CN111621549A - LAMP (loop-mediated isothermal amplification) rapid detection method for bacterial blight in rice seeds and application - Google Patents
LAMP (loop-mediated isothermal amplification) rapid detection method for bacterial blight in rice seeds and application Download PDFInfo
- Publication number
- CN111621549A CN111621549A CN202010502406.5A CN202010502406A CN111621549A CN 111621549 A CN111621549 A CN 111621549A CN 202010502406 A CN202010502406 A CN 202010502406A CN 111621549 A CN111621549 A CN 111621549A
- Authority
- CN
- China
- Prior art keywords
- rice
- lamp
- primer
- rice seed
- seq
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/689—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for bacteria
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
- Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
- Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
- Y02A50/30—Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Analytical Chemistry (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Biophysics (AREA)
- Immunology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Biotechnology (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention belongs to the field of crop molecular genetic breeding science, and discloses a LAMP (loop-mediated isothermal amplification) rapid detection method for rice seed-borne blight bacteria, which comprises the following steps: (1) taking a rice seed sample, and extracting the genomic DNA of the rice seed sample. (2) Adding the rice seed genome DNA template into an LAMP reaction system to carry out loop-mediated isothermal amplification. Judging whether the sample contains the rice bacterial blight according to the color change of the reaction solution. The method provided by the invention can be used for quickly and accurately diagnosing whether rice seeds contain the bacterial blight of rice or not, is favorable for preventing and treating the bacterial blight of rice and reduces economic loss.
Description
Technical Field
The invention belongs to the field of crop molecular genetic breeding science, and relates to a rapid LAMP detection method for rice bacterial leaf blight in rice seeds and application thereof.
Background
The rice is one of the most important grain crops in China, and has important significance for guaranteeing the grain safety and the economic growth of China. Bacterial leaf blight is the most important bacterial disease in rice production, and the bacterial leaf blight is spread to a seedling bed through water flow to cause seedling diseases. Flooding in the seedling stage, the probability of infection of seedlings is increased, the more times of flooding and top submerging are increased, the longer the flooding time is, and the higher the bacteria carrying rate of the seedlings is. However, rice seeds produced by diseased paddy also carry the blight bacteria and are continuously spread along with the sowing of the rice seeds in the next year, so that the planting of the seeds without pathogenic bacteria is very important for controlling the disease.
LAMP (Loop-mediated isothermal amplification) is a novel Nucleic acid amplification technology (Notomi T, Okayama H, Masubuchi H, et al. Loop-mediated isothermal amplification of DNA [ J ]. Nucleic Acids Research,2000,28(12): e63.) disclosed by Notomi, a Japanese scholars in 2000, and is a technology capable of designing four primers for six regions of a DNA template under a constant temperature condition and amplifying DNA by using a strand-displacing polymerase. Because of its extremely high specificity and sensitivity and the property that the reaction takes place at constant temperature, the loop-mediated isothermal amplification technique has been widely used in the field of pathogen detection.
Disclosure of Invention
The purpose of the invention is: the invention establishes a method for rapidly detecting the bacterial blight in rice seeds based on LAMP technology (loop-mediated isothermal amplification technology), provides a convenient, rapid, safe and reliable detection technology for agricultural production, and can realize the purpose by the following technical scheme:
an LAMP primer composition comprises a primer F3 shown in SEQ ID NO.1, a primer B3 shown in SEQ ID NO.2, a primer FIP shown in SEQ ID NO.3, a primer BIP shown in SEQ ID NO.4, a primer LF shown in SEQ ID NO.5 and a primer LB shown in SEQ ID NO. 6.
The LAMP primer composition disclosed by the invention is applied to detection of rice seed blight bacteria.
An LAMP rapid detection kit for detecting rice seed bacterial blight, which comprises the LAMP primer composition.
The LAMP technology (loop-mediated isothermal amplification technology) for detecting rice seed blight pathogen comprises the following operation steps:
(1) taking a rice seed sample, and extracting the genomic DNA of the rice sample;
(2) LAMP primers are carried out on a section of 168bp sequence (NCBI accession number: AF 16901931) in the rice bacterial blight gene, the section of DNA sequence is never used for detecting bacterial blight, a plurality of groups of primers are designed aiming at the section of DNA sequence, the primers with poor amplification effect and poor stability are removed through a large amount of screening work, and finally a group of primers are left as shown in Table 1.
