CN111621575A - Hu sheep MC4R gene SNP 732C → G gene SNP locus detection primer, detection test strip and application - Google Patents

Abstract

The application relates to the field of breeding biological detection, in particular to Hu sheepMC4RGene SNPg.732C → G gene SNP locus detection primer, detection test strip and application. Hu sheepMC4RThe gene SNPg.732C → G gene SNP locus detection primer is composed of the following primers:MC4R‑732‑F‑C：CGATCACCATCAGTGCCATCT；MC4R‑732‑F‑G：CGATCACCATCAGTGCCATGT；MC4R-R: GATCAGGATGGTCAGCGTGATC are provided. The detection primer has strong design specificity and high amplification efficiency aiming at a mutation region, utilizes the characteristic that the PCR reagent at the present stage can directly amplify animal whole blood, combines the rapid and simple characteristics of nucleic acid test strip result detection, can establish a nucleic acid test strip reaction system for screening the mutation site, and establishesA rapid detection method for different genotypes is provided.

Description

Hu sheep MC4R gene SNP 732C → G gene SNP locus detection primer, detection test strip and application

Technical Field

The invention relates to the field of breeding biological detection, in particular to Hu sheep MC4R gene SNPg.732C → G gene SNP locus detection primers, a detection test strip and application.

Background

Melanocortin receptor-4 (MC 4R) is a peptide secreted from the ventral medial nucleus of the hypothalamus, involved in the regulation of body weight and energy balance, and expressed by multiple neuronal populations in the central nervous system. Unlike other members of the MCR family, MC4R is not present in the adrenal cortex, hair follicles, and placenta, but is present in large numbers in various regions of the central nervous system, including the cerebral cortex, thalamus, hypothalamus, brainstem, and spinal cord. The MC4R of mammals such as human, pig, cattle, sheep and dog is composed of 332 amino acid residues, has 7-time transmembrane structure, and is one member of transmembrane G protein coupled receptor family.

Leptin and insulin are the most important peripheral regulating factors for animal feeding regulation, and MC4R can be used as a downstream medium of a leptin and insulin feeding regulation pathway to realize the regulation of animal feeding. Therefore, the protein plays an important role in the central nervous system in regulating glucose homeostasis. Mutations in the mammalian MC4R gene disrupt the adrenocortical pathway within the central nervous system, increase appetite and reduce satiety, indirectly resulting in obesity. The mutation research of the MC4R gene of mammals such as human, dog, pig, cow, sheep and the like shows that the gene can be used as a candidate functional gene of the weight or growth traits of the mammals, and a plurality of SNPs related to the growth traits of the animals exist in the gene. Based on the phenotypic effect caused by the mutation of the MC4R gene, the mutation of the gene can be divided into five types: firstly, the synthesis defect of the MC4R protein is caused, or the degradation of the MC4R protein is accelerated, which shows that the amount of the MC4R protein is obviously reduced; ② errors in protein folding or intracellular transport are caused, leading to protein retention in cells; ③ the protein can be correctly integrated in the cell membrane, but the binding capacity with the ligand is reduced; inducing signal transmission obstacle; the effect due to the mutation is not clear.

The MC4R gene is taken as a candidate gene of the classical growth traits of mammals, the SNP research of the MC4R gene is widely concerned, and candidate functional SNPs which can be used for subsequent breeding are obtained in multiple species. Therefore, by utilizing the influence of the SNP of the MC4R gene in the livestock group on the body weight and the body size of livestock, the SNP which is beneficial to the body weight growth, the growth acceleration, the fattening and the slaughtering traits of the Hu sheep is screened out in the gene, and purposeful seed selection and matching are carried out on the genotype individuals which are beneficial to the weight increase and the meat quality scoring, so that the Hu sheep group with high growth speed and good carcass quality can be cultured, and the economic benefit is improved.

The Chinese patent application (publication No. CN110331211A) discloses a SNP molecular marker related to the Hu sheep body size trait, which comprises a SNP732 which is C or G and is positioned at the 732 th position corresponding to MC4R compared with MC 4R. The SNP g.732C → G of the group MC4R gene for Hu mutton of the G4 generation is obviously related to chest circumference. Previous studies of the application found that the SNP g.732C → G of the group MC4R gene for Hu sheep in the G3 generation was significantly related to body height. The 732C → G site is located in the coding region, and has 3 genotypes of CC, CG and GG, which are moderate polymorphism and missense mutation. The SNP detection primers with strong specificity and high amplification efficiency are designed aiming at the mutation area, the characteristic that the PCR reagent at the present stage can be used for directly amplifying animal whole blood is utilized, and meanwhile, the rapid and simple characteristic of nucleic acid test strip result detection is combined, a nucleic acid test strip reaction system capable of screening the mutation sites is established, and rapid detection methods of different genotypes are established.

