CN111621588A - Molecular marker for breeding bright peel tomato variety and application thereof - Google Patents
Molecular marker for breeding bright peel tomato variety and application thereof Download PDFInfo
- Publication number
- CN111621588A CN111621588A CN202010510611.6A CN202010510611A CN111621588A CN 111621588 A CN111621588 A CN 111621588A CN 202010510611 A CN202010510611 A CN 202010510611A CN 111621588 A CN111621588 A CN 111621588A
- Authority
- CN
- China
- Prior art keywords
- tomato
- molecular marker
- breeding
- fruit
- bright
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/6895—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
-
- A—HUMAN NECESSITIES
- A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
- A01H—NEW PLANTS OR NON-TRANSGENIC PROCESSES FOR OBTAINING THEM; PLANT REPRODUCTION BY TISSUE CULTURE TECHNIQUES
- A01H1/00—Processes for modifying genotypes ; Plants characterised by associated natural traits
- A01H1/04—Processes of selection involving genotypic or phenotypic markers; Methods of using phenotypic markers for selection
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/13—Plant traits
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/156—Polymorphic or mutational markers
Landscapes
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Health & Medical Sciences (AREA)
- Organic Chemistry (AREA)
- Genetics & Genomics (AREA)
- Engineering & Computer Science (AREA)
- Analytical Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Biotechnology (AREA)
- Botany (AREA)
- General Health & Medical Sciences (AREA)
- Mycology (AREA)
- Biophysics (AREA)
- Immunology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Physics & Mathematics (AREA)
- Environmental Sciences (AREA)
- Developmental Biology & Embryology (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention relates to the field of tomato molecular marker breeding, in particular to a molecular marker for breeding a bright-peel tomato variety and application thereof. The invention constructs F2 segregation population by utilizing tomato spontaneous mutant glossy and wild tomato LA1375, locates the glossy gene in the range of No. 1 chromosome 600kb by utilizing BSR positioning strategy and linkage analysis, obtains molecular marker GLS closely linked with the glossy gene, and utilizes the molecular marker and primers thereof to breed tomato varieties, thereby providing resources for the development of special tomato varieties and laying a foundation for the biological research of fruit development.
Description
Technical Field
The invention belongs to the field of tomato breeding, and particularly relates to a molecular marker for breeding a bright-peel tomato variety and application thereof.
Background
Tomato epidermis, the cuticle membrane, is the first barrier for plant self-protection and plays an important role in the growth and development of plants. The cuticle membrane is the action interface of the plant and the environment, and can seal plant cells, reduce the plant from being subjected to biotic and abiotic stress, such as reducing water loss except stomatal transpiration, and reduce pathogenic infection and insect feeding. The cuticle membrane can also effectively block mechanical injury, and polysaccharide in the cuticle can influence the compactness and the firmness of plant cutin, thereby influencing the tension and the density of the plant exocuticle. Tomato cuticle can affect the resistance and storage of the fruit, and can also affect the sensory quality and flavor of the fruit to a great extent, especially the edible taste.
Preserved fruits and dried fruits are still popular in modern society as traditional food. The tomato can be used as vegetable and fruit, and can be further processed into preserved fruit and dried fruit. The conventional processing process of the preserved or dried tomato needs to be carried out by the processes of cleaning, blanching, peeling, hardening, sugar permeating, airing or drying and the like, so that rich water in the tomato is removed and the sugar permeating is promoted, but the loss of vitamins and lycopene is caused in the peeling process.
Based on the molecular marker, the molecular marker which can quickly breed the tomato variety with thin and volatile peel and is suitable for making dried fruits is developed, and is applied to the field of tomato breeding, so that the molecular marker has important significance.
Disclosure of Invention
Based on the molecular marker, the invention aims to provide the molecular marker for breeding the bright peel tomato variety and the application of the molecular marker in tomato breeding.
The technical scheme for solving the technical problems is as follows:
the invention provides a molecular marker for breeding tomato variety with bright peel, which takes tomato reference genome of version 2.5 as a standard, the molecular marker is a 58bp nucleotide insert located at 85257792bp of tomato chromosome 1, and the nucleotide sequence of the molecular marker is shown as SEQ ID NO: 1 is shown.
The protection range of the invention also relates to all amplification primers or hybridization probes capable of detecting the molecular markers, and all the primers or probes capable of detecting the molecular markers can be used for breeding the tomato variety with bright pericarp.