(3) According to the system: 10 × Isothermal amplification buffer 2.5ul, 5M Betaresolution 4ul, 2mM HNB (hydroxynaphthol blue) solution 2 μ L, 2uM LAMP primers FIP and BIP described in Table 1 each 2.0 μ L, 10uM LAMP primers F3 and B3 described in Table 1 each 1.0 μ L, 10 μ M LAMP primers LF and LB described in Table 1 each 0.5 μ L, 10mMdNTP Mix 3.5.0 μ L, 8U/. mu.l Bst DNA Polymerase 1.0 μ L, and rice seed sample genomic template DNA 2.0 μ L, sequentially adding to the test tube, adding water to 26 μ L, and mixing well.
(3) The above system was placed on a biormeter amplification apparatus for amplification. The reaction temperature was constant 65 ℃ for one hour. Observing the color change in the test tube after the reaction is finished, and detecting the rice bacterial blight if the color of the reaction solution is changed from purple to blue; if the color of the reaction solution is not changed, the seeds do not contain the rice bacterial blight germ.
TABLE 1 LAMP primer sequences
| Name (R) | Primer sequences (5 '-3') |
| F3 | CATCGGATGCGCGCTATC(SEQ ID NO.1) |
| B3 | CCAAGTGGACGACAATGGTC(SEQ ID NO.2) |
| FIP | GGTCGCTTGGACTCAGCATGAGCTCAAAGCATTTGGTCTGC(SEQ ID NO.3) |
| BIP | ACCTGCACATTGGCGACGTTAGCTGCCAATTTTCGAGCAC(SEQ ID NO.4) |
| LF | GGATGAAGATTATCGATCGCAACT(SEQ ID NO.5) |
| LB | CCGAAGAAAACACCTGGGG(SEQ ID NO.6) |
Advantageous effects
The method for rapidly detecting the rice seed blight germ by using the LAMP technology (loop-mediated isothermal amplification) has the following advantages:
(1) the reaction is carried out at a constant temperature of 65 ℃, so that only one water bath is needed, and the detection cost is saved. In addition, the detection result is visual, the detection result is judged by observing the color change of the reaction liquid by naked eyes, and the reaction time is only 1h, so that the method is convenient and quick.
(2) The detection sensitivity is high. Compared with the traditional PCR amplification detection, the detection sensitivity of the invention is improved by 100 times.
Matters of attention
(1) Various reagents used for LAMP detection are easily polluted to cause false positive, care must be taken in the operation process, and the influence of the polluted reagents on the experimental result is avoided.
(2) Ventilation was noted in the laboratory due to aerosol contamination. The reacted test tube, the lance head and the like need to be processed in time.
Description of the drawings:
FIG. 1: and (3) performing a rice seed genome DNA loop-mediated isothermal amplification result.
Wherein: tubes No.1 and No.2 are negative controls for water addition, and the result is purple; no. 3-8 tubes are added with 6 groups of rice seed genome DNA templates, and the result is blue, which indicates that No. 3-8 tubes of rice seeds all contain the bacterial blight.
FIG. 2: location of LAMP primers
FIG. 3: comparison of sensitivity between general PCR and LAMP
Wherein: tube 1 and tube 2 in LAMP are negative control of water addition, and the result is purple; no. 3-8 tubes are respectively the DNA amplification results of the rice bacterial blight pathogenic bacteria with the concentrations of 100ng/ul, 10ng/ul, 1ng/ul, 100pg/ul, 10pg/ul and 1 pg/ul; wherein tubes 3-8 are blue. B. The number 1-6 bands in the common PCR are respectively 100ng/ul, 10ng/ul, 1ng/ul, 100pg/ul, 10pg/ul and 1pg/ul of the amplification result of the DNA of the rice bacterial blight pathogenic bacteria.
FIG. 4: and (5) LAMP specificity verification.
Wherein: tube 1 is a water-adding negative control, and the result is purple; tube 2 is a positive control of DNA of Bacillus albus, and the result is blue; 3-10 tubes added with DNA from other bacteria, the result was purple.
Detailed Description
Example 1
Materials and methods:
1. bacterial blight of rice; rice seeds from group 6 diseased cereals.
The DNA extraction method comprises the following steps: the CTAB method is used for extracting the genome DNA of the rice bacterial blight microspecies PXO99 and 6 groups of rice seeds.