Disclosure of Invention

In order to solve the above technical problems, a first objective of the present application is to provide a Hu sheep MC4R gene SNPg.732C → G gene SNP site detection primer, which has strong design specificity and high amplification efficiency for a mutation region, utilizes the characteristic that a current-stage PCR reagent can directly amplify animal whole blood, and combines the rapid and simple characteristics of nucleic acid test strip result detection, so as to establish a nucleic acid test strip reaction system for screening the mutation site, and establish a rapid detection method for different genotypes.

In order to achieve the above object, the present application adopts the following technical solutions:

hu sheep MC4R gene SNPg.732C → G gene SNP locus detection primer, which consists of the following sequence primers:

MC4R-732-F-C：CGATCACCATCAGTGCCATCT；

MC4R-732-F-G：CGATCACCATCAGTGCCATGT；

MC4R-R：GATCAGGATGGTCAGCGTGATC。

as a further improvement, the upstream primer 5 is subjected to BIOTIN modification at the downstream end, and the downstream primer 3 is subjected to FITC modification at the decorative end.

Further, the application also provides a Hu sheep MC4R gene SNPg.732C → G genotyping test strip, which comprises the detection primer.

As a further improvement, the test strip also comprises wild homozygous CC individual blood, wild homozygous CC individual genome DNA, mutant homozygous GG individual blood, mutant homozygous GG individual genome DNA and a negative control of replacing blood and DNA templates with double distilled water with the same volume.

Further, the application also provides application of the detection primer and the detection test strip in screening Hu sheep body size characters or Hu sheep molecular marker assisted breeding.

Further, the application also provides a Hu sheep MC4R gene SNPg.732C → G genotyping detection method, which comprises the following steps:

1) the MC4R-732-F-C + MC4R-R primer reacts with a blood template of a wild homozygous CC individual;

2) the MC4R-732-F-G + MC4R-R primer reacts with the blood template of the mutation homozygous GG individual, and the MC4R-732-F-C + MC4R-R primer with the mismatch genotype group reacts with the blood template of the mutation homozygous GG individual;

3) the MC4R-732-F-G + MC4R-R primer reacts with the blood template of the mutation homozygous CC individual;

4) after the reaction is finished, adding 2 mu L of 6 XLoading Buffer into a target product amplified by 4 mu LPCR, blowing, sucking and uniformly mixing, spotting on 1.5% agarose gel, and performing 200V electrophoresis for 15 min; staining for 5min in EB, observing under ultraviolet lamp, and taking picture.

As a further improvement, the reaction systems in the steps 1), 2) and 3) are as follows:

the reaction conditions were set as follows: pre-denaturation at 94 ℃ for 2 min; denaturation at 98 deg.C for 10s, annealing at 65 deg.C, reaction time 30s, extension at 68 deg.C for 30s, 32 cycles, and storage at 4 deg.C.

Further, the application also provides a Hu sheep MC4R gene SNPg.732C → G genotyping detection method, which comprises the following steps:

1) the reaction was performed using MC4R-732-F-C + MC4R-R primers, with the templates set to: blood of a wild homozygous CC individual, genome DNA of the wild homozygous CC individual, blood of a mutant homozygous GG individual, genome DNA of the mutant homozygous GG individual and negative control of replacing blood and a DNA template by double distilled water with the same volume;

meanwhile, MC4R-732-F-G + MC4R-R primer reaction is used, and the templates are respectively set as follows: blood of a wild homozygous CC individual, genome DNA of the wild homozygous CC individual, blood of a mutant homozygous GG individual, genome DNA of the mutant homozygous GG individual and negative control of replacing blood and a DNA template by double distilled water with the same volume;

2) after the reaction is finished, opening the PCR reaction tube, inserting the bonding pad end of the test strip into the PCR reaction tube, keeping the test strip flat for 1min after the interpretation area is completely infiltrated, and waiting for a red strip to appear; and directly reading the detection result according to the color development condition of the test strip.

As a further improvement, the reaction system in the step 1) is as follows:

the reaction conditions were set as follows: pre-denaturation at 94 ℃ for 2 min; denaturation at 98 deg.C for 10s, annealing at 65 deg.C, reaction time 30s, extension at 68 deg.C for 30s, 32 cycles, and storage at 4 deg.C.