Specifically, the nucleotide sequence of the primer marked by one pair of molecules is as follows:
a forward primer: TCCTAGACTTCTAGAAATACGTGTGG, as shown in SEQ ID NO: 2 is shown in the specification;
reverse primer: TGGAAAAGAAAGGAGAAAGGATGAC, as shown in SEQ ID NO: 3, respectively.
The invention also provides an acquisition method of the molecular marker, which comprises the following steps:
(1) discovery and characterization of mutants
The mutant is spontaneously generated in the tissue culture process of tomato variety Alisa Craig, the mutant fruit shows that the peel is thin and bright, the slag melting property is good when the mutant is eaten, the mutant is melted in the mouth, the taste is good, and the mutant is named as glosssy. The glossy tomatoes have tender and thin surfaces, are easy to lose moisture and penetrate exogenous substances, can be used as raw materials of preserved fruits and dried fruits, do not need to be peeled during processing, can reduce the loss of nutrient substances and can ensure that processed products have good appearance; in addition, the tender skin of the tomato also enables the tomato fresh food to have good mouthfeel and bright appearance, and has favorable characters of attractive purchase. The mutant fruit phenotype is shown in figure 1. Through genetic research, it is found that the glosy can be stably inherited and is a stable variation.
(2) Development of molecular markers closely linked to glosssy
The glossy mutant is hybridized with tomato wild germplasm LA1375 to obtain F1 generation, F1 generation is selfed to obtain F2 generation, 563 strain F2 single plant is fixedly planted, and the fruit phenotype can be accurately identified when the tomato fruit is green and ripe. 138 individuals with fruit glosssy in the F2 population were found to have a chi-squared value of 0.8657, less than the chi-squared threshold with a degree of freedom of 1, using the chi-squared test
The mutation was judged to match the 3:1 segregation ratio, indicating that the glossy is under the control of a recessive monogene.
(3) Gene mapping and molecular marker development
Selecting 30 plants with fruit phenotypes of wild type and glosy respectively in the green and mature period of the fruit, selecting one fruit for each plant, cutting the epidermis of the fruit into equal amount of mixed samples, extracting RNA, sending the RNA to a company for RNA-seq, calculating the genotype frequency of single nucleotide polymorphic sites in two mixed pools and the difference value thereof, and obtaining the approximate position of the glosy through statistical analysis of the difference value, wherein the positioning strategy is BSR. Based on the initial localization of BSR, the glossy is located at the end of chromosome 1.
Comparing tomato reference genome with re-sequencing data of glossy and LA1375, extracting variation sites of insertion/deletion type, designing primers and screening polymorphic markers to lock the segment of interest within 0.798M. Expanding the F2 population to 2586 strains, further developing molecular markers, locking the target segment in a 600kb range and obtaining a molecular marker GLS closely linked with the target segment and a detection primer thereof, wherein the nucleotide sequence of the molecular marker GLS is shown as SEQ ID NO: 1 is shown in the specification;
the invention also provides application of the molecular marker in breeding of tomato varieties with bright pericarp. Wherein the donor material used in this application comprises a glosy mutant.
The invention also aims to provide a kit for detecting the molecular marker. Wherein the kit comprises the primer.
The invention also aims to provide the application of the tomato with bright peel screened by the molecular marker in preparing dried fruit products.
The invention constructs F2 segregation population by utilizing tomato spontaneous mutant glossy and wild tomato LA1375, locates the glossy gene in the range of No. 1 chromosome 600kb by utilizing BSR positioning strategy and linkage analysis, obtains molecular marker GLS closely linked with the glossy gene, and utilizes the molecular marker and a detection primer thereof to breed and breed tomatoes, thereby providing resources for the development of special tomato varieties and laying a foundation for the biological research of fruit development.
In the conventional breeding method, the breeding of the tomato variety with bright peel or dried fruit is required to wait until the mature period of the fruit, a large amount of time and energy are wasted, and the selection efficiency is low, but the molecular marker related to the tomato variety can be eliminated in the seedling period by detecting the molecular marker, so that the production cost is saved, the selection efficiency is greatly improved, the environmental influence is avoided, an excellent single plant can be screened out in the early stage, the material planting scale and the breeding time are reduced, the method can be applied to the breeding of the tomato variety with good slagging property and bright appearance, and can also be applied to the development of the tomato variety suitable for the production of dried fruit food.
