CN108165661B - Molecular marker closely linked with rice taste related QTL and screening method thereof - Google Patents
Molecular marker closely linked with rice taste related QTL and screening method thereof Download PDFInfo
- Publication number
- CN108165661B CN108165661B CN201810220212.9A CN201810220212A CN108165661B CN 108165661 B CN108165661 B CN 108165661B CN 201810220212 A CN201810220212 A CN 201810220212A CN 108165661 B CN108165661 B CN 108165661B
- Authority
- CN
- China
- Prior art keywords
- rice
- molecular marker
- closely linked
- taste
- qtl
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/6895—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/13—Plant traits
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/156—Polymorphic or mutational markers
Abstract
The invention discloses a molecular marker closely linked with rice flavor related QTL and a screening method thereof, wherein the nucleotide sequence of the molecular marker is shown as a sequence table SEQ ID NO. 1, and the screening method comprises the following steps: constructing an F4 generation separation population; extracting individual genome DNA of father and mother parents, F1 generations and F4 generations; constructing a genetic linkage map; positioning a rice taste related QTL by utilizing a genetic linkage map; developing a molecular marker closely linked with a rice taste related QTL; and preparing the molecular marker. Based on the technical scheme, the molecular marker which is closely linked with the postprandial sweet return gene of the rice is screened out, whether the rice contains the rice-flavor sweet return gene or not can be quickly detected by applying the molecular marker, and the rice breeding practice can be simply, quickly and high-flux carried out.
Description
Technical Field
The invention relates to the technical field of genetic engineering, in particular to a molecular marker closely linked with a rice taste related QTL and a screening method thereof.
Background
The rice is one of the most important grain crops in China, the planting area accounts for 30% of the grain crop area, the yield accounts for 40% of the total grain yield, and the rice is staple food for more than 60% of people in China. Therefore, the improvement of the rice production level is always a great problem related to the agricultural development and the stability of the people in China. However, the demand for rice production is increasing in the past to obtain high yields and to meet the demand for rice quality. Particularly, in China, with the rapid development of economy, the living standard of people is continuously improved, so that a new variety with better taste and appearance must be further cultivated while considering the yield in rice production in China. Rice quality refers to various characteristics of grains or commodities in the whole process from the production of rice to the processing into direct consumption products. One generally divides the quality of rice into 4 aspects, namely, the quality of appearance, the quality of milling, the quality of cooking and taste, and the quality of nutrition. The improvement of living standard leads people to have higher and higher demand for high-quality rice, and in recent years, the nation has brought new heights to the breeding and planting of high-quality rice. In domestic high-quality rice production areas such as south China glutinous rice and northeast China rice floral-scented series, the purchase price of the rice is 1.5 to 2 times that of the common rice. The oil-sticky rice is high-quality rice, has long and thin rice grains, is glittering and translucent, is glossy and shiny, is fragrant, smooth and soft, and leaves fragrance on teeth and cheeks after meals. The rice is cooked in an earthen pot, so that the fragrance of the rice overflows, the rice surface is oily, and rice grains are placed on paper and left with oil stains, so that the rice is called oil-sticky rice. The good-quality fragrant and soft taste and the sweet taste after meals are favored by more and more consumers, and the market demand is increasing. However, no literature reports exist on the current research on the aspect. Therefore, the research on the inheritance and molecular mechanism of the rice aroma and softness and the postprandial sweet taste has important guiding significance for the high-quality breeding of the rice.
Molecular Marker Assisted Selection (MAS) is a technique for identifying whether a population contains an individual of a target gene by means of a molecular Marker closely linked to the target gene. The MAS technology can greatly shorten the period of breeding and breeding, and enables a breeder to obtain target single plants with stable heredity more quickly. For quantitative traits such as the cooked taste trait, favorable QTLs can be dynamically tracked during breeding using molecular markers, and these favorable QTL loci can be aggregated into a target breeding material, thereby breeding a new variety with more excellent performance. Therefore, the key to develop MAS lies in the positioning of important trait-related QTL and the development of related molecular markers.