Further, the application also provides application of the method in screening Hu sheep body size characters or Hu sheep molecular marker assisted breeding.

By adopting the technical scheme, the detection primer has strong design specificity and high amplification efficiency aiming at the mutation region, utilizes the characteristic that the PCR reagent at the present stage can directly amplify animal whole blood, and simultaneously combines the rapid and simple characteristics of nucleic acid test strip result detection, can establish a nucleic acid test strip reaction system for screening the mutation sites and establish rapid detection methods of different genotypes.

Drawings

FIG. 1 PCR amplification of SNP detection primers on corresponding genotypic individuals; note: the annealing temperatures of the lanes 1-6 are 55 ℃, 57 ℃, 59 ℃, 61 ℃, 63 ℃ and 65 ℃ in sequence, the amplification primer is MC4R-732-F-C, and the amplification template is wild homozygous CC individual whole blood; (M: DNA MarkerDL 5000.)

FIG. 2 PCR amplification of SNP detection primers on corresponding genotypic individuals; note: the annealing temperature of the lanes 7-12 is 55 ℃, 57 ℃, 59 ℃, 61 ℃, 63 ℃ and 65 ℃ in sequence, the amplification primer is MC4R-732-F-G, and the amplification template is mutation homozygous GG individual whole blood; (M: DNA MarkerDL 5000.)

FIG. 3 PCR amplification of SNP detection primers in mismatched genotype individuals; note: the annealing temperatures of the lanes 1-6 are 55 ℃, 57 ℃, 59 ℃, 61 ℃, 63 ℃ and 65 ℃ in sequence, the amplification primer is MC4R-732-F-C, and the amplification template is a mutation homozygous GG individual; (M: DNA MarkerDL 5000.)

FIG. 4 PCR amplification of SNP detection primers in mismatched genotype individuals; note: the annealing temperatures of the lanes 7-12 are 55 ℃, 57 ℃, 59 ℃, 61 ℃, 63 ℃ and 65 ℃ in sequence, the amplification primer is MC4R-732-F-G, and the amplification template is wild homozygous CC individual. (M: DNA MarkerDL 5000.)

FIG. 5 shows that the MC4R-732-F-C + MC4R-R primer is tested at the SNP site by a test strip; note: 1-5 templates are respectively: the kit comprises wild homozygous CC individual blood, wild homozygous CC individual genome DNA, mutant homozygous GG individual blood, mutant homozygous GG individual genome DNA and an equal-volume double-distilled water negative control.

FIG. 6 shows that the MC4R-732-F-G + MC4R-R primer is tested at the SNP site by a test strip; note: 1-5 templates are respectively: blood of a wild homozygous CC individual, blood of a mutant homozygous GG individual, genomic DNA of the wild homozygous CC individual, genomic DNA of the mutant homozygous GG individual, and negative control of replacing blood and DNA templates with equal volume of double distilled water.

In FIG. 7, the blood samples of 1 st to 8 th Hu sheep are detected by a test strip at the SNP locus; note: the primer of the odd test strip color development result is MC4R-732-F-G, the primer of the even test strip color development result is MC4R-732-F-C, the sheep number detected in 1-2 is 6062, the sheep number detected in 3-4 is 6341, the sheep number detected in 5-6 is 6255, the sheep number detected in 7-8 is 5546, the sheep number detected in 9-10 is 5432, the sheep number detected in 11-12 is 5378, the sheep number detected in 13-14 is 5439, and the sheep number detected in 15-16 is 5497.

FIG. 8, the blood samples of 9 th to 16 th Hu sheep are detected by a test strip at SNP sites; note: the primer for the odd test strip color development result is MC4R-732-F-G, the primer for the even test strip color development result is MC4R-732-F-C, sheep number 6471 detected by 1-2, sheep number 6944 detected by 3-4, sheep number 6783 detected by 5-6, sheep number 6369 detected by 7-8, sheep number 6328 detected by 9-10, sheep number 6346 detected by 11-12, sheep number 5015 detected by 13-14 and sheep number 6303 detected by 15-16.

FIG. 9, the blood samples of 17 th to 24 th Hu sheep are detected by a test strip at SNP sites; note: the primer for the odd test strip color development result is MC4R-732-F-G, the primer for the even test strip color development result is MC4R-732-F-C, sheep No. 5977 detected by 1-2, sheep No. 6451 detected by 3-4, sheep No. 5967 detected by 5-6, sheep No. 5271 detected by 7-8, sheep No. 6469 detected by 9-10, sheep No. 5572 detected by 11-12, sheep No. 5456 detected by 13-14 and sheep No. 5902 detected by 15-16.