3, LAMP reaction system: the volume was 26ul, with 20uM FIP and BIP primers 2ul, 10uM F3 and B3 primers 0.5ul, 10uM LF and LB primers 1ul, 10mM dNTPs 3.5ul, 8U/ul Bst DNA polymerase 1ul, 50mM MgSO44ul, 10 × isothermermal amplification buffer 2.5ul, 5M Betain solution 4ul, 2mM HNB2ul, template DNA 1ul, added to the tube in sequence, and water was added to 26ul and mixed well.
The reaction conditions are as follows: amplifying for 1h at constant temperature of 65 ℃ under a closed condition. Judging the reaction result according to the color change, if the reaction solution is changed from purple to blue, proving that the sample contains the rice bacterial blight, and if the solution color is not changed, proving that the sample does not contain the rice bacterial blight.
(II) results and analysis:
the research results show that the reaction liquid in the No. 3-8 tubes is changed, which indicates that 6 groups of rice seeds all have rice bacterial blight.
Example 2
Materials and methods:
1. bacterial strain of bacterial leaf blight of rice.
The DNA extraction method comprises the following steps: extracting the genome DNA of the bacterial blight strain of rice by a CTAB method.
3. The DNA of the microspecies PXO99 of the rice bacterial blight is diluted in a concentration gradient way to be 100ng/ul, 10ng/ul, 1ng/ul, 100pg/ul, 10pg/ul and 1pg/ul respectively.
An LAMP reaction system: the volume was 26ul, with 20uM FIP and BIP primers 2ul, 10uM F3 and B3 primers 0.5ul, 10uM LF and LB primers 1ul, 10mM dNTPs 3.5ul, 8U/ul Bst DNA polymerase 1ul, 50mM MgSO44ul, 10 × isothermermal amplification buffer 2.5ul, 5M Betain solution 4ul, 2mM HNB2ul, template DNA 1ul, added to the tube in sequence, and water was added to 26ul and mixed well.
The reaction conditions are as follows: amplifying for 1h at constant temperature of 65 ℃ under a closed condition. Judging the reaction result according to the color change, if the reaction solution is changed from purple to blue, proving that the sample contains the rice bacterial blight, and if the solution color is not changed, proving that the sample does not contain the rice bacterial blight.
General PCR reaction System: the volume was 10ul, with 1ul, ddH for each of the F3 and B3 primers (identical to the LAMP's F3, B3 primers)2O2 ul, DNA template 1ul, PCR mix 5 ul.
The reaction conditions are as follows: at 95 ℃ for 5min, at 95 ℃ for 15s, at 56 ℃ for 15s, at 72 ℃ for 20s for 30 cycles, at 72 ℃ for 5 min.
(II) results and analysis:
in LAMP reaction, the DNA content of the rice bacterial blight is 1pg/ul and can still be detected, while the DNA content of the rice bacterial blight can only be detected by common PCR to be 100 pg/ul. The LAMP detection sensitivity of the invention is 100 times of that of the common PCR.
Example 3
Materials and methods:
1. bacterial blight of rice; rice leaf spot (x.oryzae pv. oryzae), rice sheath blight (Burkholderia glumae), rice bacterial brown spot (p.syringae pv. syringae vanholl), yellow single cell cabbage rot (x.campholris), rice bacterial brown stripe (a.avenae sp. avenae), Pseudomonas syringae tomato pathogenic variety DC3000(Pseudomonas syringae), Escherichia coli (Escherichia coli), Agrobacterium (Agrobacterium tumefaciens).
The DNA extraction method comprises the following steps: genomic DNA of each strain was extracted by the CTAB method.
3, LAMP reaction system: the volume was 26ul, with 20uM FIP and BIP primers 2ul, 10uM F3 and B3 primers 0.5ul, 10uM LF and LB primers 1ul, 10mM dNTPs 3.5ul, 8U/ul Bst DNA polymerase 1ul, 50mM MgSO44ul, 10 × isothermermal amplification buffer 2.5ul, 5M Betain solution 4ul, 2mM HNB2ul, template DNA 1ul, added to the tube in sequence, and water was added to 26ul and mixed well.
The reaction conditions are as follows: amplifying for 1h at constant temperature of 65 ℃ under a closed condition. And judging the reaction result according to the color change. If only the color of the reaction solution containing the DNA of the rice bacterial blight bacterium is changed and the color of the reaction solution containing the DNA of other bacteria is not changed, the LAMP system has strong specificity. (II) results and analysis:
only tube No.2 containing rice bacterial blight DNA had changed color, and the other tubes had no change in color. The LAMP system is proved to have high sensitivity and strong specificity.