Researches show that the taste quality of rice is complex, is controlled by multiple genes and belongs to complex characters. In the taste quality research report, the amylose content and the amylopectin structure have large influence on the food quality, and a plurality of QTLs or genes related to starch content and synthesis are positioned or cloned.
The amylose content is one of the important indexes for measuring the quality of the cooked taste of rice. Granular starch-binding enzyme (GBSS) that catalyzes amylose synthesis in rice is encoded by the rice waxy gene (Wx) and located on chromosome 6. The synthesis of amylose content and the expression of the Wx gene are under the control of low amylose mutant genes in addition to the influence of Wx itself. The mutant genes reported to date for controlling low amylose content fall into two broad categories, allelic and non-allelic, with the Wx gene. The investigator used NIL10 to locate qAC2, located on chr02, which is a QTL capable of interacting with Wx to control low amylose content in rice. Within the 840-kb interval on the long arm of chromosome 6, the SSR markers RM20662 and RM412 are located between du12(t), cosegregating with RM3765 and RM 176. Another investigator cloned Dul on chromosome 10, which encodes a novel Prp1 protein that regulates amylose synthesis by pre-mRNA cleavage via action Wxb. The low amylose gene du can be mapped to rice chromosome 6 using mutants 2035 and EM47, and one du gene can be mapped to rice chromosome 9 using low amylose mutant 2120. Researchers have crossed 8 mutants with low amylose content with normal rice varieties and analyzed the amylose content of F1 and F2 seeds, and found that the low amylose content of the mutants is controlled by a recessive single gene, and 5 gene loci exist in total, namely du-1, du-2, du-3, du-4 and du-5. These sites are not allelic with wx and have an additive effect, with du-1 being mapped to rice chromosome 7 and du-4 to chromosome 4.
The amylopectin structure of rice affects the gelatinization problem of starch. The chain length and chain length distribution of amylopectin, the average chain length and central chain length distribution determine the gelatinization temperature of the starch, and the longer the branched chain, the higher the gelatinization temperature. The ALK gene encodes soluble starch synthase II and controls the gelatinization temperature of rice. Researchers use Bikezao-Cbao as a parent to position ALK on the 6 th chromosome of rice, and the change of amino acid in an ALK gene coding product can cause the change of the activity of starch synthetase, thereby influencing the synthesis of medium-length branch chains of amylopectin, changing the crystal layer structure and finally showing the change of gelatinization temperature. The starch synthetase IIIa influences the structure, amylose content and starch grain physical and chemical properties of amylopectin in rice grains, and if a gene for coding IIIa is deleted or mutated, the starch related properties in the grains are changed. Researchers obtained 1 part each of the IIIa mutants, 2 mutant lines allelic, by reversing the transposon Tos17 insertion and MNU treatment. B2 to B4 branches with a Degree of Polymerization (DP) greater than 30 in the mutant were reduced to 60% in the wild type; branches with polymerization degree of 6-9 and branches with polymerization degree of 16-19 are reduced, while branches with polymerization degree of 10-15 and 20-25 are increased; the amylose content and amylopectin ultralong chains (DP greater than 500) are increased by 1.3 times and 12 times, respectively; the mutant starch granules were smaller circular and rarely transparent, and the starch synthase IIIa was cloned on chromosome 8 of rice.
At present, the research on the starch content of rice, the inheritance of starch synthetic genes and the positioning of QTLs is more, and a certain number of major genes are positioned. However, the rice still lacks sufficient QTLs and molecular markers for eating the mouth, including softness and hardness, after meal return sweetness and the like.
Disclosure of Invention
The invention aims to provide a method for screening molecular markers closely linked with rice taste related QTL. In order to achieve the above purpose, the invention provides the following technical scheme: a molecular marker closely linked with rice taste related QTL is disclosed, and the nucleotide sequence of the molecular marker is shown in a sequence table SEQ ID NO. 1.
