CN111635461A - ACE2-Albumin recombinant protein and preparation method and application thereof - Google Patents

ACE2-Albumin recombinant protein and preparation method and application thereof Download PDF

Info

Publication number
CN111635461A
CN111635461A CN202010375623.2A CN202010375623A CN111635461A CN 111635461 A CN111635461 A CN 111635461A CN 202010375623 A CN202010375623 A CN 202010375623A CN 111635461 A CN111635461 A CN 111635461A
Authority
CN
China
Prior art keywords
ace2
leu
albumin
glu
ala
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Pending
Application number
CN202010375623.2A
Other languages
Chinese (zh)
Inventor
盛剑鹏
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Qianyuan Kangan Suzhou Biotechnology Co ltd
Original Assignee
Qianyuan Kangan Suzhou Biotechnology Co ltd
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Qianyuan Kangan Suzhou Biotechnology Co ltd filed Critical Qianyuan Kangan Suzhou Biotechnology Co ltd
Priority to CN202010375623.2A priority Critical patent/CN111635461A/en
Publication of CN111635461A publication Critical patent/CN111635461A/en
Pending legal-status Critical Current

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/14—Hydrolases (3)
    • C12N9/48—Hydrolases (3) acting on peptide bonds (3.4)
    • C12N9/485—Exopeptidases (3.4.11-3.4.19)
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K47/00—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient
    • A61K47/50—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates
    • A61K47/51—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent
    • A61K47/62—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being a protein, peptide or polyamino acid
    • A61K47/64—Drug-peptide, drug-protein or drug-polyamino acid conjugates, i.e. the modifying agent being a peptide, protein or polyamino acid which is covalently bonded or complexed to a therapeutically active agent
    • A61K47/643—Albumins, e.g. HSA, BSA, ovalbumin or a Keyhole Limpet Hemocyanin [KHL]
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
    • A61P31/12—Antivirals
    • A61P31/14—Antivirals for RNA viruses
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/85—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Y—ENZYMES
    • C12Y304/00—Hydrolases acting on peptide bonds, i.e. peptidases (3.4)
    • C12Y304/17—Metallocarboxypeptidases (3.4.17)
    • C12Y304/17023—Angiotensin-converting enzyme 2 (3.4.17.23)
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N15/00—Investigating characteristics of particles; Investigating permeability, pore-volume or surface-area of porous materials
    • G01N15/10—Investigating individual particles
    • G01N15/14—Optical investigation techniques, e.g. flow cytometry
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2319/00—Fusion polypeptide
    • C07K2319/31—Fusion polypeptide fusions, other than Fc, for prolonged plasma life, e.g. albumin
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2800/00—Nucleic acids vectors
    • C12N2800/10—Plasmid DNA
    • C12N2800/106—Plasmid DNA for vertebrates
    • C12N2800/107—Plasmid DNA for vertebrates for mammalian
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N15/00—Investigating characteristics of particles; Investigating permeability, pore-volume or surface-area of porous materials
    • G01N15/10—Investigating individual particles
    • G01N15/14—Optical investigation techniques, e.g. flow cytometry
    • G01N15/149—Optical investigation techniques, e.g. flow cytometry specially adapted for sorting particles, e.g. by their size or optical properties
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N15/00—Investigating characteristics of particles; Investigating permeability, pore-volume or surface-area of porous materials
    • G01N15/10—Investigating individual particles
    • G01N15/14—Optical investigation techniques, e.g. flow cytometry
    • G01N15/1468—Optical investigation techniques, e.g. flow cytometry with spatial resolution of the texture or inner structure of the particle
    • G01N2015/1472—Optical investigation techniques, e.g. flow cytometry with spatial resolution of the texture or inner structure of the particle with colour

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Genetics & Genomics (AREA)
  • Organic Chemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Molecular Biology (AREA)
  • General Engineering & Computer Science (AREA)
  • Biochemistry (AREA)
  • Biotechnology (AREA)
  • Biomedical Technology (AREA)
  • Medicinal Chemistry (AREA)
  • Veterinary Medicine (AREA)
  • Physics & Mathematics (AREA)
  • Public Health (AREA)
  • Animal Behavior & Ethology (AREA)
  • Virology (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Microbiology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Plant Pathology (AREA)
  • Biophysics (AREA)
  • Dispersion Chemistry (AREA)
  • Analytical Chemistry (AREA)
  • General Physics & Mathematics (AREA)
  • Immunology (AREA)
  • Pathology (AREA)
  • Epidemiology (AREA)
  • Communicable Diseases (AREA)
  • Oncology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Vascular Medicine (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)

Abstract

The invention discloses an ACE2-Albumin recombinant protein and a preparation method and application thereof, aiming at the defect of short half-life period in vivo of the existing ACE2 protein, the ACE2 protein and the Albumin protein are subjected to fusion design, so that the stability of the ACE2 protein in vivo is greatly improved, the half-life period of the ACE2 protein is prolonged, and the phenomenon of antibody dependence enhancement is avoided; furthermore, the invention constructs a production vector of the ACE2-Albumin recombinant protein and provides a high-efficiency method for cloning, screening and transfecting cells; the invention also provides a method for efficiently expressing and purifying the ACE2-Albumin recombinant protein in cells; preferably, the invention also provides an application method of the ACE2-Albumin recombinant protein for detecting coronavirus.