Detailed Description

1 materials and methods

1.1 animal population selection

The test animals are all from Hu sheep meat new group core group G4 generation group bred in Hangzhou huge agriculture development limited company Yiqiao sheep farm, and the feeding management is carried out according to the Hu sheep standard feeding management method. 10mL of jugular venous blood is collected from each individual, placed in an EDTA anticoagulation tube and stored at-20 ℃. The treatment of animals meets the rules and requirements of animal welfare committee of the agricultural academy of sciences of Zhejiang province and Nanjing university of agriculture.

2 method of experiment

2.1 primer design for SNP site detection

According to the base sequence of MC4R, after DNAMAN (8.0) is compared, an amplification primer is designed aiming at g.732C → G aiming at a mutation site, the 3 'tail end of a forward primer or a reverse primer in the amplification primer corresponds to an SNP site to be detected, LNA modification is carried out on the nucleotide on the 3' tail end of the SNP site to be detected, and the design principle follows the following points:

1. the annealing temperature of the upstream primer and the downstream primer is kept consistent, and the size of an amplification product is 200-350 bp;

2, the last nucleotide or the last nucleotide of the 3' end of the forward primer or the reverse primer in the PCR amplification primer corresponds to the SNP locus to be detected;

3. the upstream primer 5 carries out BIOTIN modification at the upstream end, and the downstream primer 3 carries out FITC modification at the downstream end.

The primers were synthesized by Anhui general, as shown in Table 1-1.

TABLE 1-1 MC4R Gene 732 site detection primer System

Note: LNA modification with italicized red base

2.2 screening of SNP site detection primers and establishment of detection System

After the primer modification synthesis was completed, the dry powder was diluted and amplified, and a Marathon DNA Polymerase reaction solution (Tiosbio, China) was prepared according to the system of Table 1-2. And performing PCR amplification by using the whole blood of the individual with MC4R g.732C → G as mutant homozygous GG and wild homozygous CC as a template, and setting a corresponding genotype group. The specific operation is as follows: the MC4R-732-F-C + MC4R-R primer reacts with a blood template of a wild homozygous CC individual; the MC4R-732-F-G + MC4R-R primer reacts with the blood template of the mutation homozygous GG individual, and the MC4R-732-F-C + MC4R-R primer with the mismatch genotype group reacts with the blood template of the mutation homozygous GG individual; the MC4R-732-F-G + MC4R-R primer reacts with the blood template of the CC individual homozygous for the mutation. The reaction conditions were set as follows: pre-denaturation at 94 ℃ for 2 min; denaturation at 98 ℃ for 10s, setting an annealing temperature gradient from 55-65 ℃, reaction time for 30s, extension at 68 ℃ for 30s, 32 cycles in total, and storage at 4 ℃.

TABLE 1-2 MC4R Gene PCR amplification primer System

After the reaction is finished, the target product amplified by 4 mu LPCR is taken, 2 mu L of 6 Xloading Buffer is added for blowing, sucking and mixing evenly, the sample is applied to 1.5 percent agarose gel, and 200V electrophoresis is carried out for 15 min. Staining for 5min in EB, observing under ultraviolet lamp, and taking picture.

2.3 establishment of test paper strip detection system for SNP locus

The reaction was performed using MC4R-732-F-C + MC4R-R primers, with the templates set to: blood of a wild homozygous CC individual, genome DNA of the wild homozygous CC individual, blood of a mutant homozygous GG individual, genome DNA of the mutant homozygous GG individual and a negative control of replacing blood and a DNA template by equal volume of double distilled water. Meanwhile, MC4R-732-F-G + MC4R-R primer reaction is used, and the templates are respectively set as follows: blood of a wild homozygous CC individual, genome DNA of the wild homozygous CC individual, blood of a mutant homozygous GG individual, genome DNA of the mutant homozygous GG individual and a negative control of replacing blood and a DNA template by equal volume of double distilled water. The reaction system is shown in the table 1-2, and the reaction conditions are set as follows: pre-denaturation at 94 ℃ for 2 min; denaturation at 98 deg.C for 10s, annealing at 65 deg.C, reaction time 30s, extension at 68 deg.C for 30s, 32 cycles, and storage at 4 deg.C.