Preferably, the molecular-labeled primers are:
a forward primer: CCTATGTGTAGAGGAGCAAT
Reverse primer: GCACGACACGATTAGTTAGT
A method for screening a molecular marker closely linked with a QTL related to rice taste of rice comprises the following steps:
(1) construction of F4 generation segregating population: hybridizing the male parent and the female parent to obtain F1, and then obtaining an F4 generation population through single seed transmission;
(2) extracting individual genome DNA of father and mother parents, F1 generations and F4 generations for later use;
(3) genotyping the F4 population, acquiring genotype data and constructing a genetic linkage map;
(4) carrying out QTL analysis by combining genetic linkage maps with phenotype data, and positioning the rice taste related QTL;
(5) developing molecular markers closely linked with rice taste related QTL: selecting a molecular marker close to the section where the meal taste related QTL is located, designing a primer, and screening the molecular marker with polymorphism and amplification stability by PCR amplification and agarose gel electrophoresis detection;
(6) preparing a molecular marker: and carrying out PCR amplification by using the genomic DNA of the male parent, the F1 generation or the F4 generation as a template and using a molecular marker amplification primer pair.
Preferably, step (1) specifically comprises: hybridizing the male parent and the female parent to obtain F1, bagging and selfing F1 to obtain F2, and adding two generations of F2 through single seed to obtain F4; the male parent is a breeding material SKO, and the female parent is late 97 fragrance.
Preferably, the step (2) of extracting genomic DNA specifically comprises the steps of:
weighing fresh leaves, shearing, grinding, adding 1.5 × CTAB, grinding into homogenate, transferring into a centrifuge tube, continuously washing a mortar with 1.5 × CTAB, transferring into the centrifuge tube, adding deionized water after water bath at 65 ℃, and adding mercaptoethanol before use;
b, cooling to room temperature, adding equal volume of chloroform/isoamylol, and uniformly mixing until the subnatant turns into dark green;
c, transferring the upper-layer water phase to a new centrifugal tube after centrifugation, adding 2 times volume of precooled absolute ethyl alcohol, and placing and precipitating DNA;
d, centrifuging, removing the supernatant, adding 75% ethanol, washing and precipitating for 1 time, inverting the centrifuge tube, drying DNA, and adding TE to dissolve DNA;
e, detecting the genomic DNA by using 0.8% agarose gel, and storing the obtained parental DNA and the genomic DNA of the individuals of the F1 generation and the F4 generation for later use.
Preferably, step (4) comprises: according to the individual phenotype of the F4 population, the individual phenotype with the similar paternal type character, the similar maternal type character and the character between the paternal and the maternal is marked respectively, the individual phenotype data is compared with the genotype data, and the rice taste related gene is positioned on the genetic linkage map.
Preferably, the PCR reaction system in step (6) is as follows:
preferably, the PCR reaction conditions in step (6) are: pre-denaturation at 94 ℃ for 5 min; denaturation at 94 ℃ for 30 seconds, annealing at 60 ℃ for 30 seconds, extension at 72 ℃ for 40 seconds, and running for 35 cycles; final extension at 72 ℃ for 3 min.
The technical scheme of the invention discloses a screening method of a molecular marker, based on the technical scheme, the molecular marker M2576 which is closely linked with the rice after-meal sweet return gene is screened, the genetic linkage distance between the molecular marker M2576 and the rice taste sweet return gene of rice is 2.6cM, the molecular marker M2576 can be used for detecting whether the rice contains the rice taste sweet return gene, and the rice breeding practice can be carried out simply, rapidly and in a high-throughput manner.
Drawings
FIG. 1 is a flow chart of screening molecular markers closely linked to rice taste-related QTLs in an exemplary embodiment.
Detailed Description
In order to make the technical staff understand the invention better, the following embodiment of the invention is explained in detail with reference to the attached drawings, but the invention is not limited. It is to be understood that the described embodiments are merely a few embodiments of the invention, and not all embodiments. All other embodiments, which can be derived by a person skilled in the art from the embodiments given herein without making any creative effort, shall fall within the protection scope of the present invention.
In a specific embodiment, the method for screening molecular markers closely linked to rice taste-related QTLs is shown in fig. 1 and comprises the following steps:
(1) generation F4 segregating populations were constructed. Specifically, the male parent is a breeding material SKO, the female parent is late 97 fragrance, the male parent and the female parent are hybridized to obtain F1, F1 is bagged and selfed to obtain F2, and F2 is subjected to single-seed successive two generations to obtain F4.