Description

ACE2-Albumin recombinant protein and preparation method and application thereof
Technical Field
The invention belongs to the technical field of biology, and particularly relates to human ACE2-Albumin recombinant protein, a method for designing and manufacturing ACE2-Albumin and application of the ACE2-Albumin recombinant protein.
Technical Field
ACE2 is also known as achh and is known as angiotensin converting enzyme 2. The protein coded by the gene belongs to an angiotensin converting enzyme family of dipeptidyl carboxyl dipeptidase and has considerable homology with human angiotensin converting enzyme 1. This secreted protein catalyzes the cleavage of angiotensin I to angiotensin 1-9 and angiotensin II to the vasodilator angiotensin 1-7. ACE2 has strong affinity for Ang type II type 1 and type 2 receptors, and regulates blood pressure, fluid balance, inflammation, cell proliferation, hypertrophy, and fibrosis. Meanwhile, the specific expression of organs and cells of the gene suggests that the gene may play a role in regulating cardiovascular and renal functions and fertility. Furthermore, the gene coding protein is a functional receptor of S glycoprotein of coronavirus such as SARS-CoV-2, SARS and HCoV-NL63, and is a surface receptor for coronavirus entering host cells. Therefore, exogenous recombinant ACE2 can be used to bind to viral S glycoprotein for detection of the virus or to reduce binding of the virus to a host cell, thereby reducing or blocking infection of the host cell by the virus.
However, the half-life of the ACE2 protein in vivo is very short, which greatly limits the practical application of the ACE2 protein.
The existing method for improving the in vivo existence time of the ACE2 protein is to link ACE2 with an Antibody Fc segment, but express an Antibody Fc segment receptor on the surfaces of macrophages and B cells in vivo, if a recombinant ACE2-Fc protein is manufactured, viruses are combined with an ACE2 end, and the Fc end of the ACE2-Fc2 recombinant protein is combined with the macrophages and the B cells to carry out endocytosis, so that the viruses are mediated to enter host cells through the Fc segment receptor, and an Antibody-dependent enhancement reaction (ADE) is generated, so that more viruses enter the host cells.
Another approach to increase the in vivo lifespan of ACE2 protein is to PEG the ACE2 protein, but the ACE2 protein has many glycosylation sites, and after pegylation, it may affect the structure of ACE2 itself.
Disclosure of Invention
The invention aims to overcome the defects of the prior art, provides a design and preparation method of a long-acting ACE2-Albumin recombinant protein, prolongs the half-life of an ACE2 protein, avoids the phenomenon of antibody dependence enhancement, and has potential application value for detection and treatment of coronavirus.
In order to achieve the purpose, the technical scheme provided by the invention is as follows:
an ACE2-Albumin recombinant protein, which is characterized in that the recombinant protein contains active structures of both an ACE2 protein and an Albumin protein.
Further, the ACE2-Albumin recombinant protein contains partial or all amino acid sequences in SEQ ID NO.9 and SEQ ID NO. 10.
Further, the N terminal of the SEQ ID NO.10 is connected to the C terminal of the SEQ ID NO. 9.
Furthermore, the amino acid sequence of the ACE2-Albumin recombinant protein is shown as SEQ ID NO. 11.
Further, a nucleotide sequence encoding the ACE2-Albumin recombinant protein.
Further, a method for constructing a production vector for expressing the ACE2-Albumin recombinant protein comprises the following steps:
(1) taking ACE2 cDNA as a template, and carrying out PCR by using a forward primer with a sequence shown as SEQ ID NO.1 and a reverse primer with a sequence shown as SEQ ID NO.2 to amplify a gene fragment ACE2 with a sequence shown as SEQ ID NO. 3;
(2) taking Albumin cDNA as a template, and carrying out PCR by using a forward primer with a sequence shown as SEQ ID NO.4 and a reverse primer with a sequence shown as SEQ ID NO.5 to amplify a gene fragment Albumin with a sequence shown as SEQ ID NO. 6;
(3) taking the gene fragment ACE2 and albubin obtained in the steps 1 and 2 as templates, and carrying out overlapPCR by using a forward primer with a sequence shown as SEQ ID NO.1 and a reverse primer with a sequence shown as SEQ ID NO.5 to obtain a fusion gene fragment ACE 2-albubin with a sequence shown as SEQ ID NO. 7;
(4) and (3) cloning the target gene fragment ACE2-Albumin obtained in the step (3) to a vector by enzyme digestion to obtain a production vector of ACE2-Albumin recombinant protein.
Further, according to the construction method of the production vector for expressing the ACE2-Albumin recombinant protein, the restriction enzyme cutting sites are XhoI and NotI, the cloning vector is pMyc-IRES-GFP, the production vector of the obtained ACE2-Albumin recombinant protein is pMyc-ACE2-Albumin-IRES-GFP, and the sequence of the production vector is shown as SEQ ID NO. 8.
Further, the method for expressing the ACE2-Albumin recombinant protein by using the production vector of the ACE2-Albumin recombinant protein comprises the following steps:
(1) culturing the cells;
(2) transfecting the obtained production vector of the ACE2-Albumin recombinant protein to the cells;
(3) culturing the transfected cells and recovering the ACE2-Albumin recombinant protein.
Further, the method for preparing the ACE2-Albumin recombinant protein is characterized in that the cells are eukaryotic or prokaryotic cells, including but not limited to FreeStyle 293-F.
Further, the purification method of the ACE2-Albumin recombinant protein is as follows:
(1) purifying ACE2-Albumin recombinant protein by using Ni-NTA Superflow Resin;
(2) the concentration of ACE2-Albumin recombinant protein was determined using NanoDrop and adjusted to 2 mg/mL.
Further, the ACE2-Albumin recombinant protein is used for preparing a kit or a medicament for detecting and treating coronavirus.
Further, the detection of the new coronavirus infection Vero-E6 cells by using the ACE2-Albumin comprises the following steps: :
(1) infecting Vero-E6 cells by using fluorescent new corona pseudovirus;
(2) sorting new coronaviruses to infect Vero-E6 cells by a flow sorter and culturing to establish a cell line;
(3) incubating Vero-E6 cells infected by the fluorescent new corona pseudovirus with ACE 2-Albumin;
(4) and detecting the binding condition of the ACE2-Albumin recombinant protein by using a flow cytometer.
By combining the scheme, the invention provides the ACE2-Albumin recombinant protein and the preparation method and the application thereof, and the ACE2-Albumin recombinant protein has the following beneficial effects:
(1) the invention designs the ACE2-Albumin recombinant protein, greatly improves the stability of the ACE2 protein in vivo, prolongs the half-life period of the ACE2 protein, avoids the phenomenon of antibody dependence enhancement and establishes a good foundation for the ACE2-Albumin in subsequent scientific research and production;
(2) the invention constructs the production vector of the ACE2-Albumin recombinant protein and provides a high-efficiency method for cloning, screening and transfecting cells;
(3) the invention provides a method for efficiently expressing and purifying the ACE2-Albumin recombinant protein in cells.
(4) The invention provides an application method of the ACE2-Albumin recombinant protein for detecting coronavirus.
Drawings
FIG. 1: the invention constructs a process schematic diagram for producing a vector plasmid;
FIG. 2 is a drawing: plasmid structure schematic of empty vector pMyc-IRES-GFP carrying IRES-GFP;
FIG. 3: plasmid structure schematic diagram of the production vector pMyc-ACE 2-Albumin-IRES-GFP;
FIG. 4 is a drawing: detecting the fluorescent new corona pseudovirus infected Vero-E6 cell;
FIG. 5: detecting the condition that the ACE2-Albumin recombinant protein is combined with coronavirus S protein in a Vero-E6 cell by a flow cytometer;
Detailed Description
Reference will now be made in detail to embodiments of the present invention, examples of which are illustrated in the accompanying drawings, wherein like or similar reference numerals refer to the same or similar elements or elements having the same or similar function throughout. The embodiments described below with reference to the drawings are illustrative and intended to be illustrative of the invention and are not to be construed as limiting the invention.
Example 1
The overall flow of the construction of the production carrier of ACE2-Albumin is shown in the attached figure 1.
Human ACE2 and Albumin gene sequences, ACE2(Genbank No: NM-001371415.1) and Albumin (Genbank No: NM-000477.7) were retrieved and downloaded from genome.
Performing PCR amplification to obtain a target gene fragment ACE 2: using intestinal cDNA as template
Forward primer
ACE2-5HA-F(XhoI)-ACCACCCCTCGAGATGGCCTTGACCTTTGCTTTACTGGTGGCCCTCCTGGTGCTCAGCTGCAAGTCAAGCTGCTCTGTGGGCCAGTCCACCATTGAGGAACAGGCC(SEQ ID NO.1)，
The reverse primer ACE2-5HA-R-TCTTGTGTGCAAACTCTAGGCTGTTGTCATTC (SEQ ID NO.2) is used for PCR amplification of an ACE2 fragment. Underlined sequences are the restriction sites.
And (3) carrying out PCR amplification to obtain a target gene fragment Albumin: liver cDNA is taken as a template, a forward primer Albumin-5HA-F-CCTAGAGTTTGCACACAAGAGTGAGGTTGCTC (SEQ ID NO.4) is utilized,
reverse primer
Albumin-5HA-R(NotI)-ACCACCGCGGCCGCTTAATGGTGATGGTGATGATGCATCATCACCATCACCATTAAAG (SEQ ID NO.5) was used for PCR amplification of the Albumin fragment. Underlined sequences are the restriction sites.
The PCR reaction system is as follows:
Figure BDA0002479778700000031
the PCR amplification conditions were as follows:
Figure BDA0002479778700000041
after separating the target gene fragment ACE2 and Albumin PCR products by agarose Gel electrophoresis, target bands are cut out respectively and recovered by AxyPrep DNA Gel Extraction Kit (Axygen).
Using forward primers
ACE2-5HA-F(XhoI)-ACCACCCCTCGAGATGGCCTTGACCTTTGCTTTACTGGTGGCCCTCCTGGTGCTCAGCTGCAAGTCAAGCTGCTCTGTGGGCCAGTCCACCATTGAGGAACAGGCC(SEQ ID NO.1)，