After the reaction is finished, opening the PCR reaction tube, inserting the bonding pad end of the test paper strip (Tiosbio, Beijing) into the PCR reaction tube, and after the interpretation area is completely infiltrated, keeping the test paper flat for 1min, and waiting for a red strip to appear. And directly reading the detection result according to the color development condition of the test strip.

2.4 comparison of SNP site detection System with results of direct sequencing

In order to evaluate the operability of the detection system on actual samples and the accuracy of detection results, the method randomly selects 24 Hu sheep blood samples for detection, and compares the genotyping result detected by the test strip with the genotyping result directly sequenced by the blood samples to determine whether the SNP site detection system can detect unknown random samples and has a credible detection result.

3 results and analysis

3.1 screening of SNP site detection primers

Primers for SNP site detection were designed and synthesized according to the principle of 3.2.1, and PCR amplification was carried out using MC4R g.732C → G, mutant homozygous GG and whole blood of wild homozygous CC individual as templates, and the reaction results are shown in FIGS. 1 and 2. The MC4R-732-F-C + MC4R-R primer has an amplification band at an annealing temperature of 55 ℃, 57 ℃, 59 ℃, 61 ℃ and 63 ℃ in a reaction system with wild homozygous CC individual whole blood as a template, the size of a product is consistent with that of the product in figure 1, the band is single and bright, but the band is dull at 65 ℃. The MC4R-732-F-G + MC4R-R primer has amplification bands at the annealing temperatures of 55 ℃, 57 ℃, 59 ℃, 61 ℃ and 63 ℃ in a reaction system with mutation homozygous GG individual whole blood as a template, the sizes of products are consistent with those in the table 1-1, the bands are single and bright, and the bands are dull at the temperature of 65 ℃.

The MC4R-732-F-C + MC4R-R primer shows amplification bands at annealing temperatures of 55 ℃, 57 ℃, 59 ℃, 61 ℃, 63 ℃ and 65 ℃ in a reaction system with wild homozygous CC individual blood as a template, so that the MC4R-732-F-C + MC4R-R primer is used for carrying out a reaction with mutant homozygous GG individual blood as a template, and the annealing temperatures are selected from 55 ℃, 57 ℃, 59 ℃, 61 ℃, 63 ℃ and 65 ℃. After agarose gel electrophoresis, no amplification band appeared in the samples of FIGS. 3 and 4 when they were observed under an ultraviolet lamp. Similarly, the MC4R-732-F-G + MC4R-R primers were used to perform the reaction using the blood of the mutant homozygous CC individual as the template, and the annealing temperatures were selected from 55 deg.C, 57 deg.C, 59 deg.C, 61 deg.C, 63 deg.C and 65 deg.C. No amplification band appeared by observation under an ultraviolet lamp after agarose gel electrophoresis.

3.2 establishment of test paper strip detection system for SNP locus

The reaction was performed using MC4R-732-F-C + MC4R-R primers, with the templates set to: blood of a wild homozygous CC individual, genome DNA of a wild homozygous CC individual, blood of a mutant homozygous GG individual, genome DNA of a mutant homozygous GG individual, and double distilled water (a negative control replacing blood and DNA templates) in equal volume. The test result of the test strip is shown in figure 5, when the MC4R-732-F-C + MC4R-R primer is in a reaction product which takes the blood of a wild homozygous CC individual and the genomic DNA of the wild homozygous CC individual as templates, the test strip has a blue strip which is positioned on a quality control line (C line); a red strip, located on the test line (T line), gave a positive result. The MC4R-732-F-C + MC4R-R primer can detect the C allele in blood or genome.

The MC4R-732-F-C + MC4R-R primer only shows a blue strip in a reaction product taking the blood of the mutant homozygous GG individual, the genomic DNA of the mutant homozygous GG individual and double distilled water as templates, and a detection line (T line) has no strip, so that the result is negative. Thus, the MC4R-732-F-C + MC4R-R primer did not detect and was not interfered by the G allele in blood or genome.

The reaction was performed using MC4R-732-F-G + MC4R-R primers, with the templates set to: blood of a wild homozygous CC individual, genomic DNA of a wild homozygous CC individual, blood of a mutant homozygous GG individual, genomic DNA of a mutant homozygous GG individual and equal volume of double distilled water (replacing negative controls of blood and DNA templates). The test result of the test strip is shown in FIG. 6, when the MC4R-732-F-G + MC4R-R primer is used in a reaction product with wild homozygous CC individual blood, wild homozygous CC individual genome DNA and double distilled water as templates, the test strip only has a blue strip, and the test line (T line) has no strip, so that the test result is negative. Thus, the MC4R-732-F-G + MC4R-R primer can not detect and not be interfered by the C allele in the blood or the genome.