(2) Extracting the individual genome DNA of the father and mother parents, F1 generation and F4 generation for later use. The method comprises the following specific steps: weighing fresh leaves, shearing, grinding, adding 1.5 × CTAB, grinding into homogenate, transferring into a centrifuge tube, washing mortar with 1.5 × CTAB, transferring into a centrifuge tube, adding deionized water after 65 deg.C water bath, and adding mercaptoethanol before use. Subsequently, after cooling to room temperature, an equal volume of chloroform/isoamyl alcohol was added and mixed until the undernatant turned dark green. And then centrifuging, transferring the upper aqueous phase to a new centrifuge tube after centrifugation, adding 2 times volume of precooled absolute ethyl alcohol, and standing to precipitate DNA. After further centrifugation, the supernatant was discarded, the precipitate was washed with 75% ethanol 1 time, the tube was inverted and DNA was dried, and TE was added to dissolve DNA. And finally, detecting the genomic DNA by using 0.8% agarose gel, and storing the obtained parental DNA and the genomic DNA of the individuals of the F1 generation and the F4 generation for later use.
(3) Genotyping is carried out on the F4 population single plant by using a sequencing-based genotyping technology to obtain the genotype data of the F4 population, and the MSTMap software is used for drawing the genetic linkage map to obtain the genetic linkage map.
(4) According to the individual phenotype of the F4 population, the individual phenotype with the similar paternal type character, the similar maternal type character and the character between the paternal and the maternal is marked respectively, the individual phenotype data is compared with the genotype data, and the rice taste related gene is positioned on the genetic linkage map.
(5) Selecting the molecular marker close to the section of the rice-flavor related gene, designing a primer, and screening the molecular marker with polymorphism and stable amplification through PCR amplification and agarose gel electrophoresis detection.
(6) And carrying out PCR amplification by using the genomic DNA of the male parent, the F1 generation or the F4 generation as a template and using a molecular marker amplification primer pair. The PCR reaction system is as follows:
the PCR reaction conditions are as follows: pre-denaturation at 94 ℃ for 5 min; denaturation at 94 ℃ for 30 seconds, annealing at 60 ℃ for 30 seconds, extension at 72 ℃ for 40 seconds, and running for 35 cycles; final extension at 72 ℃ for 3 min.
In the specific embodiment, the technical scheme of the invention discloses a molecular marker M2576 closely linked with a rice taste related QTL, wherein the nucleotide sequence of the molecular marker is shown as a sequence table SEQ ID NO. 1, and the length of the nucleotide sequence is 1522 bp. The genetic linkage distance of the molecular marker to the rice taste rewweet QTL is 2.6 cM. The primers for the molecular marker M2576 are shown in Table 1 below, SEQ ID NO:2, and SEQ ID NO: 3:
TABLE 1
Example 1
The technical solution of the present invention is specifically described below by taking example 1 as an example:
1. construction of rice F4 generation segregation population
The male parent selects a breeding resource material SKO, and the female parent selects a rice variety of early oil glutinous rice with late fragrance of 97. SKO, the variety is indica rice, the growth period is 100-. The rice quality detection result is as follows: 80% of brown rice, 71% of polished rice, 55% of polished rice and 7 mm of grain length. The amylose content is 17%, the rice taste is light, and the rice has no sweet feeling. The rice is late 97 th fragrant, the variety is indica type conventional rice, the growth period is 85-90 days, the plant type is loose, and the leaf color is light green. The rice quality is detected to be 78 percent of the brown rice, 68 percent of the polished rice, 55 percent of the polished rice and 6 mm of the grain length. The amylose content is 15%, the rice taste is fragrant and sweet, and the rice has sweet taste after being eaten. Therefore, the rice of the male parent is hard, and the taste of the rice is not sweet; the female parent rice is soft and the rice taste returns sweet.
The construction method of the F4 generation separation population comprises the following steps: the male parent and the female parent are hybridized to obtain F1, F1 generation single seed is transmitted to generate F4 generation group, and 200F 4 generation single strains are obtained in total.