Reverse primer
Albumin-5HA-R(NotI)-ACCACCGCGGCCGCTTAATGGTGATGGTGATGATGCATCATC (SEQ ID NO. 5); taking ACE2 and Albumin PCR gene fragments as templates, performing Overlap PCR to synthesize a fusion gene fragment ACE2-Albumin (SEQ ID NO.10), and specifically comprising the following steps:
the Overlap PCR reaction system is as follows:
Figure BDA0002479778700000042
the conditions for the Overlap PCR amplification are as follows
Figure BDA0002479778700000043
Cloning the target gene fragment ACE2-Albumin into an empty vector pMyc-IRES-GFP (the structural schematic diagram of the vector is shown in the attached figure 2): after the PCR products were separated by agarose gel electrophoresis, the bands of interest were excised and recovered using AxyPrep DNASELL Extraction Kit (Axygen). The purified ACE2-Albumin and empty vector pMyc-IRES-GFP were digested simultaneously with XhoI and NotI (NEB), respectively, and Alkaline phosphatase (NEB) was added during digestion of empty vector pMyc-IRES-GFP. The PCR digestion product is purified and recovered by AxyPrep PCR Clean-Up Kit (Axygen), and the digestion plasmid vector is separated by agarose Gel electrophoresis, and then the target band is cut out and recovered by AxyPrep DNA Gel Extraction Kit (Axygen). The vector is connected with a target fragment by using T4 DNAlagase (NEB), then escherichia coli DH5 alpha is transformed, a single colony is selected for culture, plasmid DNA is extracted, and the plasmid DNA is sent to a commercial company for sequencing after enzyme digestion preliminary identification. Sequencing results show that the insertion of ACE2-Albumin is successful and named as a production vector pMyc-ACE2-Albumin-IRES-GFP, the sequence is shown as SEQ ID NO.8, and the structural schematic diagram of the vector is shown as figure 3.
Example 2
Production of ACE2-Albumin recombinant protein:
(1) using FreeStyle 293-F cells with FreeStyleTM293 medium was adjusted to 1 × 106cells/mL for a total of 30 mL;
(2) obtained as in example 1pMyc-ACE2-Albumin-IRES-GFP production vector 37.5ug and 0.6 mloop iPROTMMixing SFM culture medium uniformly;
(3) take 37.5ul FreeStyleTMMAX Reagent with 0.6mL OptiPROTMMixing SFM culture medium uniformly, and standing for 5 min;
(4) uniformly mixing the culture mediums obtained in the steps 3 and 4, and standing for 30 minutes;
(5) adding 1.2mL of the culture medium obtained in the step 4 into 30mL of LFreeStyle 293-F cells, culturing for 7 days, sampling at the fourth day to analyze the cell transfection condition, and collecting ACE2-Albumin recombinant protein after 7 days, wherein the sequence of the recombinant protein is shown as SEQ ID NO. 11.
Example 3
Purification of ACE2-Albumin recombinant protein
(1) Centrifuging 700g of 30mLNi-NTA Superflow Resin for 2 minutes, and removing a supernatant;
(2) adding 60mL of balance solution and Ni-NTA Superflow Resin, uniformly mixing, centrifuging for 2 minutes at 700g, and removing supernatant;
(3) centrifuging 300g of the cell culture obtained in example 2 for 5 minutes, adding the supernatant into the Ni-NTASuperflow Resin obtained in step 2, gently mixing for 30 minutes, centrifuging 700g for 2 minutes, and removing the supernatant;
(4) uniformly mixing 60mL of cleaning solution with Ni-NTA Superflow Resin, centrifuging for 2 minutes at 700g, removing supernatant, and cleaning for 3 times;
(5) uniformly mixing 30mL of eluent with Ni-NTA Superflow Resin, gently mixing for 10 minutes, centrifuging for 2 minutes at 700g, and taking supernatant, wherein the supernatant contains CSF1-Albumin recombinant protein;
(6) the concentration of ACE2-Albumin recombinant protein was determined using NanoDrop and adjusted to 2 mg/mL.
Example 4
The method for transfecting Vero-E6 cells by using the novel coronavirus comprises the following steps:
(1) the first day, 1.6X104Spreading Vero-E6 cells on a 96-well plate, culturing with DMEM + 10% fetal calf serum, and culturing in a 37-degree, 5% CO2 incubator for 24 hours;
(2) the next day, 110ul of medium containing 8mg/ml HexadimethrineBromide was added to the medium; adding 5ul of fluorescent new corona pseudovirus (and metabiology), and culturing for 24 hours;
(3) on the third day, 125ul of culture medium is added after the liquid is changed;
(4) on day four, cells were digested and transferred to 24-well plates;
(5) on day seven, cells were digested and transferred to 6-well plates;
(6) on the tenth day, FACS Aria III is used for sorting GFP positive cells, the GFP positive cells are transferred to a 96-well plate and continuously cultured to obtain a new corona pseudovirus infected cell line, as shown in the attached figure 4, wherein the left graph shows the transfection condition of Vero-E6 cells before sorting, and the right graph shows the GFP fluorescence expression condition of Vero-E6 cells after sorting, which shows that the cells are successfully sorted to purify Vero-E6 cells infected by the new corona pseudovirus and establish a stable cell line, and the expression of the new corona S protein can be indicated by GFP fluorescence.
Example 5
The ACE2-Albumin recombinant protein was tested for binding to the coronavirus S protein.
(1) Measuring the concentration of the ACE2-Albumin recombinant protein by using NanoDrop, and adjusting the concentration to 2 mg/mL;
(2) adding ACE2-Albumin recombinant protein concentration into a DMEM medium containing 2% fetal calf serum, adjusting to 1ng/mL, adding Vero-E6 cells infected by new coronavirus and Albumin antibody, and standing for 30 minutes;
(3) the method comprises the steps of infecting Vero-E6 cells with new corona pseudoviruses for 300g, centrifuging for 5 minutes, detecting the situation that the ACE 2-albubmin recombinant protein is combined with coronavirus S protein in Vero-E6 cells by using a flow cytometer, as shown in figure 5, the upper part in the figure is a schematic diagram that the ACE 2-albubmin recombinant protein is combined with Vero-E6 cells, the lower left figure is a flow cytometer detection result under the condition that Vero-E6 cells are not co-incubated with ACE 2-albubmin after the new corona pseudoviruses are infected, and the fact that the Vero-E6 cells express S protein even after the new corona pseudoviruses are infected can be seen, and no positive signal can be detected when the ACE 2-albubmin is combined; the lower right graph is the detection result of a flow cytometer under the condition that Vero-E6 and ACE2-Albumin are incubated together after the new coronavirus is infected, and positive signals can be detected when Vero-E6 cells express S protein and are combined with ACE2-Albumin after the new coronavirus is infected; the ACE2-Albumin can be effectively combined with new corona S protein and can be used in the field of new corona virus detection and treatment.
The foregoing is only a preferred embodiment of the present invention, and it should be noted that modifications can be made by those skilled in the art without departing from the principle of the present invention, and these modifications should also be construed as the protection scope of the present invention.
SEQUENCE LISTING
<110> Qianyuan kang' an (Suzhou) Biotechnology Co., Ltd
<120> ACE2-Albumin recombinant protein, preparation method and application thereof
<130>2020
<160>11
<170>PatentIn version 3.5
<210>1
<211>106
<212>DNA
<213> Artificial
<223> primer ACE2-5HA-F (XhoI)
<400>1
accacccctc gagatggcct tgacctttgc tttactggtg gccctcctgg tgctcagctg 60
caagtcaagc tgctctgtgg gccagtccac cattgaggaa caggcc 106
<210>2
<211>32
<212>DNA
<213> Artificial
<223> primer ACE2-5HA-R
<400>2
tcttgtgtgc aaactctagg ctgttgtcat tc 32
<210>3
<211>2212
<212>DNA
<213> human
<223> Gene fragment ACE2
<400>3
accaccctcg agatggcctt gacctttgct ttactggtgg ccctcctggt gctcagctgc 60
aagtcaagct gctctgtggg ccagtccacc attgaggaac aggccaagac atttttggac 120
aagtttaacc acgaagccga agacctgttc tatcaaagtt cacttgcttc ttggaattat 180
aacaccaata ttactgaaga gaatgtccaa aacatgaata atgctgggga caaatggtct 240
gcctttttaa aggaacagtc cacacttgcc caaatgtatc cactacaaga aattcagaat 300
ctcacagtca agcttcagct gcaggctctt cagcaaaatg ggtcttcagt gctctcagaa 360
gacaagagca aacggttgaa cacaattcta aatacaatga gcaccatcta cagtactgga 420
aaagtttgta acccagataa tccacaagaa tgcttattac ttgaaccagg tttgaatgaa 480
ataatggcaa acagtttaga ctacaatgag aggctctggg cttgggaaag ctggagatct 540
gaggtcggca agcagctgag gccattatat gaagagtatg tggtcttgaa aaatgagatg 600
gcaagagcaa atcattatga ggactatggg gattattgga gaggagacta tgaagtaaat 660
ggggtagatg gctatgacta cagccgcggc cagttgattg aagatgtgga acataccttt 720
gaagagatta aaccattata tgaacatctt catgcctatg tgagggcaaa gttgatgaat 780
gcctatcctt cctatatcag tccaattgga tgcctccctg ctcatttgct tggtgatatg 840
tggggtagat tttggacaaa tctgtactct ttgacagttc cctttggaca gaaaccaaac 900
atagatgtta ctgatgcaat ggtggaccag gcctgggatg cacagagaat attcaaggag 960
gccgagaagt tctttgtatc tgttggtctt cctaatatga ctcaaggatt ctgggaaaat 1020
tccatgctaa cggacccagg aaatgttcag aaagcagtct gccatcccac agcttgggac 1080
ctggggaagg gcgacttcag gatccttatg tgcacaaagg tgacaatgga cgacttcctg 1140
acagctcatc atgagatggg gcatatccag tatgatatgg catatgctgc acaacctttt 1200
ctgctaagaa atggagctaa tgaaggattc catgaagctg ttggggaaat catgtcactt 1260
tctgcagcca cacctaagca tttaaaatcc attggtcttc tgtcacccga ttttcaagaa 1320
gacaatgaaa cagaaataaa cttcctgctc aaacaagcac tcacgattgt tgggactctg 1380
ccatttactt acatgttaga gaagtggagg tggatggtct ttaaagggga aattcccaaa 1440
gaccagtgga tgaaaaagtg gtgggagatg aagcgagaga tagttggggt ggtggaacct 1500
gtgccccatg atgaaacata ctgtgacccc gcatctctgt tccatgtttc taatgattac 1560
tcattcattc gatattacac aaggaccctt taccaattcc agtttcaaga agcactttgt 1620
caagcagcta aacatgaagg ccctctgcac aaatgtgaca tctcaaactc tacagaagct 1680
ggacagaaac tgttcaatat gctgaggctt ggaaaatcag aaccctggac cctagcattg 1740
gaaaatgttg taggagcaaa gaacatgaat gtaaggccac tgctcaacta ctttgagccc 1800
ttatttacct ggctgaaaga ccagaacaag aattcttttg tgggatggag taccgactgg 1860
agtccatatg cagaccaaag catcaaagtg aggataagcc taaaatcagc tcttggagat 1920
aaagcatatg aatggaacga caatgaaatg tacctgttcc gatcatctgt tgcatatgct 1980
atgaggcagt actttttaaa agtaaaaaat cagatgattc tttttgggga ggaggatgtg 2040
cgagtggcta atttgaaacc aagaatctcc tttaatttct ttgtcactgc acctaaaaat 2100