Drawings
FIG. 1 is a comparison of the phenotype of a fruit of a mutant glosy and a wild type tomato, wherein glosy represents the mutant glosy and WT represents the wild type tomato;
FIG. 2 shows BSR analysis results;
FIG. 3 is the result of gel electrophoresis of the amplification product of the GLS molecular marker of example 2, wherein g/g represents recessive genotype; G/G represents a dominant genotype; G/G indicates heterozygous genotype.
Detailed Description
The principles and features of this invention are described below in conjunction with specific embodiments, the examples given are intended to illustrate the invention and are not intended to limit the scope of the invention. Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. The terminology used in the description of the invention herein is for the purpose of describing particular embodiments only and is not intended to be limiting of the invention.
Test materials:
the Glossy mutant is obtained in the tissue culture process of the Alisa Craig tomato material in the laboratory, the fruit is thin and bright in peel, good in slag melting property when being eaten, instantly melted in the mouth, good in taste, and easy to lose moisture, and can be obtained by the public from an applicant and only used for repeated experiments.
The tomato wild germplasm LA1375 is obtained from the tomato genetic resource center TGRC, and has the phenotype of thick fruit surface and generally bright color.
Example 1
The development of molecular markers for breeding tomato varieties with bright peel or dried fruits comprises the following specific steps:
s1, hybridizing by taking glossy as a female parent and tomato wild germplasm LA1375 as a male parent to obtain an F1 generation; plants from F1 were self-pollinated to give F2 generations.
S2, sowing seeds in plastic shed and planting 563 plants F2. And (4) normal management, wherein the phenotype can be basically judged 2-3 weeks after fruit setting, and the phenotype in the green mature period is obvious and stable. Each plant investigates more than 3 fruits, the glosssy mutant fruits have bright color and sticky hand feeling when touching, and the normal fruits have matte color and smooth touch. If more than 3 fruits are all bright and sticky, the glosy phenotype is judged as recessive, otherwise, the glosy phenotype is dominant.
138 individuals with fruit glosssy in the F2 population were found to have a chi-squared value of 0.8657, less than the chi-squared threshold with a degree of freedom of 1, using the chi-squared test
The mutation was judged to match the 3:1 segregation ratio, indicating that glossy is recessive monogenic control.
S3, selecting 30 plants of which the fruit phenotypes are wild type and glosy respectively in the green and mature period of the fruit, selecting a fruit for each plant, cutting the epidermis of the fruit into equal amount of mixed samples, extracting RNA, and sending the RNA to a company for RNA-seq, wherein the gene positioning strategy is BSR. And after obtaining mixed pool RNA-seq sequencing data, performing quality evaluation on the sequencing data by using FastQC software, and performing quality control on the sequencing data by using Trimmomatic to remove joints, low-quality reads with more N. Thereafter, the various reads were aligned to version 2.5 tomato reference genome using hisat2, the obtained alignment file data extracted polymorphic SNPs using samtools software and autonomously developed Perl script, the maximum allele-frequency SNP-index of the recessive pool and the frequency of this SNP in the dominant pool were calculated, and the euclidean distance (ED value) of each SNP site was calculated. And filtering out sites with the sequencing depth of both pools lower than 15 reads and SNP-index greater than 0.7, performing linear regression fitting after the ED value is raised to the power, and mapping, wherein 3 times of the sum of median values and standard deviations of power fitting values of all the sites is used as a threshold line, and the sections higher than the threshold line are used as candidate sections. According to the initial positioning result of the BSR (as shown in fig. 2), the initial positioning interval of the glosy is determined as follows: and (2) Chr 1: 84443855 to 88138301.
S4, combining with re-sequencing data (wild currant tomato germplasm LA1375 has been re-sequenced, the related sequence information is detailed in http:// solgenomics. net. genome re-sequencing is performed on the glosy mutant by HiSeq4000 sequencing platform in the laboratory.) and utilizing GATK to identify the polymorphic SNP and InDel in the candidate segments of the two pools, identifying the InDel marker and designing a detection primer according to an autonomously developed program, and combining with recombinant single strain analysis, positioning the target segment in the range of 0.798M.
S5, F2 segregation of the large population of the population using glossy × LA1375 further yields molecular markers closely linked to glossy.