The test result of the test strip shows that the test strip has a blue strip and is positioned on a quality control line (line C) in a reaction product taking the blood of the mutant homozygous GG individual and the genomic DNA of the mutant homozygous GG individual as templates by the MC4R-732-F-G + MC4R-R primer; a red strip, located on the test line (T line), gave a positive result. The MC4R-732-F-G + MC4R-R primer can detect the G allele in blood or genome.

3.3 comparison of SNP site detection System with results of direct sequencing

And randomly selecting 24 Hu sheep blood samples for detection, and simultaneously comparing the genotyping result detected by the test strip with the genotyping result of direct sequencing of the blood samples to confirm whether the SNP locus detection system can detect unknown random samples and has a credible detection result. The primers MC4R-732-F-G + MC4R-R, MC4R-732-F-C + MC4R-R are used for simultaneously detecting sheep blood samples with different numbers. The detection result is shown in a table 4-3, and when the detection result of MC4R-732-F-G + MC4R-R is positive and the detection result of MC4R-732-F-C + MC4R-R is also positive, the sheep genotype can be judged to be a mutation heterozygote GC type; when the detection result of MC4R-732-F-G + MC4R-R is negative and the detection result of MC4R-732-F-C + MC4R-R is positive, the sheep genotype can be judged to be wild homozygous CC type; when the detection result of MC4R-732-F-G + MC4R-R is positive and the detection result of MC4R-732-F-C + MC4R-R is negative, the sheep genotype can be judged to be a mutation homozygous GG type. The test results of the test strip are shown in fig. 7, fig. 8 and fig. 9.

The direct sequencing method results show that the genotypes corresponding to the selected sheep numbers are as follows: 6062: CG type, 6341: type CC, 6255: CG type, 5546: GG type, 5432: type CC, 5378: GG type, 5439: type CC, 5497: CG type, 6471: GC type, 6944: GG type, 6783: GC type, 6369: GC type, 6328: type CC, 6346: GG type, 5015: GG type, 6303: GC type, 5977: GG type, 6451: GG type, 5967: GC type, 5271: type CC, 6469: GG type, 5572: GC type, 5456: GC type, 5902: GC type. The two results are compared to obtain the genotyping result detected by the test strip which is completely consistent with the genotyping result of the direct sequencing of the blood sample (see tables 1-3).

TABLE 1-3 comparison of test strip assay systems with direct sequencing results

Discussion 4

4.1 LNA modification of primers for SNP site detection

Theoretically, Polymerase Chain Reaction (PCR) can be successfully performed only when the single strand of the template and the primer are correctly matched according to the base pairing principle. Therefore, a set of PCR primers with only one base difference is designed in the region containing the base difference, the amplification is carried out by using a conventional PCR amplification instrument, whether an amplification product with the length according with the designed fragment is generated or not is detected, and the base type of the target site in the target region can be judged. However, when conventional PCR primers are used, even if a single-base mismatch or even a three-to four-base mismatch is present, the PCR reaction may be carried out normally to obtain an amplification product having the same length as the target fragment. Therefore, when PCR amplification typing is performed using conventional primers, false positive results cannot be eliminated, and thus erroneous genotyping results may be obtained.

Locked Nucleic Acids (LNAs) refer to RNA derivatives in which 2 'rasonic acids and 4' rasonic acids are connected by methylene bridges in a rasonic sugar ring, and can be paired with DNA or RNA according to the general base pairing principle. The bridging structure increases the stability of the nucleic acid skeleton, improves the annealing temperature, enhances the specificity of base pairing and greatly reduces the probability of mismatching. Therefore, the locked nucleic acid is widely applied to a plurality of fields such as gene chip, RNA interference and the like^[70]。