gtgtctgata tcattcctag aactgaagtt gaaaaggcca tcaggatgtc ccggagccgt 2160
atcaatgatg ctttccgtct gaatgacaac agcctagagt ttgcacacaa ga 2212
<210>4
<211>32
<212>DNA
<213> Artificial
<223> primer Albumin-5HA-F
<400>4
cctagagttt gcacacaaga gtgaggttgc tc 32
<210>5
<211>58
<212>DNA
<213> Artificial
<223> primer Albumin-5HA-R (NotI)
<400>5
accaccgcgg ccgcttaatg gtgatggtga tgatgcatca tcaccatcac cattaaag 58
<210>6
<211>1794
<212>DNA
<213> human
<223> Gene fragment Albumin
<400>6
cctagagttt gcacacaaga gtgaggttgc tcatcggttt aaagatttgg gagaagaaaa 60
tttcaaagcc ttggtgttga ttgcctttgc tcagtatctt cagcagtgtc catttgaaga 120
tcatgtaaaa ttagtgaatg aagtaactga atttgcaaaa acatgtgttg ctgatgagtc 180
agctgaaaat tgtgacaaat cacttcatac cctttttgga gacaaattat gcacagttgc 240
aactcttcgt gaaacctatg gtgaaatggc tgactgctgt gcaaaacaag aacctgagag 300
aaatgaatgc ttcttgcaac acaaagatga caacccaaac ctcccccgat tggtgagacc 360
agaggttgat gtgatgtgca ctgcttttca tgacaatgaa gagacatttt tgaaaaaata 420
cttatatgaa attgccagaa gacatcctta cttttatgcc ccggaactcc ttttctttgc 480
taaaaggtat aaagctgctt ttacagaatg ttgccaagct gctgataaag ctgcctgcct 540
gttgccaaag ctcgatgaac ttcgggatga agggaaggct tcgtctgcca aacagagact 600
caagtgtgcc agtctccaaa aatttggaga aagagctttc aaagcatggg cagtagctcg 660
cctgagccag agatttccca aagctgagtt tgcagaagtt tccaagttag tgacagatct 720
taccaaagtc cacacggaat gctgccatgg agatctgctt gaatgtgctg atgacagggc 780
ggaccttgcc aagtatatct gtgaaaatca agattcgatc tccagtaaac tgaaggaatg 840
ctgtgaaaaa cctctgttgg aaaaatccca ctgcattgcc gaagtggaaa atgatgagat 900
gcctgctgac ttgccttcat tagctgctga ttttgttgaa agtaaggatg tttgcaaaaa 960
ctatgctgag gcaaaggatg tcttcctggg catgtttttg tatgaatatg caagaaggca 1020
tcctgattac tctgtcgtgc tgctgctgag acttgccaag acatatgaaa ccactctaga 1080
gaagtgctgt gccgctgcag atcctcatga atgctatgcc aaagtgttcg atgaatttaa 1140
acctcttgtg gaagagcctc agaatttaat caaacaaaat tgtgagcttt ttgagcagct 1200
tggagagtac aaattccaga atgcgctatt agttcgttac accaagaaag taccccaagt 1260
gtcaactcca actcttgtag aggtctcaag aaacctagga aaagtgggca gcaaatgttg 1320
taaacatcct gaagcaaaaa gaatgccctg tgcagaagac tatctatccg tggtcctgaa 1380
ccagttatgt gtgttgcatg agaaaacgcc agtaagtgac agagtcacca aatgctgcac 1440
agaatccttg gtgaacaggc gaccatgctt ttcagctctg gaagtcgatg aaacatacgt 1500
tcccaaagag tttaatgctg aaacattcac cttccatgca gatatatgca cactttctga 1560
gaaggagaga caaatcaaga aacaaactgc acttgttgag ctcgtgaaac acaagcccaa 1620
ggcaacaaaa gagcaactga aagctgttat ggatgatttc gcagcttttg tagagaagtg 1680
ctgcaaggct gacgataagg agacctgctt tgccgaggag ggtaaaaaac ttgttgcttt 1740
aatggtgatg gtgatgatgc atcatcacca tcaccattaa gcggccgcgg tggt 1794
<210>7
<211>3973
<212>DNA
<213> Artificial
<223>ACE2-Albumin
<400>7
accacccatg gccttgacct ttgctttact ggtggccctc ctggtgctca gctgcaagtc 60
aagctgctct gtgggccagt ccaccattga ggaacaggcc aagacatttt tggacaagtt 120
taaccacgaa gccgaagacc tgttctatca aagttcactt gcttcttgga attataacac 180
caatattact gaagagaatg tccaaaacat gaataatgct ggggacaaat ggtctgcctt 240
tttaaaggaa cagtccacac ttgcccaaat gtatccacta caagaaattc agaatctcac 300
agtcaagctt cagctgcagg ctcttcagca aaatgggtct tcagtgctct cagaagacaa 360
gagcaaacgg ttgaacacaa ttctaaatac aatgagcacc atctacagta ctggaaaagt 420
ttgtaaccca gataatccac aagaatgctt attacttgaa ccaggtttga atgaaataat 480
ggcaaacagt ttagactaca atgagaggct ctgggcttgg gaaagctgga gatctgaggt 540
cggcaagcag ctgaggccat tatatgaaga gtatgtggtc ttgaaaaatg agatggcaag 600
agcaaatcat tatgaggact atggggatta ttggagagga gactatgaag taaatggggt 660
agatggctat gactacagcc gcggccagtt gattgaagat gtggaacata cctttgaaga 720
gattaaacca ttatatgaac atcttcatgc ctatgtgagg gcaaagttga tgaatgccta 780
tccttcctat atcagtccaa ttggatgcct ccctgctcat ttgcttggtg atatgtgggg 840
tagattttgg acaaatctgt actctttgac agttcccttt ggacagaaac caaacataga 900
tgttactgat gcaatggtgg accaggcctg ggatgcacag agaatattca aggaggccga 960
gaagttcttt gtatctgttg gtcttcctaa tatgactcaa ggattctggg aaaattccat 1020
gctaacggac ccaggaaatg ttcagaaagc agtctgccat cccacagctt gggacctggg 1080
gaagggcgac ttcaggatcc ttatgtgcac aaaggtgaca atggacgact tcctgacagc 1140
tcatcatgag atggggcata tccagtatga tatggcatat gctgcacaac cttttctgct 1200
aagaaatgga gctaatgaag gattccatga agctgttggg gaaatcatgt cactttctgc 1260
agccacacct aagcatttaa aatccattgg tcttctgtca cccgattttc aagaagacaa 1320
tgaaacagaa ataaacttcc tgctcaaaca agcactcacg attgttggga ctctgccatt 1380
tacttacatg ttagagaagt ggaggtggat ggtctttaaa ggggaaattc ccaaagacca 1440
gtggatgaaa aagtggtggg agatgaagcg agagatagtt ggggtggtgg aacctgtgcc 1500
ccatgatgaa acatactgtg accccgcatc tctgttccat gtttctaatg attactcatt 1560
cattcgatat tacacaagga ccctttacca attccagttt caagaagcac tttgtcaagc 1620
agctaaacat gaaggccctc tgcacaaatg tgacatctca aactctacag aagctggaca 1680
gaaactgttc aatatgctga ggcttggaaa atcagaaccc tggaccctag cattggaaaa 1740
tgttgtagga gcaaagaaca tgaatgtaag gccactgctc aactactttg agcccttatt 1800
tacctggctg aaagaccaga acaagaattc ttttgtggga tggagtaccg actggagtcc 1860
atatgcagac caaagcatca aagtgaggat aagcctaaaa tcagctcttg gagataaagc 1920
atatgaatgg aacgacaatg aaatgtacct gttccgatca tctgttgcat atgctatgag 1980
gcagtacttt ttaaaagtaa aaaatcagat gattcttttt ggggaggagg atgtgcgagt 2040
ggctaatttg aaaccaagaa tctcctttaa tttctttgtc actgcaccta aaaatgtgtc 2100
tgatatcatt cctagaactg aagttgaaaa ggccatcagg atgtcccgga gccgtatcaa 2160
tgatgctttc cgtctgaatg acaacagcct agagtttgca cacaagagtg aggttgctca 2220
tcggtttaaa gatttgggag aagaaaattt caaagccttg gtgttgattg cctttgctca 2280
gtatcttcag cagtgtccat ttgaagatca tgtaaaatta gtgaatgaag taactgaatt 2340
tgcaaaaaca tgtgttgctg atgagtcagc tgaaaattgt gacaaatcac ttcataccct 2400
ttttggagac aaattatgca cagttgcaac tcttcgtgaa acctatggtg aaatggctga 2460
ctgctgtgca aaacaagaac ctgagagaaa tgaatgcttc ttgcaacaca aagatgacaa 2520
cccaaacctc ccccgattgg tgagaccaga ggttgatgtg atgtgcactg cttttcatga 2580
caatgaagag acatttttga aaaaatacttatatgaaatt gccagaagac atccttactt 2640
ttatgccccg gaactccttt tctttgctaa aaggtataaa gctgctttta cagaatgttg 2700
ccaagctgct gataaagctg cctgcctgtt gccaaagctc gatgaacttc gggatgaagg 2760
gaaggcttcg tctgccaaac agagactcaa gtgtgccagt ctccaaaaat ttggagaaag 2820
agctttcaaa gcatgggcag tagctcgcct gagccagaga tttcccaaag ctgagtttgc 2880
agaagtttcc aagttagtga cagatcttac caaagtccac acggaatgct gccatggaga 2940
tctgcttgaa tgtgctgatg acagggcgga ccttgccaag tatatctgtg aaaatcaaga 3000
ttcgatctcc agtaaactga aggaatgctg tgaaaaacct ctgttggaaa aatcccactg 3060
cattgccgaa gtggaaaatg atgagatgcc tgctgacttg ccttcattag ctgctgattt 3120
tgttgaaagt aaggatgttt gcaaaaacta tgctgaggca aaggatgtct tcctgggcat 3180
gtttttgtat gaatatgcaa gaaggcatcc tgattactct gtcgtgctgc tgctgagact 3240
tgccaagaca tatgaaacca ctctagagaa gtgctgtgcc gctgcagatc ctcatgaatg 3300
ctatgccaaa gtgttcgatg aatttaaacc tcttgtggaa gagcctcaga atttaatcaa 3360
acaaaattgt gagctttttg agcagcttgg agagtacaaa ttccagaatg cgctattagt 3420
tcgttacacc aagaaagtac cccaagtgtc aactccaact cttgtagagg tctcaagaaa 3480
cctaggaaaa gtgggcagca aatgttgtaa acatcctgaa gcaaaaagaa tgccctgtgc 3540
agaagactat ctatccgtgg tcctgaacca gttatgtgtg ttgcatgaga aaacgccagt 3600
aagtgacaga gtcaccaaat gctgcacaga atccttggtg aacaggcgac catgcttttc 3660
agctctggaa gtcgatgaaa catacgttcc caaagagttt aatgctgaaa cattcacctt 3720
ccatgcagat atatgcacac tttctgagaa ggagagacaa atcaagaaac aaactgcact 3780
tgttgagctc gtgaaacaca agcccaaggc aacaaaagag caactgaaag ctgttatgga 3840
tgatttcgca gcttttgtag agaagtgctg caaggctgac gataaggaga cctgctttgc 3900
cgaggagggt aaaaaacttg ttgctttaat ggtgatggtg atgatgcatc atcaccatca 3960
ccattaaggt ggt 3973
<210>8
<211>9447
<212>DNA
<213> Artificial
<223> vector pMyc-ACE2-Albumin-IRES-GFP
<400>8
ctgcataatg aaagacccca cctgtaggtt tggcaagcta gcttaagtaa cgccattttg 60
caaggcatgg aaaaatacat aactgagaat agaaaagttc agatcaaggt caggaacaga 120
tggaacagct gaatatgggc caaagcggat atctgtggta agcagttcct gccccggctc 180
agggccaaga acagatggaa cagctgaata tgggccaaac aggatatctg tggtaagcag 240
ttcctgcccc ggctcagggc caagaacaga tggtccccag atgcggtcca gccctcagca 300
gtttctagag aaccatcaga tgtttccagg gtgccccaag gacctgaaat gaccctgtgc 360
cttatttgaa ctaaccaatc agttcgcttc tcgcttctgt tcgcgcgctt ctgctccccg 420
agctcaataa aagagcccac aacccctcac tcggggcgcc agtcctccga ttgactgagt 480
cgcccgggta cccgtattcc caataaagcc tcttgctgtt tgcatccgaa tcgtggactc 540
gctgatcctt gggagggtct cctcagattg attgactgcc cacctcgggg gtctttcatt 600
tggaggttcc accgagattt ggagacccca gcccagggac caccgacccc cccgccggga 660
ggtaagctgg ccagcggtcg tttcgtgtct gtctctgtct ttgtgcgtgt ttgtgccggc 720
atctaatgtt tgcgcctgcg tctgtactag ttagctaact agctctgtat ctggcggacc 780
cgtggtggaa ctgacgagtt cggaacaccc ggccgcaacc ctgggagacg tcccagggac 840
ttcgggggcc gtttttgtgg cccgacctga gtccaaaaat cccgatcgtt ttggactctt 900
tggtgcaccc cccttagagg agggatatgt ggttctggta ggagacgaga acctaaaaca 960
gttcccgcct ccgtctgaat ttttgctttc ggtttgggac cgaagccgcg ccgcgcgtct 1020
tgtctgctgc agcatcgttc tgtgttgtct ctgtctgact gtgtttctgt atttgtctga 1080
aaatatgggc ccgggccaga ctgttaccac tcccttaagt ttgaccttag gtcactggaa 1140
agatgtcgag cggatcgctc acaaccagtc ggtagatgtc aagaagagac gttgggttac 1200
cttctgctct gcagaatggc caacctttaa cgtcggatgg ccgcgagacg gcacctttaa 1260
ccgagacctc atcacccagg ttaagatcaa ggtcttttca cctggcccgc atggacaccc 1320
agaccaggtc ccctacatcg tgacctggga agccttggct tttgaccccc ctccctgggt 1380
caagcccttt gtacacccta agcctccgcc tcctcttcct ccatccgccc cgtctctccc 1440
ccttgaacct cctcgttcga ccccgcctcg atcctccctt tatccagccc tcactccttc 1500
tctaggcgcc cccatatggc catatgagat cttatatggg gcacccccgc cccttgtaaa 1560
cttccctgac cctgacatga caagagttac taacagcccc tctctccaag ctcacttaca 1620
ggctctctac ttagtccagc acgaagtctg gagacctctg gcggcagcct accaagaaca 1680
actggaccga ccggtggtac ctcaccctta ccgagtcggc gacacagtgt gggtccgccg 1740
acaccagact aagaacctag aacctcgctg gaaaggacct tacacagtcc tgctgaccac 1800
ccccaccgcc ctcaaagtag acggcatcgc agcttggata cacgccgccc acgtgaaggc 1860
tgccgacccc gggggtggac catcctctag actgccggat cccaattgat gaccgcgccg 1920
ggcgccgccg ggcgctgccc tcccacgaca tggctgggct ccctgctgtt gttggtctgt 1980
ctcctggcga gcaggagtat caccgaggag gtgtcggagt actgtagcca catgattggg 2040
agtggacacc tgcagtctct gcagcggctg attgacagtc agatggagac ctcgtgccaa 2100
attacatttg agtttgtaga ccaggaacag ttgaaagatc cagtgtgcta ccttaagaag 2160
gcatttctcc tggtacaaga cataatggag gacaccatgc gcttcagaga taacaccccc 2220
aatgccatcg ccattgtgca gctgcaggaa ctctctttga ggctgaagag ctgcttcacc 2280
aaggattatg aagagcatga caaggcctgc gtccgaactt tctatgagac acctctccag 2340
ttgctggaga aggtcaagaa tgtctttaat gaaacaaaga atctccttga caaggactgg 2400