The method comprises the following specific steps:
(1) expanding the F2 population of glossy × LA1375 to 2586 strain;
(2) the sequences of detection primers of the developed 3 polymorphic molecular markers are respectively as follows:
L-F：CTTATAGTCTTCTAGGTTATTCCTTTGG
L-R：ACGACCAAGATTGACTTAACCTG
M-F：ACACTCCAACAGTAGGATTGGTTTG
M-R：GTGACAAATGCTATTTTGACAGCATAC
R-F：ACTTGTTGTGCGTGCCTTAATG
R-R：CACAATTGATCCATGAGTTTATGAGATG
obtaining the genotype of each plant, and obtaining 661 individual plants with recessive target segments;
(3) and (3) utilizing the 661 recessive individuals to obtain 7 important recombinant individuals by combining molecular marker identification, and determining that fruits of the 7 individuals are all glosys phenotypes through phenotypic identification. Thus locating the glosssy within 600kb and obtaining the molecular marker GLS closely linked to the glosssy, which is an insertion/deletion marker, with a fragment size of 58bp and a sequence shown in seq id NO: 1 is shown.
(4) A pair of primer sequences for detecting the molecular marker GLS are as follows:
GLS-F：TCCTAGACTTCTAGAAATACGTGTGG(SEQ ID NO：2)
GLS-R：TGGAAAAGAAAGGAGAAAGGATGAC(SEQ ID NO：3)。
the sequence amplified by the primer sequence in the mutant is shown as SEQ ID NO: 4, respectively.
Example 2
Using the molecular marker GLS and the primer sequences obtained in example 1, 13 plant materials obtained from the glossy mutant as donor material were identified and compared with their fruit phenotypes, as follows:
(1) the tomato related strain genome DNA is used as a template, a primer is GLS, and a reaction system and a program recommended by Easy Taq polymerase of Beijing all-purpose gold biotechnology limited are used for amplification, and a PCR product is detected by 2 percent agarose gel electrophoresis.
Wherein, the PCR amplification reaction system in the technical scheme comprises the following components according to the total volume of 15 mul:
the PCR amplification reaction conditions are as follows: pre-denaturation at 94.0 deg.C for 3 min; denaturation at 94.0 deg.C for 30s, renaturation at 55.0 deg.C for 30s, and extension at 72.0 deg.C for 30s, and circulating for 33 times; extending for 5min at 72.0 deg.C, and storing at 4 deg.C.
(2) Analysis of results
The amplification results may appear as follows:
in the first case: a 195bp strip appears, which shows that the fruit is homozygous dominant and the phenotype is normal fruit;
in the second case: a 253bp strip appears, the fruit is homozygous and recessive, and the phenotype is bright fruit;
in the third case: if a 195bp band and a 253bp band appear simultaneously, the fruit is heterozygous, and the phenotype is normal.
The results for 13 plant materials are shown in FIG. 3, where 4 normal fruits and 9 bright fruits were identified as the mature fruit phenotype.
The above description is only for the purpose of illustrating the preferred embodiments of the present invention and is not to be construed as limiting the invention, and any modifications, equivalents, improvements and the like that fall within the spirit and principle of the present invention are intended to be included therein.
Sequence listing
<110> university of agriculture in Huazhong
<120> molecular marker for breeding tomato variety with bright peel and application thereof
<160>4
<170>SIPOSequenceListing 1.0
<210>1
<211>58
<212>DNA
<213>InDel(Tomato)
<400>1
aaattatttc atgaatttta taatgtgaga cattaaaatt aatattaatt gtgtgaag 58
<210>2
<211>26
<212>DNA
<213> Artificial sequence (GLS-F)
<400>2
tcctagactt ctagaaatac gtgtgg 26
<210>3
<211>25
<212>DNA
<213> Artificial sequence (GLS-R)
<400>3
tggaaaagaa aggagaaagg atgac 25
<210>4
<211>253
<212>DNA
<213> Tomato (Tomato)
<400>4
tcctagactt ctagaaatac gtgtggataa caattttatg tttaaattaa aattaatatt 60
aattgtgtga agaaaattat ttcatgaatt ttataatgtg agacattaaa attaatatta 120
attgtgtgaa gaaattattt catgaatttt ataatgtgag acccattaca atctaacttc 180
accttcttcc taattctttc tttctttgtt cctttttctt cattttttgt catcctttct 240
cctttctttt cca 253
Claims (9)
1. The molecular marker for breeding the tomato variety with bright peel is characterized in that a tomato reference genome of version 2.5 is taken as a standard, the molecular marker is a 58bp nucleotide insert located at 85257792bp of tomato chromosome 1, and the nucleotide sequence of the molecular marker is shown as SEQ ID NO: 1 is shown.