Sequence listing
<110> Nanjing university of agriculture
<120> LAMP rapid detection method for bacterial blight in rice seeds and application
<160>6
<170>SIPOSequenceListing 1.0
<210>1
<211>18
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>1
catcggatgc gcgctatc 18
<210>2
<211>20
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>2
ccaagtggac gacaatggtc 20
<210>3
<211>41
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>3
ggtcgcttgg actcagcatg agctcaaagc atttggtctg c 41
<210>4
<211>40
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>4
acctgcacat tggcgacgtt agctgccaat tttcgagcac 40
<210>5
<211>24
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>5
ggatgaagat tatcgatcgc aact 24
<210>6
<211>19
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>6
ccgaagaaaa cacctgggg 19
Claims (6)
1. An LAMP primer composition is characterized by consisting of a primer F3 shown in SEQ ID NO.1, a primer B3 shown in SEQ ID NO.2, a primer FIP shown in SEQ ID NO.3, a primer BIP shown in SEQ ID NO.4, a primer LF shown in SEQ ID NO.5 and a primer LB shown in SEQ ID NO. 6.
2. The LAMP primer composition of claim 1, which is applied to detection of rice seed blight disease.
3. An LAMP rapid detection kit for detecting rice seed blight, characterized by comprising the LAMP primer composition of claim 1.
4. A LAMP rapid detection method for rice bacterial blight in rice seeds is characterized by comprising the following steps:
(1) taking a rice seed sample, and extracting the genomic DNA of the rice seed sample;
(2) performing loop-mediated isothermal amplification on the genomic DNA of the rice seed sample by using the LAMP primer composition of claim 1, wherein the amplification result is directly judged by the color change of a reaction solution: if the color of the reaction solution is changed from purple to blue, the rice seed sample contains rice bacterial blight original bacteria; if the color of the reaction solution is not changed, the rice seed sample does not contain the bacterial blight.
5. The LAMP rapid detection method according to claim 4, characterized in that the LAMP reaction system is: the volume was 26ul, with 20uM FIP and BIP primers 2ul, 10uM F3 and B3 primers 0.5ul, 10uM LF and LB primers 1ul, 10mM dNTPs 3.5ul, 8U/ul Bst DNA polymerase 1ul, 50mM MgSO44ul, 10 × isothermamamplification buffer 2.5ul, 5M Betain solution 4ul, 2mM HNB2ul, and template DNA 1ul being filled up to 26ul with water.
6. The LAMP rapid detection method according to claim 4, characterized in that the reaction conditions of the loop-mediated isothermal amplification are: amplifying for 1h at constant temperature of 65 ℃ under a closed condition.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202010502406.5A CN111621549B (en) | 2020-06-05 | 2020-06-05 | LAMP (loop-mediated isothermal amplification) rapid detection method for bacterial blight in rice seeds and application |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202010502406.5A CN111621549B (en) | 2020-06-05 | 2020-06-05 | LAMP (loop-mediated isothermal amplification) rapid detection method for bacterial blight in rice seeds and application |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN111621549A true CN111621549A (en) | 2020-09-04 |
| CN111621549B CN111621549B (en) | 2022-07-12 |
Family
ID=72269189
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202010502406.5A Active CN111621549B (en) | 2020-06-05 | 2020-06-05 | LAMP (loop-mediated isothermal amplification) rapid detection method for bacterial blight in rice seeds and application |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN111621549B (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN114350758A (en) * | 2021-12-31 | 2022-04-15 | 杭州飞时达生物科技有限公司 | Primer group and kit for rapidly detecting pathogenic bacteria of bacterial leaf blight of rice based on LAMP |
Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101608235A (en) * | 2009-03-27 | 2009-12-23 | 南京农业大学 | Padlock probe and the multiple detection method of rice leaf spot bacteria and paddy rice slice germ |
| CN204287191U (en) * | 2014-11-26 | 2015-04-22 | 江南大学 | The two-in-one immune colloid gold Rapid detection test strip of a kind of rice leaf spot bacteria and xanthomonas oryzae pv. oryzicola |
| CN105063193A (en) * | 2015-07-31 | 2015-11-18 | 江西师范大学 | HDA kit and detecting method for detecting xanthomonas oryzae of rice |
| CN107338312A (en) * | 2017-08-09 | 2017-11-10 | 中国检验检疫科学研究院 | A kind of method and kit that rice leaf spot bacteria is detected using digital pcr |
-
2020