aatattttca gcaagaactg caacaacagc tttgctgaat gctccagcca agatgtggtg 2460
accaagcctg attgcaactg cctgtacccc aaagccatcc ctagcagtga cccggcctct 2520
gtctcccctc atcagcccct cgccccctcc atggcccctg tggctggctt gacctgggag 2580
gactctgagg gaactgaggg cagctccctc ttgcctggtg agcagcccct gcacacagtg 2640
gatccaggca gtgccaagca gcggccaccc aggagcacct gccagagctt tgagccgcca 2700
gagaccccag ttgtcaagga cagcaccatc ggtggctcac cacagcctcg cccctctgtc 2760
ggggccttca accccgggat ggaggatatt cttgactctg caatgggcac taattgggtc 2820
ccagaagaag cctctggaga ggccagtgag attcccgtac cccaagggac agagctttcc 2880
ccctccaggc caggaggggg cagcatgcag acagagcccg ccagacccag caacttcctc 2940
tcagcatctt ctccactccc tgcatcagca aagggccaac agccggcaga tgtaactggt 3000
accgccttgc ccagggtggg ccccgtgagg cccactggcc aggactggaa tcacaccccc 3060
cagaagacag accatccatc tgccctgctc agagaccccc cggagccagg ctctcccagg 3120
atctcatcac tgcgccccca gggcctcagc aacccctcca ccctctctgc tcagccacag 3180
ctttccagaa gccactcctc gggcagcgtg ctgccccttg gggagctgga gggcaggagg 3240
agcaccaggg atcggaggag ccccgcagag ccagaaggag gaccagcaag tgaaggggca 3300
gccaggcccc tgccccgttt taactccgtt cctttgactg acacaggcca tgagaggcag 3360
tccgagggat ccttcagccc gcagctccag gagtctgtct tccacctgct ggtgcccagt 3420
gtcatcctgg tcttgctggc cgtcggaggc ctcttgttct acaggtggag gcggcggagc 3480
catcaagagc ctcagagagc ggattctccc ttggagcaac cagagggcag ccccctgact 3540
caggatgaca gacaggtgga actgccagtg gcacacaaga gtgaggttgc tcatcggttt 3600
aaagatttgg gagaagaaaa tttcaaagcc ttggtgttga ttgcctttgc tcagtatctt 3660
cagcagtgtc catttgaaga tcatgtaaaa ttagtgaatg aagtaactga atttgcaaaa 3720
acatgtgttg ctgatgagtc agctgaaaat tgtgacaaat cacttcatac cctttttgga 3780
gacaaattat gcacagttgc aactcttcgt gaaacctatg gtgaaatggc tgactgctgt 3840
gcaaaacaag aacctgagag aaatgaatgc ttcttgcaac acaaagatga caacccaaac 3900
ctcccccgat tggtgagacc agaggttgat gtgatgtgca ctgcttttca tgacaatgaa 3960
gagacatttt tgaaaaaata cttatatgaa attgccagaa gacatcctta cttttatgcc 4020
ccggaactcc ttttctttgc taaaaggtat aaagctgctt ttacagaatg ttgccaagct 4080
gctgataaag ctgcctgcct gttgccaaag ctcgatgaac ttcgggatga agggaaggct 4140
tcgtctgcca aacagagact caagtgtgcc agtctccaaa aatttggaga aagagctttc 4200
aaagcatggg cagtagctcg cctgagccag agatttccca aagctgagtt tgcagaagtt 4260
tccaagttag tgacagatct taccaaagtc cacacggaat gctgccatgg agatctgctt 4320
gaatgtgctg atgacagggc ggaccttgcc aagtatatct gtgaaaatca agattcgatc 4380
tccagtaaac tgaaggaatg ctgtgaaaaa cctctgttgg aaaaatccca ctgcattgcc 4440
gaagtggaaa atgatgagat gcctgctgac ttgccttcat tagctgctga ttttgttgaa 4500
agtaaggatg tttgcaaaaa ctatgctgag gcaaaggatg tcttcctggg catgtttttg 4560
tatgaatatg caagaaggca tcctgattac tctgtcgtgc tgctgctgag acttgccaag 4620
acatatgaaa ccactctaga gaagtgctgt gccgctgcag atcctcatga atgctatgcc 4680
aaagtgttcg atgaatttaa acctcttgtg gaagagcctc agaatttaat caaacaaaat 4740
tgtgagcttt ttgagcagct tggagagtac aaattccaga atgcgctatt agttcgttac 4800
accaagaaag taccccaagt gtcaactcca actcttgtag aggtctcaag aaacctagga 4860
aaagtgggca gcaaatgttg taaacatcct gaagcaaaaa gaatgccctg tgcagaagac 4920
tatctatccg tggtcctgaa ccagttatgt gtgttgcatg agaaaacgcc agtaagtgac 4980
agagtcacca aatgctgcac agaatccttg gtgaacaggc gaccatgctt ttcagctctg 5040
gaagtcgatg aaacatacgt tcccaaagag tttaatgctg aaacattcac cttccatgca 5100
gatatatgca cactttctga gaaggagaga caaatcaaga aacaaactgc acttgttgag 5160
ctcgtgaaac acaagcccaa ggcaacaaaa gagcaactga aagctgttat ggatgatttc 5220
gcagcttttg tagagaagtg ctgcaaggct gacgataagg agacctgctt tgccgaggag 5280
ggtaaaaaac ttgttgcttt aatggtgatg gtgatgatgc atcatcacca tcaccattaa 5340
gaattcctgc aggcctcgag ggccggcgcg ccgcggccgc tacgtaaatt ccgcccctct 5400
ccctcccccc cccctaacgt tactggccga agccgcttgg aataaggccg gtgtgcgttt 5460
gtctatatgt tattttccac catattgccg tcttttggca atgtgagggc ccggaaacct 5520
ggccctgtct tcttgacgag cattcctagg ggtctttccc ctctcgccaa aggaatgcaa 5580
ggtctgttga atgtcgtgaa ggaagcagtt cctctggaag cttcttgaag acaaacaacg 5640
tctgtagcga ccctttgcag gcagcggaac cccccacctg gcgacaggtg cctctgcggc 5700
caaaagccac gtgtataaga tacacctgca aaggcggcac aaccccagtg ccacgttgtg 5760
agttggatag ttgtggaaag agtcaaatgg ctctcctcaa gcgtattcaa caaggggctg5820
aaggatgccc agaaggtacc ccattgtatg ggatctgatc tggggcctcg gtgcacatgc 5880
tttacatgtg tttagtcgag gttaaaaaac gtctaggccc cccgaaccac ggggacgtgg 5940
ttttcctttg aaaaacacga tgataatatg gccacaacca tggtgagcaa gggcgaggag 6000
ctgttcaccg gggtggtgcc catcctggtc gagctggacg gcgacgtaaa cggccacaag 6060
ttcagcgtgt ccggcgaggg cgagggcgat gccacctacg gcaagctgac cctgaagttc 6120
atctgcacca ccggcaagct gcccgtgccc tggcccaccc tcgtgaccac cctgacctac 6180
ggcgtgcagt gcttcagccg ctaccccgac cacatgaagc agcacgactt cttcaagtcc 6240
gccatgcccg aaggctacgt ccaggagcgc accatcttct tcaaggacga cggcaactac 6300
aagacccgcg ccgaggtgaa gttcgagggc gacaccctgg tgaaccgcat cgagctgaag 6360
ggcatcgact tcaaggagga cggcaacatc ctggggcaca agctggagta caactacaac 6420
agccacaacg tctatatcat ggccgacaag cagaagaacg gcatcaaggt gaacttcaag 6480
atccgccaca acatcgagga cggcagcgtg cagctcgccg accactacca gcagaacacc 6540
cccatcggcg acggccccgt gctgctgccc gacaaccact acctgagcac ccagtccgcc 6600
ctgagcaaag accccaacga gaagcgcgat cacatggtcc tgctggagtt cgtgaccgcc 6660
gccgggatca ctctcggcat ggacgagctg tacaagtaaa gcggcccagc cacagtggtc 6720
gaccgggccg ccagcacagt gggggggggc ccgcgattag tccaatttgt taaagacagg 6780
atatcagtgg tccaggctct agttttgact caacaatatc accagctgaa gcctatagag 6840
tacgagccat agatagaata aaagatttta tttagtctcc agaaaaaggg gggaatgaaa 6900
gaccccacct gtaggtttgg caagctagct taagtaagcc attttgcaag gcatggaaaa 6960
atacataact gagaatagag aagttcagat caaggttagg aacagagaga caggagaata 7020
tgggccaaac aggatatctg tggtaagcag ttcctgcccc ggctcagggc caagaacagt 7080
tggaacagca gaatatgggc caaacaggat atctgtggta agcagttcct gccccggctc 7140
agggccaaga acagatggtc cccagatgcg gtcccgccct cagcagtttc tagagaacca 7200
tcagatgttt ccagggtgcc ccaaggacct gaaatgaccc tgtgccttat ttgaactaac 7260
caatcagttc gcttctcgct tctgttcgcg cgcttctgct ccccgagctc aataaaagag 7320
cccacaaccc ctcactcggc gcgccagtcc tccgatagac tgcgtcgccc gggtacccgt 7380
gtatccaata aaccctcttg cagttgcatc cgacttgtgg tctcgctgtt ccttgggagg 7440
gtctcctctg agtgattgac tacccgtcag cgggggtctt tcattctgca ttaatgaatc 7500
ggccaacgcg cggggagagg cggtttgcgt attgggcgct cttccgcttc ctcgctcact 7560
gactcgctgc gctcggtcgt tcggctgcgg cgagcggtat cagctcactc aaaggcggta 7620
atacggttat ccacagaatc aggggataac gcaggaaaga acatgtgagc aaaaggccag 7680
caaaaggcca ggaaccgtaa aaaggccgcg ttgctggcgt ttttccatag gctccgcccc 7740
cctgacgagc atcacaaaaa tcgacgctca agtcagaggt ggcgaaaccc gacaggacta 7800
taaagatacc aggcgtttcc ccctggaagc tccctcgtgc gctctcctgt tccgaccctg 7860
ccgcttaccg gatacctgtc cgcctttctc ccttcgggaa gcgtggcgct ttctcatagc 7920
tcacgctgta ggtatctcag ttcggtgtag gtcgttcgct ccaagctggg ctgtgtgcac 7980
gaaccccccg ttcagcccga ccgctgcgcc ttatccggta actatcgtct tgagtccaac 8040
ccggtaagac acgacttatc gccactggca gcagccactg gtaacaggat tagcagagcg 8100
aggtatgtag gcggtgctac agagttcttg aagtggtggc ctaactacgg ctacactaga 8160
aggacagtat ttggtatctg cgctctgctg aagccagtta ccttcggaaa aagagttggt 8220
agctcttgat ccggcaaaca aaccaccgct ggtagcggtg gtttttttgt ttgcaagcag 8280
cagattacgc gcagaaaaaa aggatctcaa gaagatcctt tgatcttttc tacggggtct 8340
gacgctcagt ggaacgaaaa ctcacgttaa gggattttgg tcatgagatt atcaaaaagg 8400
atcttcacct agatcctttt gcggccggcc gcaaatcaat ctaaagtata tatgagtaaa 8460
cttggtctga cagttaccaa tgcttaatca gtgaggcacc tatctcagcg atctgtctat 8520
ttcgttcatc catagttgcc tgactccccg tcgtgtagat aactacgata cgggagggct 8580
taccatctgg ccccagtgct gcaatgatac cgcgagaccc acgctcaccg gctccagatt 8640
tatcagcaat aaaccagcca gccggaaggg ccgagcgcag aagtggtcct gcaactttat 8700
ccgcctccat ccagtctatt aattgttgcc gggaagctag agtaagtagt tcgccagtta 8760
atagtttgcg caacgttgtt gccattgcta caggcatcgt ggtgtcacgc tcgtcgtttg 8820
gtatggcttc attcagctcc ggttcccaac gatcaaggcg agttacatga tcccccatgt 8880
tgtgcaaaaa agcggttagc tccttcggtc ctccgatcgt tgtcagaagt aagttggccg 8940
cagtgttatc actcatggtt atggcagcac tgcataattc tcttactgtc atgccatccg 9000
taagatgctt ttctgtgact ggtgagtact caaccaagtc attctgagaa tagtgtatgc 9060
ggcgaccgag ttgctcttgc ccggcgtcaa cacgggataa taccgcgcca catagcagaa 9120
ctttaaaagt gctcatcatt ggaaaacgtt cttcggggcg aaaactctca aggatcttac 9180
cgctgttgag atccagttcg atgtaaccca ctcgtgcacc caactgatct tcagcatctt 9240
ttactttcac cagcgtttct gggtgagcaa aaacaggaag gcaaaatgcc gcaaaaaagg 9300
gaataagggc gacacggaaa tgttgaatac tcatactctt cctttttcaa tattattgaa 9360
gcatttatca gggttattgt ctcatgagcg gatacatatt tgaatgtatt tagaaaaata 9420
aacaaatagg ggttccgcgc acatttc 9447
<210>9
<211>554
<212>PRT
<213> human
<223>ACE2
<400>9
Met Thr Ala Pro Gly Ala Ala Gly Arg Cys Pro Pro Thr Thr Trp Leu
1 5 10 15
Gly Ser Leu Leu Leu Leu Val Cys Leu Leu Ala Ser Arg Ser Ile Thr
20 25 30
Glu Glu Val Ser Glu Tyr Cys Ser His Met Ile Gly Ser Gly His Leu
35 40 45
Gln Ser Leu Gln Arg Leu Ile Asp Ser Gln Met Glu Thr Ser Cys Gln
50 55 60
Ile Thr Phe Glu Phe Val Asp Gln Glu Gln Leu Lys Asp Pro Val Cys
65 70 75 80
Tyr Leu Lys Lys Ala Phe Leu Leu Val Gln Asp Ile Met Glu Asp Thr
85 90 95
Met Arg Phe Arg Asp Asn Thr Pro Asn Ala Ile Ala Ile Val Gln Leu
100 105 110
Gln Glu Leu Ser Leu Arg Leu Lys Ser Cys Phe Thr Lys Asp Tyr Glu
115 120 125
Glu His Asp Lys Ala Cys Val Arg Thr Phe Tyr Glu Thr Pro Leu Gln
130 135 140
Leu Leu Glu Lys Val Lys Asn Val Phe Asn Glu Thr Lys Asn Leu Leu
145 150 155 160
Asp Lys Asp Trp Asn Ile Phe Ser Lys Asn Cys Asn Asn Ser Phe Ala
165 170 175
Glu Cys Ser Ser Gln Asp Val Val Thr Lys Pro Asp Cys Asn Cys Leu
180 185 190
Tyr Pro Lys Ala Ile Pro Ser Ser Asp Pro Ala Ser Val Ser Pro His
195 200 205
Gln Pro Leu Ala Pro Ser Met Ala Pro Val Ala Gly Leu Thr TrpGlu
210 215 220
Asp Ser Glu Gly Thr Glu Gly Ser Ser Leu Leu Pro Gly Glu Gln Pro
225 230 235 240
Leu His Thr Val Asp Pro Gly Ser Ala Lys Gln Arg Pro Pro Arg Ser
245 250 255
Thr Cys Gln Ser Phe Glu Pro Pro Glu Thr Pro Val Val Lys Asp Ser
260 265 270
Thr Ile Gly Gly Ser Pro Gln Pro Arg Pro Ser Val Gly Ala Phe Asn
275 280 285
Pro Gly Met Glu Asp Ile Leu Asp Ser Ala Met Gly Thr Asn Trp Val
290 295 300
Pro Glu Glu Ala Ser Gly Glu Ala Ser Glu Ile Pro Val Pro Gln Gly
305 310 315 320
Thr Glu Leu Ser Pro Ser Arg Pro Gly Gly Gly Ser Met Gln Thr Glu
325 330 335
Pro Ala Arg Pro Ser Asn Phe Leu Ser Ala Ser Ser Pro Leu Pro Ala
340 345 350
Ser Ala Lys Gly Gln Gln Pro Ala Asp Val Thr Gly Thr Ala Leu Pro
355 360 365
Arg Val Gly Pro ValArg Pro Thr Gly Gln Asp Trp Asn His Thr Pro
370 375 380