2. Detecting the molecularly imprinted amplification primer or hybridization probe of claim 1.
3. The primer for detecting the molecular marker of claim 1, according to claim 2, wherein the nucleotide sequence of the primer is as follows:
a forward primer: TCCTAGACTTCTAGAAATACGTGTGG, as shown in SEQ ID NO: 2 is shown in the specification;
reverse primer: TGGAAAAGAAAGGAGAAAGGATGAC, as shown in SEQ ID NO: 3, respectively.
4. The method for obtaining a molecular marker according to claim 1, comprising the steps of:
hybridizing the glossy mutant with tomato wild germplasm LA1375 to obtain F1 generation, and selfing the F1 generation to obtain F2;
f2 identifying fruit phenotype when the fruit is green and ripe, and determining that the glosy is a single recessive gene;
selecting fruits with different plants with the phenotypes of wild type and mutant type respectively, cutting the same amount of mixed samples of fruit epidermis, extracting RNA, performing RNA-seq, performing initial positioning by using a BSR gene positioning strategy, and positioning the glossy in the range of No. 1 chromosome 4M;
using the re-sequencing data of glossy and LA1375 to design and screen for polymorphic markers, analysis of recombination events in the F2 population, locking the segment of interest within the 0.798M range;
the F2 population was expanded, molecular markers were further developed, the segment of interest was locked in the 600kb range and the molecular marker GLS closely linked to it was obtained.
5. The use of the molecular marker of claim 1 in the breeding of tomato varieties having bright pericarp.
6. Use of a molecular marker according to claim 1 for the selective breeding of tomato varieties with bright pericarp, wherein the donor material used in the breeding of tomato comprises a glosy mutant.
7. A kit for detecting the molecular marker of claim 1.
8. The kit for detecting the molecular marker of claim 1 according to claim 7, comprising the primer of claim 2.
9. Use of the bright peel tomato of claim 1 in the preparation of a dried fruit product.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202010510611.6A CN111621588A (en) | 2020-06-08 | 2020-06-08 | Molecular marker for breeding bright peel tomato variety and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202010510611.6A CN111621588A (en) | 2020-06-08 | 2020-06-08 | Molecular marker for breeding bright peel tomato variety and application thereof |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN111621588A true CN111621588A (en) | 2020-09-04 |
Family
ID=72257264
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202010510611.6A Pending CN111621588A (en) | 2020-06-08 | 2020-06-08 | Molecular marker for breeding bright peel tomato variety and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN111621588A (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN112538487A (en) * | 2020-12-24 | 2021-03-23 | 南京农业大学 | Tomato irregular fruit cracking key regulatory gene and identification method and application thereof |
Citations (7)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1352680A (en) * | 1999-01-12 | 2002-06-05 | 吉尼西斯研究及发展有限公司 | Compositions isolated from plant cell and their use in the modification of plant cell signaling |
| CN101076592A (en) * | 2004-10-12 | 2007-11-21 | 洛克菲勒大学 | Micro rna |
| CN105874072A (en) * | 2013-12-30 | 2016-08-17 | 库瑞瓦格股份公司 | Artificial nucleic acid molecules |
| US20160319361A1 (en) * | 2013-08-28 | 2016-11-03 | Caris Life Sciences Switzerland Holdings Gmbh | Oligonucleotide probes and uses thereof |
| WO2018097677A1 (en) * | 2016-11-28 | 2018-05-31 | Samsung Electronics Co., Ltd. | Image processing apparatus, image processing method, and computer-readable recording medium thereof |
| CN109468408A (en) * | 2019-01-02 | 2019-03-15 | 华中农业大学 | A kind of molecular labeling and application with tomato Drought-tolerant gene close linkage |
| CN110257550A (en) * | 2019-07-30 | 2019-09-20 | 华中农业大学 | One kind chromosomal structural variation molecular labeling relevant to Tomato Fruit Color, special primer and its application |
-
2020
- 2020-06-08 CN CN202010510611.6A patent/CN111621588A/en active Pending