2. Extraction of genomic DNA
In this embodiment, the genomic DNAs of the father and mother parents, F1 generation and F4 generation individuals are extracted by CTAB method, and the specific method is as follows:
A. weighing 1.0g of fresh leaves, shearing, putting into a mortar, grinding with liquid nitrogen, adding 3mL of 1.5 xCTAB, grinding into homogenate, transferring into a 15mL centrifuge tube, adding 1mL of 1.5 xCTAB into the mortar, washing, and transferring into the centrifuge tube. Mixing, and slowly shaking at 65 deg.C in water bath for 30 min.
Wherein the 1.5 × CTAB formula is as follows (1L):
deionized water was added to a volume of 1L, and mercaptoethanol was added to a final concentration of 0.2% (2ml) before use.
B. After cooling to room temperature, an equal volume of chloroform/isoamyl alcohol (24: 1) was added and mixed gently until the subnatant turned dark green.
C. Centrifuging at 4200rpm for 10min, transferring the upper aqueous phase to a new 15mL centrifuge tube, adding 2 times volume of precooled absolute ethanol, mixing and standing for 5 min. The DNA was precipitated by standing at-20 ℃ for 30 min.
D. Centrifuging at 4200rpm for 10min, discarding the supernatant, adding 1mL of 75% ethanol to wash the precipitate 1 time, inverting the centrifuge tube to dry the DNA, and adding 200. mu.L of TE to dissolve the DNA.
E. Genomic DNA was detected on a 0.8% agarose gel.
F. The obtained parental DNA and genomic DNA of the F1 and F4 individuals were stored at-20 ℃ for further use.
3. Genetic map construction
Individuals of the F4 population were genotyped using RAD-seq based genotyping techniques to obtain genotype data for the F4 population.
And (3) carrying out genetic linkage map drawing by using MSTMap software (http:// alumi. cs. ucr. edu/-yonghui/MSTMap. html) to obtain a genetic linkage map.
4. Positioning of rice meal taste related QTL
According to the individual phenotype of the F4 population, the character is marked as a similar to the male parent type, the character is marked as b similar to the female parent type, and the character is marked as h between the male parent and the female parent. And obtaining phenotype data of all individuals, comparing the phenotype data of the individuals with the genotype data obtained before, and positioning the rice soft and hard and rice taste sweet genes on a genetic linkage map.
5. Molecular marker development
According to the sequencing result of RAD-seq, SOAP software developed by Huada is used for comparing sequencing reads, and then SOAPsv is used for searching molecular markers with larger fragment differences, so that gel electrophoresis is used for distinguishing and identifying conveniently. Selecting a marker close to a section where the long-particle type gene is located as a candidate, then respectively designing primers, and screening the marker with polymorphism and stable amplification through PCR amplification and agarose gel electrophoresis detection.
6. Preparation of molecular markers
The method for preparing the molecular marker M2576 specifically comprises the following steps: the extracted genomic DNA of the parent, F1 generation or F4 generation is used as a template, and a molecular marker amplification primer pair is used for PCR amplification, wherein the amplification primer pair is shown in Table 1. The PCR reaction system is as follows:
the PCR reaction procedure was as follows: pre-denaturation at 94 ℃ for 5 min; denaturation at 94 ℃ for 30 seconds, annealing at 60 ℃ for 30 seconds, extension at 72 ℃ for 40 seconds, and running for 35 cycles; final extension at 72 ℃ for 3 min. The PCR amplification product can be stored at 4 ℃. Obtaining the molecular marker through the amplification process, preferably, purifying the amplified product after amplification. After purification, sequencing is carried out, and the result is shown in a sequence table SEQ ID NO 1.
The above description is only a preferred embodiment of the present invention, and is not intended to limit the scope of the present invention, and all technical extensions or innovations made by using the contents of the present specification and drawings are included in the scope of the present invention.