Gln Lys Thr Asp His Pro Ser Ala Leu Leu Arg Asp Pro Pro Glu Pro
385 390 395 400
Gly Ser Pro Arg Ile Ser Ser Leu Arg Pro Gln Gly Leu Ser Asn Pro
405 410 415
Ser Thr Leu Ser Ala Gln Pro Gln Leu Ser Arg Ser His Ser Ser Gly
420 425 430
Ser Val Leu Pro Leu Gly Glu Leu Glu Gly Arg Arg Ser Thr Arg Asp
435 440 445
Arg Arg Ser Pro Ala Glu Pro Glu Gly Gly Pro Ala Ser Glu Gly Ala
450 455 460
Ala Arg Pro Leu Pro Arg Phe Asn Ser Val Pro Leu Thr Asp Thr Gly
465 470 475 480
His Glu Arg Gln Ser Glu Gly Ser Phe Ser Pro Gln Leu Gln Glu Ser
485 490 495
Val Phe His Leu Leu Val Pro Ser Val Ile Leu Val Leu Leu Ala Val
500 505 510
Gly Gly Leu Leu Phe Tyr Arg Trp Arg Arg Arg Ser His Gln Glu Pro
515 520 525
Gln Arg Ala Asp Ser Pro Leu Glu Gln Pro Glu Gly Ser Pro Leu Thr
530 535 540
Gln Asp Asp Arg Gln Val Glu Leu Pro Val
545 550
<210>10
<211>609
<212>PRT
<213> human
<223>Albumin
<400>10
Met Lys Trp Val Thr Phe Ile Ser Leu Leu Phe Leu Phe Ser Ser Ala
1 5 10 15
Tyr Ser Arg Gly Val Phe Arg Arg Asp Ala His Lys Ser Glu Val Ala
20 25 30
His Arg Phe Lys Asp Leu Gly Glu Glu Asn Phe Lys Ala Leu Val Leu
35 40 45
Ile Ala Phe Ala Gln Tyr Leu Gln Gln Cys Pro Phe Glu Asp His Val
50 55 60
Lys Leu Val Asn Glu Val Thr Glu Phe Ala Lys Thr Cys Val Ala Asp
65 70 75 80
Glu Ser Ala Glu Asn Cys Asp Lys Ser Leu His Thr Leu Phe Gly Asp
85 90 95
Lys Leu Cys Thr Val Ala Thr Leu Arg Glu Thr Tyr Gly Glu Met Ala
100 105 110
Asp Cys Cys Ala Lys Gln Glu Pro Glu Arg Asn Glu Cys Phe Leu Gln
115 120 125
His Lys Asp Asp Asn Pro Asn Leu Pro Arg Leu Val Arg Pro Glu Val
130 135 140
Asp Val Met Cys Thr Ala Phe His Asp Asn Glu Glu Thr Phe Leu Lys
145 150 155 160
Lys Tyr Leu Tyr Glu Ile Ala Arg Arg His Pro Tyr Phe Tyr Ala Pro
165 170 175
Glu Leu Leu Phe Phe Ala Lys Arg Tyr Lys Ala Ala Phe Thr Glu Cys
180 185 190
Cys Gln Ala Ala Asp Lys Ala Ala Cys Leu Leu Pro Lys Leu Asp Glu
195 200 205
Leu Arg Asp Glu Gly Lys Ala Ser Ser Ala Lys Gln Arg Leu Lys Cys
210 215 220
Ala Ser Leu Gln Lys Phe Gly Glu Arg Ala Phe Lys Ala Trp Ala Val
225 230 235 240
Ala Arg Leu Ser Gln Arg Phe Pro Lys Ala Glu Phe Ala Glu Val Ser
245 250 255
Lys Leu Val ThrAsp Leu Thr Lys Val His Thr Glu Cys Cys His Gly
260 265 270
Asp Leu Leu Glu Cys Ala Asp Asp Arg Ala Asp Leu Ala Lys Tyr Ile
275 280 285
Cys Glu Asn Gln Asp Ser Ile Ser Ser Lys Leu Lys Glu Cys Cys Glu
290 295 300
Lys Pro Leu Leu Glu Lys Ser His Cys Ile Ala Glu Val Glu Asn Asp
305 310 315 320
Glu Met Pro Ala Asp Leu Pro Ser Leu Ala Ala Asp Phe Val Glu Ser
325 330 335
Lys Asp Val Cys Lys Asn Tyr Ala Glu Ala Lys Asp Val Phe Leu Gly
340 345 350
Met Phe Leu Tyr Glu Tyr Ala Arg Arg His Pro Asp Tyr Ser Val Val
355 360 365
Leu Leu Leu Arg Leu Ala Lys Thr Tyr Glu Thr Thr Leu Glu Lys Cys
370 375 380
Cys Ala Ala Ala Asp Pro His Glu Cys Tyr Ala Lys Val Phe Asp Glu
385 390 395 400
Phe Lys Pro Leu Val Glu Glu Pro Gln Asn Leu Ile Lys Gln Asn Cys
405 410 415
Glu Leu Phe Glu Gln Leu Gly Glu Tyr Lys Phe Gln Asn Ala Leu Leu
420 425 430
Val Arg Tyr Thr Lys Lys Val Pro Gln Val Ser Thr Pro Thr Leu Val
435 440 445
Glu Val Ser Arg Asn Leu Gly Lys Val Gly Ser Lys Cys Cys Lys His
450 455 460
Pro Glu Ala Lys Arg Met Pro Cys Ala Glu Asp Tyr Leu Ser Val Val
465 470 475 480
Leu Asn Gln Leu Cys Val Leu His Glu Lys Thr Pro Val Ser Asp Arg
485 490 495
Val Thr Lys Cys Cys Thr Glu Ser Leu Val Asn Arg Arg Pro Cys Phe
500 505 510
Ser Ala Leu Glu Val Asp Glu Thr Tyr Val Pro Lys Glu Phe Asn Ala
515 520 525
Glu Thr Phe Thr Phe His Ala Asp Ile Cys Thr Leu Ser Glu Lys Glu
530 535 540
Arg Gln Ile Lys Lys Gln Thr Ala Leu Val Glu Leu Val Lys His Lys
545 550 555 560
Pro Lys Ala Thr Lys Glu Gln Leu Lys Ala Val Met Asp Asp Phe Ala
565 570575
Ala Phe Val Glu Lys Cys Cys Lys Ala Asp Asp Lys Glu Thr Cys Phe
580 585 590
Ala Glu Glu Gly Lys Lys Leu Val Ala Ala Ser Gln Ala Ala Leu Gly
595 600 605
Leu
<210>11
<211>1319
<212>PRT
<213> Artificial
<223> ACE2-Albumin recombinant protein
<400>11
Met Ala Leu Thr Phe Ala Leu Leu Val Ala Leu Leu Val Leu Ser Cys
1 5 10 15
Lys Ser Ser Cys Ser Val Gly Gln Ser Thr Ile Glu Glu Gln Ala Lys
20 25 30
Thr Phe Leu Asp Lys Phe Asn His Glu Ala Glu Asp Leu Phe Tyr Gln
35 40 45
Ser Ser Leu Ala Ser Trp Asn Tyr Asn Thr Asn Ile Thr Glu Glu Asn
50 55 60
Val Gln Asn Met Asn Asn Ala Gly Asp Lys Trp Ser Ala Phe Leu Lys
65 70 75 80
Glu Gln Ser Thr Leu Ala Gln Met Tyr Pro Leu Gln Glu Ile Gln Asn
8590 95
Leu Thr Val Lys Leu Gln Leu Gln Ala Leu Gln Gln Asn Gly Ser Ser
100 105 110
Val Leu Ser Glu Asp Lys Ser Lys Arg Leu Asn Thr Ile Leu Asn Thr
115 120 125
Met Ser Thr Ile Tyr Ser Thr Gly Lys Val Cys Asn Pro Asp Asn Pro
130 135 140
Gln Glu Cys Leu Leu Leu Glu Pro Gly Leu Asn Glu Ile Met Ala Asn
145 150 155 160
Ser Leu Asp Tyr Asn Glu Arg Leu Trp Ala Trp Glu Ser Trp Arg Ser
165 170 175
Glu Val Gly Lys Gln Leu Arg Pro Leu Tyr Glu Glu Tyr Val Val Leu
180 185 190
Lys Asn Glu Met Ala Arg Ala Asn His Tyr Glu Asp Tyr Gly Asp Tyr
195 200 205
Trp Arg Gly Asp Tyr Glu Val Asn Gly Val Asp Gly Tyr Asp Tyr Ser
210 215 220
Arg Gly Gln Leu Ile Glu Asp Val Glu His Thr Phe Glu Glu Ile Lys
225 230 235 240
Pro Leu Tyr Glu His Leu His Ala Tyr Val Arg Ala Lys Leu Met Asn
245 250 255
Ala Tyr Pro Ser Tyr Ile Ser Pro Ile Gly Cys Leu Pro Ala His Leu
260 265 270
Leu Gly Asp Met Trp Gly Arg Phe Trp Thr Asn Leu Tyr Ser Leu Thr
275 280 285
Val Pro Phe Gly Gln Lys Pro Asn Ile Asp Val Thr Asp Ala Met Val
290 295 300
Asp Gln Ala Trp Asp Ala Gln Arg Ile Phe Lys Glu Ala Glu Lys Phe
305 310 315 320
Phe Val Ser Val Gly Leu Pro Asn Met Thr Gln Gly Phe Trp Glu Asn
325 330 335
Ser Met Leu Thr Asp Pro Gly Asn Val Gln Lys Ala Val Cys His Pro
340 345 350
Thr Ala Trp Asp Leu Gly Lys Gly Asp Phe Arg Ile Leu Met Cys Thr
355 360 365
Lys Val Thr Met Asp Asp Phe Leu Thr Ala His His Glu Met Gly His
370 375 380
Ile Gln Tyr Asp Met Ala Tyr Ala Ala Gln Pro Phe Leu Leu Arg Asn
385 390 395 400
Gly Ala Asn Glu Gly Phe His Glu Ala Val GlyGlu Ile Met Ser Leu
405 410 415
Ser Ala Ala Thr Pro Lys His Leu Lys Ser Ile Gly Leu Leu Ser Pro
420 425 430
Asp Phe Gln Glu Asp Asn Glu Thr Glu Ile Asn Phe Leu Leu Lys Gln
435 440 445
Ala Leu Thr Ile Val Gly Thr Leu Pro Phe Thr Tyr Met Leu Glu Lys
450 455 460
Trp Arg Trp Met Val Phe Lys Gly Glu Ile Pro Lys Asp Gln Trp Met
465 470 475 480
Lys Lys Trp Trp Glu Met Lys Arg Glu Ile Val Gly Val Val Glu Pro
485 490 495
Val Pro His Asp Glu Thr Tyr Cys Asp Pro Ala Ser Leu Phe His Val
500 505 510
Ser Asn Asp Tyr Ser Phe Ile Arg Tyr Tyr Thr Arg Thr Leu Tyr Gln
515 520 525
Phe Gln Phe Gln Glu Ala Leu Cys Gln Ala Ala Lys His Glu Gly Pro
530 535 540
Leu His Lys Cys Asp Ile Ser Asn Ser Thr Glu Ala Gly Gln Lys Leu
545 550 555 560
Phe Asn Met Leu Arg Leu Gly Lys Ser Glu Pro Trp Thr Leu Ala Leu
565 570 575
Glu Asn Val Val Gly Ala Lys Asn Met Asn Val Arg Pro Leu Leu Asn
580 585 590
Tyr Phe Glu Pro Leu Phe Thr Trp Leu Lys Asp Gln Asn Lys Asn Ser
595 600 605
Phe Val Gly Trp Ser Thr Asp Trp Ser Pro Tyr Ala Asp Gln Ser Ile
610 615 620
Lys Val Arg Ile Ser Leu Lys Ser Ala Leu Gly Asp Lys Ala Tyr Glu
625 630 635 640
Trp Asn Asp Asn Glu Met Tyr Leu Phe Arg Ser Ser Val Ala Tyr Ala
645 650 655
Met Arg Gln Tyr Phe Leu Lys Val Lys Asn Gln Met Ile Leu Phe Gly
660 665 670
Glu Glu Asp Val Arg Val Ala Asn Leu Lys Pro Arg Ile Ser Phe Asn
675 680 685
Phe Phe Val Thr Ala Pro Lys Asn Val Ser Asp Ile Ile Pro Arg Thr
690 695 700
Glu Val Glu Lys Ala Ile Arg Met Ser Arg Ser Arg Ile Asn Asp Ala
705 710 715 720
Phe Arg Leu Asn Asp Asn Ser Leu Glu Phe Ala His Lys Ser Glu Val
725 730 735
Ala His Arg Phe Lys Asp Leu Gly Glu Glu Asn Phe Lys Ala Leu Val
740 745 750
Leu Ile Ala Phe Ala Gln Tyr Leu Gln Gln Cys Pro Phe Glu Asp His
755 760 765
Val Lys Leu Val Asn Glu Val Thr Glu Phe Ala Lys Thr Cys Val Ala
770 775 780
Asp Glu Ser Ala Glu Asn Cys Asp Lys Ser Leu His Thr Leu Phe Gly
785 790 795 800
Asp Lys Leu Cys Thr Val Ala Thr Leu Arg Glu Thr Tyr Gly Glu Met
805 810 815
Ala Asp Cys Cys Ala Lys Gln Glu Pro Glu Arg Asn Glu Cys Phe Leu
820 825 830
Gln His Lys Asp Asp Asn Pro Asn Leu Pro Arg Leu Val Arg Pro Glu
835 840 845
Val Asp Val Met Cys Thr Ala Phe His Asp Asn Glu Glu Thr Phe Leu
850 855 860
Lys Lys Tyr Leu Tyr Glu Ile Ala Arg Arg His Pro Tyr Phe Tyr Ala
865 870 875 880
Pro Glu Leu Leu Phe Phe Ala Lys Arg Tyr Lys Ala Ala Phe Thr Glu
885 890 895
Cys Cys Gln Ala Ala Asp Lys Ala Ala Cys Leu Leu Pro Lys Leu Asp
900 905 910
Glu Leu Arg Asp Glu Gly Lys Ala Ser Ser Ala Lys Gln Arg Leu Lys
915 920 925
Cys Ala Ser Leu Gln Lys Phe Gly Glu Arg Ala Phe Lys Ala Trp Ala
930 935 940
Val Ala Arg Leu Ser Gln Arg Phe Pro Lys Ala Glu Phe Ala Glu Val
945 950 955 960
Ser Lys Leu Val Thr Asp Leu Thr Lys Val His Thr Glu Cys Cys His
965 970 975
Gly Asp Leu Leu Glu Cys Ala Asp Asp Arg Ala Asp Leu Ala Lys Tyr
980 985 990
Ile Cys Glu Asn Gln Asp Ser Ile Ser Ser Lys Leu Lys Glu Cys Cys
995 1000 1005
Glu Lys Pro Leu Leu Glu Lys Ser His Cys Ile Ala Glu Val Glu
1010 1015 1020
Asn Asp Glu Met Pro Ala Asp Leu Pro Ser Leu Ala Ala Asp Phe
1025 1030 1035
Val Glu Ser Lys Asp Val Cys Lys Asn Tyr Ala Glu Ala Lys Asp
1040 1045 1050
Val Phe Leu Gly Met Phe Leu Tyr Glu Tyr Ala Arg Arg His Pro
1055 1060 1065
Asp Tyr Ser Val Val Leu Leu Leu Arg Leu Ala Lys Thr Tyr Glu
1070 1075 1080
Thr Thr Leu Glu Lys Cys Cys Ala Ala Ala Asp Pro His Glu Cys
1085 1090 1095
Tyr Ala Lys Val Phe Asp Glu Phe Lys Pro Leu Val Glu Glu Pro
1100 1105 1110
Gln Asn Leu Ile Lys Gln Asn Cys Glu Leu Phe Glu Gln Leu Gly
1115 1120 1125
Glu Tyr Lys Phe Gln Asn Ala Leu Leu Val Arg Tyr Thr Lys Lys
1130 1135 1140
Val Pro Gln Val Ser Thr Pro Thr Leu Val Glu Val Ser Arg Asn
1145 1150 1155
Leu Gly Lys Val Gly Ser Lys Cys Cys Lys His Pro Glu Ala Lys
1160 1165 1170
Arg Met Pro Cys Ala Glu Asp Tyr Leu Ser Val Val Leu Asn Gln
1175 1180 1185
Leu Cys Val Leu His Glu Lys Thr Pro Val Ser Asp Arg Val Thr
11901195 1200
Lys Cys Cys Thr Glu Ser Leu Val Asn Arg Arg Pro Cys Phe Ser
1205 1210 1215
Ala Leu Glu Val Asp Glu Thr Tyr Val Pro Lys Glu Phe Asn Ala
1220 1225 1230
Glu Thr Phe Thr Phe His Ala Asp Ile Cys Thr Leu Ser Glu Lys
1235 1240 1245
Glu Arg Gln Ile Lys Lys Gln Thr Ala Leu Val Glu Leu Val Lys
1250 1255 1260
His Lys Pro Lys Ala Thr Lys Glu Gln Leu Lys Ala Val Met Asp
1265 1270 1275
Asp Phe Ala Ala Phe Val Glu Lys Cys Cys Lys Ala Asp Asp Lys
1280 1285 1290
Glu Thr Cys Phe Ala Glu Glu Gly Lys Lys Leu Val Ala Leu Met
1295 1300 1305
Val Met Val Met Met His His His His His His
1310 1315