Patent Citations (7)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1352680A (en) * | 1999-01-12 | 2002-06-05 | 吉尼西斯研究及发展有限公司 | Compositions isolated from plant cell and their use in the modification of plant cell signaling |
| CN101076592A (en) * | 2004-10-12 | 2007-11-21 | 洛克菲勒大学 | Micro rna |
| US20160319361A1 (en) * | 2013-08-28 | 2016-11-03 | Caris Life Sciences Switzerland Holdings Gmbh | Oligonucleotide probes and uses thereof |
| CN105874072A (en) * | 2013-12-30 | 2016-08-17 | 库瑞瓦格股份公司 | Artificial nucleic acid molecules |
| WO2018097677A1 (en) * | 2016-11-28 | 2018-05-31 | Samsung Electronics Co., Ltd. | Image processing apparatus, image processing method, and computer-readable recording medium thereof |
| CN109468408A (en) * | 2019-01-02 | 2019-03-15 | 华中农业大学 | A kind of molecular labeling and application with tomato Drought-tolerant gene close linkage |
| CN110257550A (en) * | 2019-07-30 | 2019-09-20 | 华中农业大学 | One kind chromosomal structural variation molecular labeling relevant to Tomato Fruit Color, special primer and its application |
Non-Patent Citations (3)
| Title |
|---|
| ANJUM NAWAB等: ""Mango kernel starch as a novel edible coating for enhancing shelf- lifeof tomato (Solanum lycopersicum) fruit"", 《INTERNATIONAL JOURNAL OF BIOLOGICAL MACROMOLECULES》 * |
| YUANYUAN PU等: ""A novel dominant glossy mutation causes suppression of wax biosynthesis pathway and deficiency of cuticular wax in Brassica napus"", 《BMC PLANT BIOLOGY》 * |
| 刘辉等: ""番茄低温响应转录因子SlNAC41克隆及表达分析"", 《植物生理学报》 * |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN112538487A (en) * | 2020-12-24 | 2021-03-23 | 南京农业大学 | Tomato irregular fruit cracking key regulatory gene and identification method and application thereof |
| CN112538487B (en) * | 2020-12-24 | 2022-04-19 | 南京农业大学 | Tomato irregular fruit cracking key regulatory gene and identification method and application thereof |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US10945396B2 (en) | Hybrid cantaloupe plant named Earlypac | |
| US10945392B2 (en) | Hybrid cantaloupe plant named HM8970 | |
| HUE028201T2 (en) | Improved pepper plant | |
| US20190029206A1 (en) | Hybrid tomato plant named hm 7182 | |
| US11197441B1 (en) | Hybrid cantaloupe plant named SUN PAC | |
| US11202423B1 (en) | Hybrid cantaloupe plant named sweet spot | |
| US11197440B1 (en) | Hybrid cantaloupe plant named PRIME PAC | |
| US11197439B1 (en) | Hybrid cantaloupe plant named HMX47D2514 | |
| US20210289731A1 (en) | Hybrid pumpkin plant named hmx6821 | |
| US20210329866A1 (en) | Hybrid pumpkin plant named hmx0686 | |
| US20210329871A1 (en) | Hybrid cantaloupe plant named hmc454326 | |
| Ramtekey et al. | Molecular tagging of photoperiod responsive flowering in Indian bean [Lablab purpureus (L.) Sweet] | |
| CN113736910A (en) | Linkage molecular marker of peanut single plant pod number main effect QTL site qPN7 and application thereof | |
| CN111621588A (en) | Molecular marker for breeding bright peel tomato variety and application thereof | |
| US20180265887A1 (en) | Basil Plants With High Tolerance to Downy Mildew | |
| CN113846178B (en) | SNP molecular marker closely linked with major QTL of sweet corn grain size and application thereof | |
| US11350586B2 (en) | Hybrid cucumber plant named DIXON | |
| WO2022208489A1 (en) | Semi-determinate or determinate growth habit trait in cucurbita | |
| WO2022090188A1 (en) | Novel type of long shelf-life melon plants | |
| CN114262749A (en) | Molecular marker primer pair, kit and detection method for loquat pulp color and application | |
| CN108165661B (en) | Molecular marker closely linked with rice taste related QTL and screening method thereof | |
| CA3121350A1 (en) | Solanaceous plant capable of stenospermocarpic fruit formation | |
| US11647713B2 (en) | Hybrid cantaloupe plant named deputy | |
| US11647712B2 (en) | Hybrid cantaloupe plant named HMC460066 | |
| US11930754B2 (en) | Hybrid cucumber plant named HM 258 |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| RJ01 | Rejection of invention patent application after publication | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20200904 |