The application designs the SNP locus amplification primer by LNA modification, the 3 'end of a forward primer or a reverse primer in the amplification primer corresponds to the SNP locus to be detected, and LNA modification is carried out on the nucleotide on the 3' end primer of the SNP locus to be detected, so that the result obviously improves the specificity of the combination of a PCR amplification primer and a template DNA chain, and the PCR amplification is carried out completely and correctly according to the base pairing principle, thereby achieving the purpose of judging the nucleotide type of a target site by detecting the existence of an amplification product and realizing the genotyping of the SNP locus to be detected. The annealing temperature of the primer modified by LNA is higher than that of the unmodified primer, so that an annealing temperature gradient experiment is carried out in the early primer screening stage to ensure that the reaction system is at the optimal temperature. In the present application, the single and bright amplified bands appear at annealing temperature gradients of 55 ℃, 57 ℃, 59 ℃, 61 ℃ and 63 ℃, but the bands are relatively dim at 65 ℃. The reason is that the annealing temperature is not optimal at 65 ℃, but the final annealing temperature is 65 ℃, because the requirement on the annealing temperature can be met at the highest temperature, and the existence of primer dimer can be reduced. If the temperature variation range is narrowed and the unit variation temperature is reduced under certain conditions, the optimal result can still not be obtained, so that measures of shortening the annealing step time and/or reducing the PCR amplification cycle number are taken, and the annealing temperature gradient PCR amplification is carried out again until the optimal annealing temperature is determined.

4.2 establishment of test paper strip detection system for SNP locus

When designing the MC4R gene SNP detection primer, two primers are designed and respectively marked as Biotin (Biotin), Fluorescein Isothiocyanate (FITC) or 6-carboxyfluorescein (6-FAM). And ensures that the two markers can be simultaneously integrated on the double-chain amplification product, and the reaction result can be directly observed by a test strip without using an agarose gel system for detection. Because the test strip follows the combination principle of antigen and antibody in the color development process, the reaction sensitivity is one to two orders of magnitude higher than that of agarose gel observed under an ultraviolet lamp by naked eyes, and meanwhile, complicated agarose gel electrophoresis still needs to be carried out after the amplification is finished, so that the observation under the ultraviolet lamp also poses certain threat to the body health of detection personnel. The established rapid detection and typing system of the nucleic acid test strip is slightly lower than the cost of the traditional direct sequencing, the single market price of the test strip of the rapid detection and typing system of the nucleic acid test strip is 10-15 yuan, and the single market price of the direct sequencing method is 20-30 yuan.

4.3 false positive prevention and suggestion of primer in SNP locus test strip detection system

It should be noted that when primer dimer exists in the reaction system, since the structure of dimer also conforms to the structure with modified structure at both ends, even if no target fragment is generated in the negative result, the test strip still has a positive result, i.e. false positive, due to the primer dimer.

To avoid the generation of false positives, the following method can be used:

1. the annealing temperature should be raised as much as possible to reduce the generation of primer dimers under the premise of satisfying the annealing temperature of the amplification conditions, and 65 ℃ is finally selected in the temperature gradient of PCR amplification of the corresponding genotype individuals for the SNP detection primers in the application.

2. Properly adjusting the template concentration and the primer concentration, and reducing the primer concentration when the optimal template concentration of positive results of amplification products on the test strip is ensured; or increasing the template concentration when the optimal primer concentration for ensuring that the amplification product has a positive result on the test strip.

3. The concentration of Mg2+ is too high, the PCR cycle number is too much, primer dimer can be generated, the concentration of Mg2+ can be reduced, and the cycle number can be reduced.

4. The PCR product is used as template for secondary PCR, and the original product may be diluted in different times to raise the specificity of the primer and the template and reduce primer dimer.

5. Meanwhile, a large number of experiments show that the generation of primer dimer has a great relationship with the base sequence of the primer, the A → T base appears at the tail of the primer and is more prone to have false positive compared with C → G, the A → T appears at the tail of the primer can be avoided as much as possible when the primer is designed, and if the A → T base cannot be avoided, a plurality of pairs of alternative primers need to be designed for screening.

The establishment of the rapid detection method of the SNP locus test strip detection system avoids the complexity of the operation of the traditional PCR-SSCP or PCR sequencing technology, has wider consumer groups, greatly improves the detection efficiency, and has important significance for improving the basic breeding level of the sheep meat property.

The previous description of the disclosed embodiments is provided to enable any person skilled in the art to make or use the present invention, including any reference to the above-mentioned embodiments. Various modifications to these embodiments will be readily apparent to those skilled in the art. The general principles defined herein may be implemented in other embodiments without departing from the spirit or scope of the invention. Thus, the present invention is not intended to be limited to the embodiments shown herein but is to be accorded the widest scope consistent with the principles and novel features disclosed herein.