Claims (10)

1. An ACE2-Albumin recombinant protein, which is characterized in that the recombinant protein contains active structures of both an ACE2 protein and an Albumin protein.
2. The ACE2-Albumin recombinant protein according to claim 1, wherein the recombinant protein comprises part or all of the amino acid sequence shown in SEQ ID No.9 and SEQ ID No. 10.
3. The ACE2-Albumin recombinant protein according to claim 2, wherein the N-terminus of SEQ ID No.10 is linked to the C-terminus of SEQ ID No. 9.
4. The ACE2-Albumin recombinant protein according to claim 1, wherein the amino acid sequence of the recombinant protein is shown as SEQ ID No. 11.
5. A nucleotide sequence encoding the ACE2-Albumin recombinant protein of any one of claims 1 to 4.
6. A method for constructing a vector for producing recombinant ACE2-Albumin protein as claimed in any of claims 1 to 4, comprising the steps of:
(1) taking ACE2 cDNA as a template, and carrying out PCR by using a forward primer with a sequence shown as SEQ ID NO.1 and a reverse primer with a sequence shown as SEQ ID NO.2 to amplify a gene sheet ACE2 with a sequence shown as SEQ ID NO. 3;
(2) taking Albumin cDNA as a template, and carrying out PCR by using a forward primer with a sequence shown as SEQ ID NO.4 and a reverse primer with a sequence shown as SEQ ID NO.5 to amplify a gene fragment Albumin with a sequence shown as SEQ ID NO. 6;
(3) taking the gene fragment ACE2 and Albumin obtained in the steps 1 and 2 as templates, and carrying out Overlap PCR by using a forward primer with a sequence shown as SEQ ID NO.1 and a reverse primer with a sequence shown as SEQ ID NO.5 to obtain a fusion gene fragment ACE2-Albumin with a sequence shown as SEQ ID NO. 7;
(4) and (3) cloning the target gene fragment ACE2-Albumin obtained in the step (3) to a vector by enzyme digestion to obtain a production vector of ACE2-Albumin recombinant protein.
7. The method for constructing the production vector of the ACE2-Albumin recombinant protein, according to claim 6, wherein the sites for enzyme digestion are XhoI and NotI, the cloning vector is pMyc-IRES-GFP, and the obtained production vector of the ACE2-Albumin recombinant protein is pMyc-ACE2-Albumin-IRES-GFP, and the sequence of the production vector is shown in SEQ ID NO. 8.
8. The method for constructing a production vector of ACE2-Albumin recombinant protein according to claim 6 or 7, to express ACE2-Albumin recombinant protein, comprising the steps of:
(1) culturing the cells;
(2) transfecting the obtained production vector of the ACE2-Albumin recombinant protein to the cells;
(3) culturing the transfected cells and recovering the ACE2-Albumin recombinant protein.
9. The method for expressing the ACE2-Albumin recombinant protein according to claim 8, wherein the cell is a eukaryotic or prokaryotic cell, including but not limited to FreeStyle 293-F.
10. Use of the ACE2-Albumin recombinant protein as claimed in any one of claims 1 to 4 in the manufacture of a kit or medicament for the detection and treatment of a coronavirus.
CN202010375623.2A 2020-05-07 2020-05-07 ACE2-Albumin recombinant protein and preparation method and application thereof Pending CN111635461A (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN202010375623.2A CN111635461A (en) 2020-05-07 2020-05-07 ACE2-Albumin recombinant protein and preparation method and application thereof

