fluid; Sponge in the electroporation also is dipped in electricity to be changeed in the damping fluid.Sponge, filter paper (3), gel, film, filter paper (3), sponge are put well in order, note avoiding bubble, boundary alignment is fixed with sieve tray then, inserts in the electrotransfer groove, and gel is at cathode direction, and film is in anode direction.Adding electricity changes damping fluid, and 4 ℃, 100V shifts 1hr.

Immunology detection: place the TNT damping fluid to wash 3 times film earlier, each 5min.Change in the confining liquid 37 ℃ of jog 30min over to.Put in the TNT damping fluid rinsing 3 times, each 5min.Add T α with the dilution of TNT damping fluid ₁Antibody, 37 ℃ of jog 1hr.Put in the TNT damping fluid rinsing 3 times, each 5min.Add goat anti-rabbit igg-HRP, 37 ℃ of jog 1hr with the dilution of TNT damping fluid.Put in the TNT damping fluid rinsing 4 times, each 5min.Add tmb substrate liquid, colour developing 15min, it is positive blue band person to occur, and water washes with termination reaction, and taking-up is dried, and takes pictures.

Shift as stated above, hybridize and develop the color, the result shows that transforming the algae strain has occurred and positive control (T α ₁) the much the same band in position, illustrate that transforming the algae strain truly has and give expression to T α ₁Albumen.

Claims (1)

1. the utilization gene integration platform system carries out blue-green alga transgene and expresses extrasin alpha ₁Method, it is characterized in that going out Phycocyanins, C-cpc2 promoter region, integration platform homologous fragment L and R by design pcr amplification from blue-green algae Calothrix 7601 chromosomal DNAs, assembled and contained cpc2 promotor, UBT α ₁Goal gene, rbcS terminator, Km ^rThe donor plasmid pUTK of reporter gene and gene platform homologous sequence element has set up the new gene integration platform system of Calothrix 7601, has obtained commentaries on classics UBT α ₁The algae strain of gene, its concrete grammar step is as follows:

(1) clone of cpc2 promoter region P and homologous dna fragment L and R

Homologous fragment L and R are chosen in respectively in the middle of the cpcB2, A2 gene of cpc2 operon.Design three couples of PCR primer P1 and P2 respectively according to the promoter region P of the cpc2 operon of filamentous cyanobacteria Calothrix7601 and the nucleotide sequence at homologous fragment L and these three fragment two ends of R, L1 and L2, R1 and R2, its sequence is as follows:

P1 (5 ' end primer): 5 '-GC GTCGACGAATTGTAAGAA-3 '

SalI

P2 (3 ' end primer): 5 '-AT GCATGCTCCAGCATCTCCTA-3 '

SphI

L1 (5 ' end primer): 5 '-CG GAATTCTGCTATTAGTCCGC-3 '

EcoRI

L2 (3 ' end primer): 5 '-CG GTCGACGCCCTCGGTTAAAGGTGT-3 '

SalI

R1 (5 ' end): 5 '-CG GTCGACTGTAGCTCCTTAATGTC-3 '

SalI

R2 (3 ' end): 5 '-CCT AAGCTTTCTTGATATTCGGCTG-3 '

HindIII

Wherein promoter region left end primer P2 has designed a SphI restriction enzyme site, and its sequence is GCATG ↓ C, is template with the chromosomal DNA of Calothrix7601, and round pcr routinely amplifies 0.6kb fragment P respectively, 1.2kb fragment L and 1.2kb fragment R; According to the restriction enzyme site in the primer,, use T then with SphI and SalI while double digestion fragment P and carrier pUC19 ₄Dna ligase connects, and connector transformation receptor bacterium E.coli JM101 obtains white clone with blue screening in vain, gets recombinant plasmid pUCP; With HindIII and SalI while double digestion fragment R and carrier pUC19, use T then ₄Dna ligase connects, and connector transformation receptor bacterium E.coli JM101 obtains white clone with blue screening in vain, gets recombinant plasmid pUCR; Behind EcoRI and SalI double digestion fragment L and recombinant plasmid pUCP, use T ₄Dna ligase connects, and connector transformation receptor bacterium E.coli JM101 obtains white clone with blue screening in vain, gets recombinant plasmid pULP;

(2) clone of external source donor sheet segment DNA:

A. kantlex-Km ^rThe clone of reporter gene and rbcS polyA terminator:

Selection contains reporter gene kantlex-Km ^rWith two segmental plasmid pKYLX71 of terminator rbcS polyA, with XbaI and SalI double digestion pKYLX71, glue reclaims the dna fragmentation of 4.8Kb, be connected with recombinant plasmid pUCR through same double digestion, connector Transformed E .coli JM101, to contain the two anti-substratum screening of Ap and Km, obtained the recombinant plasmid pUKR of 8.7kb;

B. goal gene UBT α ₁Acquisition and clone:

Press T α ₁The sequences Design of gene following PCR primer T1, T2 and T2 ':

T1 (5 ' end fragment): 5 '-GG GCATGCAA GGATCCGACGCAGCTGTT

SphI BamHI

GACACCAGCTCCGAAATCACCACCAAAGACTTAAAGG-3’(65Nts)

T2 (3 ' end fragment): 5 '-GGGTCG ACTAGTTTTCTGCTTCTTCAAC

SpeI

AACTTCTTTTTTTTCCTTTAAGTCTTTGGTGGTGATT-3 (65Nts)

T2 ' (3 ' end primer): be 5 ' preceding 25 Nucleotide of holding of T2

With T1 and T2 is primer, and pcr amplification gets T α routinely ₁Fragment is a template with plasmid pUCUB, and primer is U1 and U2, and pcr amplification goes out the UB fragment, cuts T α with the BamHI enzyme ₁Be connected after the UB fragment, be template with this connector again, be that primer amplification obtains UBT α with U1 and T2 ' ₁Fragment.Cut pUKR with XbaI and the incomplete enzyme of HindIII, reclaim the 6.0Kb fragment, with SphI and SpeI double digestion goal gene UBT α ₁With SphI and HindIII double digestion pULP; Above three kinds of endonuclease bamhis are mixed the back connect, transform,, obtained donor plasmid pUTK with Ap and the two anti-screenings of Km;

(3) donor plasmid pUTK electricity swashs conversion Calothrix 7601

With EcoRI complete degestion pUTK, obtain wire plasmid pUTK, at voltage 0.4～2.0kv, resistance 100～200 Ω, electricity swashs conversion blue-green algae Calothrix 7601 under the condition of time 2.5～5.0ms, electric capacity 25 μ F, to with the Km screening, obtain to change UBT α through the conversion algae strain after electricity swashs processing through cultivating ₁The algae strain of gene.

Images