Sequence listing
<110> Shenzhen Shengbao Joint cereal shares GmbH
<120> molecular marker closely linked with rice taste related QTL and screening method thereof
<130> JY181-272219
<160> 3
<170> SIPOSequenceListing 1.0
<210> 1
<211> 1522
<212> DNA
<213> Artificial
<400> 1
gatcgtgacg tttcttgatt tctggcagtg gatgatgtcg gcgccgacgg cggtgacgtc 60
atggccggag atgtcgaggt tgtagttgcc ggggtggtag ccgaagacgt tgtagaatgt 120
gatgattacg gtggtgtagc ggccggtgtc gcaggcctgg cggagggtgc cttcgtcggc 180
gtcggcgtga cggccccagt agattgctag gccgccgacg tagccgtccg ccgtcgccgg 240
cgcggcgaga tggccggaga ttattgtgag cagcaatgct gctgctagtg caaagggtaa 300
gggagggaga gccattttgc aacgacagtg tcagtgtaca gtggctgtga gcttgcttga 360
agtgatttct gatgtactcc tatgtgtaga ggagcaattt tacggttctt aagtaggtac 420
tataaagtat tattttttct attataaatt tgatatctta tgttaccttt acactaaaat 480
tttggtacct catggtatct cctcaagtac cgtagaattg cttaaatgta gagaagaaga 540
gatttgtgat tatgtaatgt actctctccg gtttttaatg tttgacactc ctcaagtacc 600
gtagaattgc ttaaatgtag agaagaagag atttgtgatt atgtaatgta ctctccggtt 660
tttaatgttt gacaccgttg attgtgtagt gcacgtttga ccacttgtct tattaaaaaa 720
aatatttaaa tatttataaa tataagtcat gcttaaaata tcttttgtaa taaatcaact 780
cgtaacaaaa taaatacttc agaataatat ttagataaat tttttaaata aaatgaatgg 840
tcaaatattc tatcgtaaac agtgtcaaac attgaaaacc agagggagca atcttttttc 900
ttggggtcta gctgctgcta ggcacctagg tagtggtcta ttgtggtgtg cgtgatttgg 960
atgcgtatag gttaatggat ggatttgatg catgtgggtt ggatatgttg atgagatttg 1020
accgttgact cgaccagcgg ctaccacgtc atcggtgctg gtcgatctcg atccaaaact 1080
aactaatcgt gtcgtgctgt actccctcca tctaaaaaaa ccctggtttc cgtgtctaac 1140
gtttgatcgt cctttttatt tgaaaaaatt ataaaaaaat taaaaagata attcacgcat 1200
aaagtattaa tcatgtttta tcatctaaca ataataaaaa tactaattat aaaaaaattt 1260
catataagac ggacagtcaa acgttgtcac ggaaatctag ggtttgtctt ttttttttta 1320
agacggaggg agtatgtatg tactaggatg ttgttcatac atcttgaagg gcaacagctg 1380
gatagcattc tgcaaatatt gcattgtcgt ttgcgcaagg ggcagggaat taggccactc 1440
atcttccttt tgggtacttg tctatcacaa aagcgaattc tcatgagtat gtttgttttt 1500
tttttttggt gataacaggg ca 1522
<210> 2
<211> 20
<212> DNA
<213> Artificial
<400> 2
cctatgtgta gaggagcaat 20
<210> 3
<211> 20
<212> DNA
<213> Artificial
<400> 3
gcacgacacg attagttagt 20
Claims (1)
1. A molecular marker closely linked with rice taste related QTL is characterized in that the nucleotide sequence of the molecular marker is shown as a sequence table SEQ ID NO. 1; the rice taste of the rice refers to rice taste of sweet.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201810220212.9A CN108165661B (en) | 2018-03-16 | 2018-03-16 | Molecular marker closely linked with rice taste related QTL and screening method thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201810220212.9A CN108165661B (en) | 2018-03-16 | 2018-03-16 | Molecular marker closely linked with rice taste related QTL and screening method thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN108165661A CN108165661A (en) | 2018-06-15 |
| CN108165661B true CN108165661B (en) | 2021-08-06 |
Family
ID=62511252
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201810220212.9A Active CN108165661B (en) | 2018-03-16 | 2018-03-16 | Molecular marker closely linked with rice taste related QTL and screening method thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN108165661B (en) |
Families Citing this family (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN111118201B (en) * | 2020-02-23 | 2020-11-03 | 云南省农业科学院农业环境资源研究所 | Molecular marker closely linked with gene du13(t) for regulating and controlling low amylose content of rice and application thereof |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106318937A (en) * | 2015-06-17 | 2017-01-11 | 深圳华大基因研究院 | Molecular marker and application thereof |
-
2018
- 2018-03-16 CN CN201810220212.9A patent/CN108165661B/en active Active
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106318937A (en) * | 2015-06-17 | 2017-01-11 | 深圳华大基因研究院 | Molecular marker and application thereof |
Non-Patent Citations (1)
| Title |
|---|
| QTL analysis for cooking traits of super rice with a high-density SNP genetic map and fine mapping of a novel boiled grain length locus;Li, Yuanyuan; Tao, Hongjian; Xu, Jie; 等.;《PLANT BREEDING》;20151031;第134卷(第5期);全文 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN108165661A (en) | 2018-06-15 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN105385697B (en) | Sesame inflorescence finite basis is because of Sidt1 and its SNP marker | |
| CN107205353A (en) | SNP (SNP) mark for stevia rebaudianum | |
| CN102933072A (en) | Barley and uses thereof | |
| CN109097387A (en) | A kind of methods and applications with CRISPR/Cas9 gene editing system initiative purple fruit Tomato mutants | |
| US20210400901A1 (en) | Sesame plants with improved organoleptic properties and methods thereof | |
| CN107365865B (en) | Molecular marker related to tomato fruit color and application thereof | |
| CN102816778B (en) | Mutant gene of rice starch branching enzyme SBE3 gene and application of mutant gene | |
| US20210307285A1 (en) | Sesame plants with improved organoleptic properties and methods thereof | |
| CA3129544C (en) | Methods of determining sensitivity to photoperiod in cannabis | |
| CN107266595A (en) | Composition and method for producing the starch with New function | |
| CN108165661B (en) | Molecular marker closely linked with rice taste related QTL and screening method thereof | |
| JP4892647B1 (en) | New varieties, methods for distinguishing plant varieties, and methods for rapid development of rice individuals | |
| KR101946162B1 (en) | Snp markers for discriminating raphanus sativus cultivar and uses thereof | |
| EP2294912A1 (en) | Method for increasing the level of zeaxanthin in a plant line, method for selecting a plant or part thereof, including a seed and tuber, and use thereof | |
| US20180265887A1 (en) | Basil Plants With High Tolerance to Downy Mildew | |
| TW201606084A (en) | Method of predicting or determining plant phenotypes | |
| Vashistha et al. | Genetics of sex chromosomes and sex-linked molecular markers in papaya (Carica papaya L.) | |
| CN108148927A (en) | The molecular labeling and its screening technique of QTL close linkages related to rice meal taste | |
| CN108148928A (en) | The molecular labeling and its screening technique of QTL close linkages related to rice meal taste | |
| CN112779269A (en) | Xinjiang rice and wheat glume growth promoting gene P1 and protein coded by same | |
| CN110199871B (en) | Breeding method of high-lysine maize inbred line | |
| CN111621588A (en) | Molecular marker for breeding bright peel tomato variety and application thereof | |
| CN105349650B (en) | A kind of method of qualitative detection rice digestion resistant content of starch | |
| WO2020131600A1 (en) | Snp markers and selection of low fiber in brassica | |
| KR20210100689A (en) | Solanaceae plants capable of forming gastric unit fruit |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant | ||
| TR01 | Transfer of patent right | ||
| TR01 | Transfer of patent right |
Effective date of registration: 20230821 Address after: 518000 Boxing Building 16B, No. 52, Qingshuihe 1st Road, Qingshuihe Community, Qingshuihe Street, Luohu District, Shenzhen, Guangdong Patentee after: Shenzhen Shengbao Rice Molecular Breeding Research Co.,Ltd. Address before: 518000 No. 3, 5th floor, foreign trade light industry building, 1002 Aiguo Road, Luohu District, Shenzhen, Guangdong Patentee before: SHENZHEN GRANLUX UNITED GRAINS Co.,Ltd. |