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN202010375623.2A CN111635461A (en) 2020-05-07 2020-05-07 ACE2-Albumin recombinant protein and preparation method and application thereof

Publications (1)

Publication Number Publication Date
CN111635461A true CN111635461A (en) 2020-09-08

Family

ID=72328324

Family Applications (1)

Application Number Title Priority Date Filing Date
CN202010375623.2A Pending CN111635461A (en) 2020-05-07 2020-05-07 ACE2-Albumin recombinant protein and preparation method and application thereof

Country Status (1)

Country Link
CN (1) CN111635461A (en)

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN111986817A (en) * 2020-08-21 2020-11-24 南通大学 Method for screening new crown COVID-19 therapeutic drug through ACE2
CN112794918A (en) * 2021-02-22 2021-05-14 中国科学院微生物研究所 Human ACE2 modified protein and ACE2-hFc antibody protein for novel coronavirus

Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN1884303A (en) * 2005-06-20 2006-12-27 中国医学科学院基础医学研究所 SARS-CoV virus structural protein infusion protein and its high yield expression and purification and uses
CN107759697A (en) * 2016-08-19 2018-03-06 安源生物科技(上海)有限公司 The method for preparing fusion protein
CN108026143A (en) * 2015-07-24 2018-05-11 韩美药品株式会社 The method for preparing physiological active polypeptide conjugate
CN109265554A (en) * 2018-08-31 2019-01-25 美康生物科技股份有限公司 A kind of Angiotensin II immunogene and preparation method thereof

Patent Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN1884303A (en) * 2005-06-20 2006-12-27 中国医学科学院基础医学研究所 SARS-CoV virus structural protein infusion protein and its high yield expression and purification and uses
CN108026143A (en) * 2015-07-24 2018-05-11 韩美药品株式会社 The method for preparing physiological active polypeptide conjugate
CN107759697A (en) * 2016-08-19 2018-03-06 安源生物科技(上海)有限公司 The method for preparing fusion protein
CN109265554A (en) * 2018-08-31 2019-01-25 美康生物科技股份有限公司 A kind of Angiotensin II immunogene and preparation method thereof

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
LIU P.等: "Novel ACE2-Fc chimeric fusion provides long-lasting hypertension control and organ protection in mouse models of systemic renin angiotensin system activation", 《KIDNEY INTERNATIONAL》 *

Cited By (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN111986817A (en) * 2020-08-21 2020-11-24 南通大学 Method for screening new crown COVID-19 therapeutic drug through ACE2
CN112794918A (en) * 2021-02-22 2021-05-14 中国科学院微生物研究所 Human ACE2 modified protein and ACE2-hFc antibody protein for novel coronavirus
CN112794918B (en) * 2021-02-22 2023-08-15 中国科学院微生物研究所 Human ACE2 remodelling protein and ACE2-hFc antibody protein aiming at novel coronavirus

Similar Documents

Publication Publication Date Title
US4745051A (en) Method for producing a recombinant baculovirus expression vector
CN111893097A (en) Coronavirus pseudovirus packaging system and one-step packaging method
NO173944B (en) PROCEDURE FOR THE PREPARATION OF A RECOMBINANT BACULOVIRUS EXPRESSION VECTOR
US6759575B2 (en) Barstar gene
BRPI0713112A2 (en) short-chain volatile hydrocarbon production using microalgae, cyanobacteria or genetically engineered bacteria
CN111635461A (en) ACE2-Albumin recombinant protein and preparation method and application thereof
CN109142740A (en) The diagnosis of neurological autoimmune disease
RU2730667C2 (en) Gene-therapeutic dna-vector based on gene-therapeutic dna-vector vtvaf17, carrying target gene selected from group of genes krt5, krt14, lamb3, col7a1, to increase level of expression of these target genes, method for production and use thereof, strain escherichia coli scs110-af/vtvaf17-krt5, or escherichia coli scs110-af/vtvaf17-krt14, or escherichia coli scs110-af/vtvaf17-lamb3, or escherichia coli scs110-af/vtvaf17-col7a1, carrying gene-therapeutic dna vector, method for production thereof, method for industrial production of gene-therapeutic dna vector
CN113699186A (en) Gene expression cassette, lentiviral vector and application thereof in treatment of beta thalassemia
KR20220161297A (en) new cell line
CN1425075A (en) Differential expression screening method
CN111548421B (en) CSF1-Albumin recombinant protein and preparation method and application thereof
CN114874332B (en) Use of modified RNF112 as a medicament for the treatment of ALS
AU609183B2 (en) Antimalaria vaccines
CN110050065B (en) Early post-transfection isolation (EPIC) of cells for biologicals production
CN113699090B (en) Method for constructing propionic acid producing bacteria
CN113186140B (en) Genetically engineered bacteria for preventing and/or treating hangover and liver disease
CN106520837A (en) Recombinant vector and application thereof
KR20230082026A (en) Compositions and methods for simultaneously regulating the expression of genes
CN107384958A (en) The anti-geneome plasmids of RSV and its application based on reverse genetics structure
CN111826397A (en) Method for producing recombinant target protein, overexpression vector and virus suspension
CN114959919A (en) Method for constructing saccharomyces cerevisiae artificial small promoter library and application
CN113684240B (en) Method for preparing bleomycin high-yield strain by utilizing in-situ multiplication blm gene cluster and double reporter genes and application thereof
US20230174955A1 (en) Monomeric proteins for hydroxylating amino acids and products
CN107815435A (en) The gluconacetobacter of cellulose production capacity with enhancing

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
RJ01 Rejection of invention patent application after publication
RJ01 Rejection of invention patent application after publication

Application publication date: 20200908