Sequence listing

<110> Zhejiang province academy of agricultural sciences

<120> Hu sheep MC4R gene SNPg.732C → G gene SNP locus detection primer, detection test strip and application

<160>3

<170>SIPOSequenceListing 1.0

<210>1

<211>21

<212>DNA

<213> primers (Primer)

<400>1

cgatcaccat cagtgccatc t 21

<210>2

<211>21

<212>DNA

<213> primers (Primer)

<400>2

cgatcaccat cagtgccatg t 21

<210>3

<211>22

<212>DNA

<213> primers (Primer)

<400>3

gatcaggatg gtcagcgtga tc 22

Claims (10)

1. Hu sheep MC4R gene SNPg.732C → G gene SNP locus detection primer, which is characterized in that the detection primer is composed of the following sequence primers:

MC4R-732-F-C：CGATCACCATCAGTGCCATCT；

MC4R-732-F-G：CGATCACCATCAGTGCCATGT；

MC4R-R：GATCAGGATGGTCAGCGTGATC。

2. the Hu sheep MC4R gene SNPg.732C → G gene SNP site detection primer as claimed in claim 1, wherein the upstream primer 5 carries out BIOTIN modification and the downstream primer 3 carries out FITC modification.

3. The test strip for testing Hu sheep MC4R gene SNPg.732C → G gene typing is characterized in that the test strip comprises the detection primer of claim 1 or 2.

4. The test strip of claim 3, further comprising blood from a wild homozygous CC individual, genomic DNA from a wild homozygous CC individual, blood from a mutant homozygous GG individual, genomic DNA from a mutant homozygous GG individual, and a negative control in which equal volumes of double distilled water replace blood and DNA template.

5. The use of the detection primer of claim 1 or 2 and the detection test strip of claim 3 or 4 for screening Hu sheep size traits or Hu sheep molecular marker assisted breeding.

6. A method for detecting the SNPg.732C → G genotyping of Hu sheep MC4R gene, which is characterized in that the method adopts the detection primer of claim 1 or 2, and comprises the following steps:

1) the MC4R-732-F-C + MC4R-R primer reacts with a blood template of a wild homozygous CC individual;

2) the MC4R-732-F-G + MC4R-R primer reacts with the blood template of the mutation homozygous GG individual, and the MC4R-732-F-C + MC4R-R primer with the mismatch genotype group reacts with the blood template of the mutation homozygous GG individual;

3) the MC4R-732-F-G + MC4R-R primer reacts with the blood template of the mutation homozygous CC individual;

4) after the reaction is finished, adding 2 mu L of 6 XLoading Buffer into a target product amplified by 4 mu LPCR, blowing, sucking and uniformly mixing, spotting on 1.5% agarose gel, and performing 200V electrophoresis for 15 min; staining for 5min in EB, observing under ultraviolet lamp, and taking picture.

7. The detection method according to claim 6, wherein the reaction system in the steps 1), 2) and 3) is as follows:

the reaction conditions were set as follows: pre-denaturation at 94 ℃ for 2 min; denaturation at 98 deg.C for 10s, annealing at 65 deg.C, reaction time 30s, extension at 68 deg.C for 30s, 32 cycles, and storage at 4 deg.C.

8. A method for detecting Hu sheep MC4R gene SNPg.732C → G genotyping, which is characterized in that the method adopts the test strip of claim 3 or 4, and comprises the following steps:

1) the reaction was performed using MC4R-732-F-C + MC4R-R primers, with the templates set to: blood of a wild homozygous CC individual, genome DNA of the wild homozygous CC individual, blood of a mutant homozygous GG individual, genome DNA of the mutant homozygous GG individual and negative control of replacing blood and a DNA template by double distilled water with the same volume;

meanwhile, MC4R-732-F-G + MC4R-R primer reaction is used, and the templates are respectively set as follows: blood of a wild homozygous CC individual, genome DNA of the wild homozygous CC individual, blood of a mutant homozygous GG individual, genome DNA of the mutant homozygous GG individual and negative control of replacing blood and a DNA template by double distilled water with the same volume;

2) after the reaction is finished, opening the PCR reaction tube, inserting the bonding pad end of the test strip into the PCR reaction tube, keeping the test strip flat for 1min after the interpretation area is completely infiltrated, and waiting for a red strip to appear; and directly reading the detection result according to the color development condition of the test strip.

9. The detection method according to claim 8, wherein the reaction system in step 1) is as follows:

the reaction conditions were set as follows: pre-denaturation at 94 ℃ for 2 min; denaturation at 98 deg.C for 10s, annealing at 65 deg.C, reaction time 30s, extension at 68 deg.C for 30s, 32 cycles, and storage at 4 deg.C.

10. Use of the method of any one of claims 6-9 for screening Hu sheep size traits or Hu sheep molecular marker assisted breeding.

Images