- 2020-06-05 CN CN202010502406.5A patent/CN111621549B/en active Active
Patent Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101608235A (en) * | 2009-03-27 | 2009-12-23 | 南京农业大学 | Padlock probe and the multiple detection method of rice leaf spot bacteria and paddy rice slice germ |
| CN204287191U (en) * | 2014-11-26 | 2015-04-22 | 江南大学 | The two-in-one immune colloid gold Rapid detection test strip of a kind of rice leaf spot bacteria and xanthomonas oryzae pv. oryzicola |
| CN105063193A (en) * | 2015-07-31 | 2015-11-18 | 江西师范大学 | HDA kit and detecting method for detecting xanthomonas oryzae of rice |
| CN107338312A (en) * | 2017-08-09 | 2017-11-10 | 中国检验检疫科学研究院 | A kind of method and kit that rice leaf spot bacteria is detected using digital pcr |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN114350758A (en) * | 2021-12-31 | 2022-04-15 | 杭州飞时达生物科技有限公司 | Primer group and kit for rapidly detecting pathogenic bacteria of bacterial leaf blight of rice based on LAMP |
| CN114350758B (en) * | 2021-12-31 | 2024-04-19 | 杭州飞时达生物科技有限公司 | Primer group and kit for detecting bacterial leaf blight pathogenic bacteria of rice based on LAMP |
Also Published As
| Publication number | Publication date |
|---|---|
| CN111621549B (en) | 2022-07-12 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Chakraborty et al. | Evaluation of phosphate solubilizers from soils of North Bengal and their diversity analysis | |
| CN106399490B (en) | LAMP primer group for detecting phytoplasma and kit and application thereof | |
| CN113151522A (en) | LFD-RPA technology-based rice bacterial leaf streak germ detection kit, primer probe composition and application thereof | |
| CN111621549B (en) | LAMP (loop-mediated isothermal amplification) rapid detection method for bacterial blight in rice seeds and application | |
| CN108004346B (en) | Wheat gene Yr10 molecular marker and application thereof in screening wheat with wheat stripe rust resistance | |
| CN117344054A (en) | Molecular marker primer for amplifying wheat powdery mildew resistance gene pmXQ-0508 and application thereof | |
| Galetto et al. | Real-time PCR diagnosis and quantification of phytoplasmas | |
| CN109371110B (en) | LAMP (loop-mediated isothermal amplification) detection kit for bacterial canker pathogen of poplar | |
| CN110699475A (en) | Padlock probe of pecan alternaria alternata and detection method thereof | |
| Villadas et al. | Identification of nodule-dominant Rhizobium meliloti strains carrying pRmeGR4b-type plasmid within indigenous soil populations by PCR using primers derived from specific DNA sequences | |
| CN112662804B (en) | Primer group, kit and method for detecting pathogenic variation of avirulence gene AvrPi9 of rice blast | |
| CN114958835A (en) | Combination product and kit for detecting bacterial rice blight bacteria | |
| CN115029470A (en) | Combination product and kit for detecting rice bacterial blight | |
| CN111100940B (en) | Method for rapidly detecting pseudomonas in needle mushroom culture material | |
| CN110804674B (en) | Primer probe composition and kit for detecting soybean root rot based on recombinase polymerase amplification method and application of primer probe composition and kit | |
| CN112522428A (en) | Method for rapidly detecting Arthrobacter attheifer in needle mushroom culture material | |
| KR101478921B1 (en) | Primer for loop-mediated isothermal amplification reaction for detecting Arcobacter spp., and method for detecting Arcobacter spp. using the same | |
| KR101995575B1 (en) | Primer set for discriminating Pseudomonas syringae pathovars and uses thereof | |
| CN114774576A (en) | LAMP (loop-mediated isothermal amplification) rapid detection method for rice blast germs in rice seeds and application | |
| CN116397041B (en) | InDel marker SiDmr6 closely linked with millet saline-alkali sensitivity, primer and application thereof | |
| CN111979340A (en) | Specific primer and probe for identifying European cherry fruit fly and application of specific primer and probe | |
| CN113897456B (en) | Real-time fluorescence PCR detection primer probe combination and detection kit for four fir anthracnose pathogens and application of kit | |
| CN114672578B (en) | Primer composition for detecting corynebacterium bovis and application of primer composition | |
| CN114164296B (en) | Primer probe composition for detecting pythium oligandrum, kit and application and detection method | |
| CN110273017B (en) | Primer for detecting bacillus subtilis by loop-mediated isothermal amplification method and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |