CN111607663B - IRAP molecular marker developed based on tea tree retrotransposon sequence and application thereof - Google Patents

Abstract

The invention relates to an IRAP molecular marker developed based on a tea tree retrotransposon sequence and application thereof, belongs to the field of biotechnology, and successfully develops the IRAP molecular marker based on a Ty3-gypsy retrotransposon transcriptase sequence, wherein the IRAP molecular marker, namely a primer F1R2, F4R1 or F6R1 can be used for germplasm distinction of different tea trees, has stable result, high efficiency and difficult environmental influence, can be effectively applied to species analysis of tea tree germplasm resources in various regions and research on species genetic relationship analysis, and provides a new way for the research fields of germplasm identification, genetic relationship analysis, genetic diversity analysis and the like of the tea trees. Has great significance for the aspects of excellent variety improvement, cultivation, identification of tea plant cultivation variation method and the like on the germplasm resources of tea plants.

Description

IRAP molecular marker developed based on tea tree retrotransposon sequence and application thereof

Technical Field

The invention belongs to the technical field of biology, and particularly relates to an IRAP molecular marker developed based on a tea tree retrotransposon sequence and application thereof.

Background

Tea tree (Camellia sinensis l.o.ktze) is a perennial woody plant of the genus Camellia of the family theaceae, and originates in the southwest and south China. In recent years, through nationwide resource investigation and system arrangement, the tea tree classification system is gradually improved, but due to complicated hybridization and variation in evolution, the existing tea tree species systematic classification research still has many divergences. The classification of tea tree species is mainly based on morphological characteristics, and in recent years, with the application of various biological technologies, the classification of tea tree species needs to obtain a reliable result based on multivariate evidences such as morphology, biochemistry, molecular biology and the like. The DNA molecular marker makes up the defects of the traditional morphological marker classification method by the characteristics of rapidness and relative accuracy, and becomes a powerful tool for the modern tea tree taxonomy research. Complex tea plant genetic phenomena such as environmental response, quantitative traits and the like have been developed successively with the help of DNA molecular markers, and RAPD, ISSR, AFLP, DNA bar codes and the like have been widely applied in the research fields of tea plant species identification, genetic diversity analysis, classification evolution and the like. They also have disadvantages, such as RAPD markers are susceptible to environmental influences, and the results obtained are less stable and reproducible; ISSR markers are Mendelian inheritance, and dominant homozygous genotypes and heterozygous genotypes are difficult to distinguish; the dominant marker AFLP has high requirements on the purity of DNA and the quality of endonuclease, and has complex steps and high cost. At present, effective methods and knowledge are still lacked aiming at the classification of tea trees on germplasm resources and the molecular marker research of improved variety breeding.

Transposable elements are important components of the genome of higher plants, and are classified into transposons and retrotransposons; among them, plant retrotransposons are the most abundant transposable element in plants, which was discovered for the first time in 1984 by Shepherd in maize, and through research, retrotransposons have an extremely important role in plant genes and genome structures and evolution, and are one of the important reasons for influencing plant genome size, evolution and gene diversity. Retrotranspositions are classified into LTR and non-LTR retrotransposons according to whether the ends contain long repeats. The LTR retrotransposon is divided into two subclasses of Ty1-copia and Ty3-gypsy according to the protein gene of the coding region. Retrotransposons are of diverse lengthSex and interspecies and intraspecies sequence diversity, and genome diversity in the event that insertion polymorphisms are shown, genetic mutations are induced, leading to biological evolution^[8]These properties determine the potential of retrotransposons for the development of molecular markers. Various molecular marker technologies have been established based on LTR retrotransposons, including SSAP (sequence specific amplification polymorphism), IRAP (retrotransposon site amplification polymorphism), RBIP (retrotransposon insertion polymorphism) and REMAP (retrotransposon-microsatellite amplification polymorphism). Compared with the conventional molecular marker, the molecular marker of the retrotransposon has more obvious advantages, and mainly has the characteristics of wide coverage, large information quantity, high sensitivity and polymorphism and the like, and basically comprises the whole plant genome.

Tea is an important agricultural economic product in Yunnan province, tea germplasm resources are very rich, and with the development of agricultural science and technology, the variety of tea breeding is more and more, but the difference between germplasm materials is smaller and smaller, and the tea breeding is difficult to distinguish by depending on the phenotype alone. The retrotransposon is widely applied, but has not been practically applied in tea trees, and the research on tea tree phylogenetic classification in China lacks corresponding biological basis and technical means, so that the research on tea tree germplasm resources through IRAP molecular markers is hoped to establish a tea tree retrotransposon research method, develop specific molecular markers capable of distinguishing different species, and lay a foundation for the research on tea tree germplasm resource evaluation, the discovery and utilization of excellent genes, tea tree fine variety cultivation and the like.

Disclosure of Invention

The invention successfully develops the IRAP molecular marker based on the Ty3-gypsy retrotransposon transcriptase sequence, the IRAP molecular marker, namely the primers F1R2, F4R1 or F6R1 can distinguish the germplasm of different tea trees, the result is stable, the efficiency is high, the environmental influence is not easily received, the IRAP molecular marker can be effectively applied to the research of species analysis of tea tree germplasm resources in various regions and species genetic relationship analysis, and a new way is provided for the research fields of germplasm identification, genetic relationship analysis, genetic diversity analysis and the like of the tea trees.

In order to realize the purpose, the invention is realized by the following technical scheme:

the IRAP molecular marker primer developed based on the retrotransposon sequence of the tea tree comprises one or more pairs of primers in F1R2, F4R1 and F6R1, and the sequences of the primers are as follows:

(1)F1R2:

Primer F:CTGAAGGAGGAGATTTAT，

Primer R:CGTAAAGCAGGAGTATGATGAA；

(2)F4R1:

Primer F:ACGGTGATTTGGAGGAGGAA，

Primer R:TCGTCGACATAAACAATAAG；

(3)F6R1:

Primer F:GTATGGCCTCAAGCAAGCAC，

Primer R:TCGTCGACATAAACAATAAG。

the IRAP molecular marker primer is applied to germplasm identification, genetic relationship analysis and genetic diversity analysis of tea trees: and (3) performing PCR amplification on the DNA sample of any one or more pairs of primers in the F1R2, F4R1 and F6R1 by using the DNA sample of the tea tree variety to be detected as a template.

Further preferably, the PCR amplification system is: contains 1.25ng of template DNA, 12.5. mu.L of PCR mix, 1.3. mu.L of Primer F, 1.3. mu. L, Taq of Primer R, 0.125U, ddH of enzyme₂O 9.4μL。

Further preferably, the PCR amplification procedure is as follows:

(1) F1R 2: pre-denaturation at 94 ℃ for 10 min; denaturation at 94 deg.C for 45s, annealing at 51 deg.C for 45s, extending at 72 deg.C for 1min, and returning to denaturation cycle for 36 times; final extension at 72 deg.C for 10 min;

(2) F4R 1: pre-denaturation at 94 ℃ for 10 min; denaturation at 94 deg.C for 45s, annealing at 52 deg.C for 45s, extension at 72 deg.C for 1min, and returning to denaturation cycle for 36 times; final extension at 72 deg.C for 10 min;

(3) F6R 1: pre-denaturation at 94 ℃ for 10 min; denaturation at 94 deg.C for 45s, annealing at 52 deg.C for 45s, extension at 72 deg.C for 1min, and returning to denaturation cycle for 36 times; final extension 72 ℃ for 10 min.

The kit for identifying the tea plant germplasm comprises the IRAP molecular marker primer.

The invention has the beneficial effects that:

the invention successfully develops the IRAP molecular marker based on the Ty3-gypsy retrotransposon transcriptase sequence, the IRAP molecular marker, namely the primers F1R2, F4R1 or F6R1 can distinguish the germplasm of different tea trees, the result is stable, the efficiency is high, the environmental influence is not easily received, the IRAP molecular marker can be effectively applied to the research of species analysis of tea tree germplasm resources in various regions and species genetic relationship analysis, and a new way is provided for the research fields of germplasm identification, genetic relationship analysis, genetic diversity analysis and the like of the tea trees. Has great significance for the aspects of excellent variety improvement, cultivation, identification of tea plant cultivation variation method and the like on the germplasm resources of tea plants.

Drawings

FIG. 1 is a sample DNA extraction electrophoresis test chart;

in the figure, CH002 is Jingmaishan mottle; CH005 is Jingmaishan Dapingzhan; CH019 is a large village sample of Jingmaishan mountain; CH033 is dry Jingmaishan glutinous rice; CH034 to CH038 are brute brick ancient camellia mountain samples; CH039 and CH040 are Yiwugu theashan samples; CH041 and CH042 are Yule Gu cha shan samples; CH044, CH047 and CH048 are Yuanyang tea sample; m Lane is DNA 2000 marker (2000 bp, 1000bp, 750bp, 500bp, 250bp and 100bp from top to bottom);

FIG. 2 is an alignment of cloud resistant No. 10 tea Ty3-gypsy retrotransposon transcriptases amino acid sequences;

FIG. 3 is an alignment of amino acid sequences of Zijuan tea tree Ty3-gypsy retrotransposon transcriptases;

FIG. 4 is a dendrogram analysis of the amino acid sequence of the cloud-resistant No. 10 tea Tree Ty3-gypsy retrotransposon transcriptase;

FIG. 5 is an amino acid sequence evolutionary tree analysis of Zijuan tea Tree Ty3-gypsy retrotransposon transcriptase;

FIG. 6-1 is an IRAP-PCR amplification electrophoretic detection map (F1R 2);

in the figure, CH074-1 is a No. 22 sample of Jinggu tree; CH076-1 is Scopus variegatus No. 018 sample; CH083-1 is sample No. 0319; CH084-1 is sample No. 0699; CH086-1 is sample number 0305; CH087-1 is sample No. 0351; CH088-1 is sample No. 0432; the M lane is DNA1000 marker (the size is 1000bp, 700bp, 500bp, 400bp, 300bp, 200bp and 100bp from top to bottom in sequence);

FIG. 6-2 is an IRAP-PCR amplification electrophoretic detection map (F1R 2);

in the figure, CHO76 is a Jinggu ancient tree sample No. 018, CH077 is a long and narrow leaf, CH078 is bovine bloody tea, CH079 is Shifeng, CH080 is Yunmei, CH081-1 is Yun Huai, CH082-1 is a regional trial sample, ZJ1 is rhododendron purpureus, CH089-1 is a 0468 sample, CH085-1 is a 0467 sample, CH072-1 and CH073-1 are Jinggu ancient tree tea, ZJ2 and ZJ3 are rhododendron purpureus, and a lane M is DNA1000 maker (the size of which is from top to bottom is 1000bp, 700bp, 500bp, 400bp, 300bp, 200bp and 100bp in sequence);

FIGS. 6-3 are IRAP-PCR amplification electrophoretic assays (F4R 1);

in the figure, CH072 to CH076 are Jinggu ancient tree tea, CH077 is long and narrow leaves, CH078 is bovine blood tea, CH079 is Shifeng, CH080 is Yunnan plum, ZJ1, ZJ2 and ZJ3 are rhododendron, CH072-1 and CH073-1 are Jinggu ancient tree tea, and M lane is DNA1000 marker (the size is 1000bp, 700bp, 500bp, 400bp, 300bp, 200bp and 100bp from top to bottom in sequence);

FIGS. 6-4 are IRAP-PCR amplification electrophoretic detection maps (F4R 1);

CH060 in the figure is sample No. Taili 1; CH061 is Taili No. 2 sample; CH062 is sample No. 1 of the small house; CH063 is Zizhai subsample; CH064 is sample No. 3 Taili; CH065 is a supplemental sample; CH066 is sample No. 2; CH067 is ancient tea; CH068 is Jinggu ancient tea 20; CH069 is CSA; CH070 is Jinggu ancient tree 21; CH071 is cloisonne ancient tree 135; the M lane is DNA1000 marker (the size is 1000bp, 700bp, 500bp, 400bp, 300bp, 200bp and 100bp from top to bottom in sequence);

FIGS. 6-5 are IRAP-PCR amplification electrophoretic assays (F6R 1);

CH004 in the figure is caulis Miscanthi sinensis; CH002 is macula reforming; CH033 is dried glutinous rice; CH005 is big flat palm; CH019 is a sample from Jingmai Dazhai; CH021 is the second sample of Jingmai Dazhai; CH026 is pulsatilla base; CH 034-CH 039 are brute ancient tea; the M lane is DNA1000 marker (the size is 1000bp, 700bp, 500bp, 400bp, 300bp, 200bp and 100bp from top to bottom in sequence);

FIGS. 6-6 are IRAP-PCR amplification electrophoretic assays (F6R 1);

in the figure, CH029 is Java; CH015 is aixian; CH044, CH047 and CH048 are Yuanyang tea samples; the M lane is DNA1000 marker (the size is 1000bp, 700bp, 500bp, 400bp, 300bp, 200bp and 100bp from top to bottom in sequence);

FIG. 7 is a graph of the cluster analysis of germplasm resources of tea plants tested.

Detailed Description

In order to make the objects, technical solutions and advantages of the present invention more apparent, preferred embodiments of the present invention will be described in detail below to facilitate understanding of the skilled person.

Examples

The experimental identification material is prepared by collecting new shoots of tea trees from Jingmaishan mountain, Jinggu, Yuanyang, Lianghe, Pu' er tea plant and other places in the course of 2015 to 2018, immediately storing the materials with liquid nitrogen, delivering the materials to a laboratory, and storing the materials in a refrigerator at-80 ℃ for extracting DNA. The specific information of the experimental material is shown in Table 1 below.

TABLE 1 tea Tree sample information

1 sample Total DNA extraction

According to the operation instruction of a novel plant group gene rapid extraction kit (Beijing Baitacg biotechnology, Inc.), total DNA extraction is carried out on the collected tea plant materials, the integrity of the extracted DNA is detected by 1% agarose gel electrophoresis, and the extracted DNA is stored in a refrigerator at the temperature of-20 ℃ for later use.

As shown in FIG. 1, the DNA bands are single and clear, and the DNA of the test sample is successfully extracted.

2 IRAP molecular marker primer design

2.1 amplification, cloning and sequence analysis of Ty3-gypsy retrotransposon

Firstly, using Yunan 10# and Zijuan genome DNA as a template, amplifying a Ty3-F (5'-AGMGRATGTGYGTSGAYAT-3') and Ty3-R (5'-CAMACCMRAAMWCACAMT-3') primers to obtain a Ty3-gypsy reverse transcription transposable region of tea trees, carrying out gel recovery on the obtained fragments after 1% agarose electrophoresis, connecting the recovered fragments by a PMD 18-T carrier, carrying out T-A clone sequencing, randomly selecting not less than 40 PCR product clones for each sample fragment, and sending the clones to Populaceae biotechnology company for clone sequencing.

The sequence obtained by clone sequencing is spliced and artificially corrected through Sequencher 5.4.1, and the boundary of Ty3-gypsy retrotransposon is determined according to the existing sequence in GenBank and the vector is removed. The cloned sequence is converted into a corresponding amino acid sequence by DNAstar software, and a gap in data is treated as missing data. The sequences of Ty3-gypsy retrotransposons were aligned using MAFFT v6.8 and BioEdit v 7.0.9. DNAsp v6.0 was used to count mutation sites, nucleotide diversity, genetic diversity index (H), haplotypes, etc. The MEGA7.0 software is adopted to construct a Neighbor-join phylogenetic tree, and the branch length of the tree is the self-expansion probability of 1000 times of repetition.

Sequence analysis of Ty3-gypsy retrotransposon was as follows:

(1) ty3-gypsy retrotransposon transcriptase sequence analysis

The length range of 41 Ty3-gypsy retrotransposon transcriptive enzyme sequences obtained by cloning Yunan No. 10 tea trees is 260-269bp, the average length is 267.5bp, wherein 3 sequences with the length of 260bp, 1 sequence with the length of 265bp, 10 sequences with the length of 266bp and 27 sequences with the length of 269bp are provided; the 42 Ty3-gypsy retrotransposon transcriptases obtained from the clone of Zijuan tea tree have the sequence length of 260-269bp and the average length of 267.3bp, wherein the sequence length of 260bp has 1, the sequence length of 263bp has 2, the sequence length of 265bp has 1, the sequence length of 266bp has 15, the sequence length of 267bp has 1, and the sequence length of 269bp has 22. Ty3-gypsy retrotransposon transcriptase sequence composition is similar to that of other plants, and the sequence is rich in bases A and T, contains 10# (A + T)% of Yunan in the range of 52.69-65.06%, and contains 53.85-65.8% of Zijuan (A + T)%.

Tea tree Ty3-gypsy retrotransposon transcriptase sequences have higher diversity, polymorphism sites of Yunan 10# and Zijuan tea tree are 236 and 232, nucleic acid polymorphism indexes Pi (Nucleotide polymorphism: per site) are 0.53355 and 0.53532 respectively, sample variation indexes (Sampling variation of Pi) are 0.0000817 +/-0.00904 and 0.0000819 +/-0.00905 respectively, and Average nucleic acid difference sites are (Average number of Nucleotide differences) k 129.01161.

All cloned sequences of Yunkan No. 10# are Haplotype (Number of Haplotypes, h:41), Haplotype gene diversity index (Haplotype gene diversity) Hd: 1.000. The mutation index (Variance of Haplotype variability) between haplotypes was 0.00003(Standard development of Haplotype variability: 0.005). There are 40 Haplotypes (Number of Haplotypes, h:40) of the clone 42 belonging to Zizania purpurea, clone 20 and 21 belonging to Hap _20, clone 34 and 35 belonging to Hap _33, and haplotype diversity index (haplotype (gene)) Hd: 0.998. The variation index (Variance of Haplotype variability) between haplotypes was 0.00003(Standard development of Haplotype variability: 0.006).

(2) Ty3-gypsy retrotransposon transcriptase amino acid sequence analysis

The predicted amino acid sequence lengths of all clones of Yunjin 10# and Zijuan were 80-91aa and 75-95aa, respectively. After MAFFT v6.8 is subjected to sequence alignment, the sequence of individual amino acid sequences is found to have large difference and is difficult to have conserved regions with other sequences (see FIGS. 2 and 3). By constructing a phylogenetic tree of Ty3-gypsy retrotransposon transcriptases in tea plant through MEGA7.0 software, we found that the cloud resistant No. 10 Ty3-gypsy can be divided into 6 groups (Group1 to Group6) (see FIG. 4), wherein Group1 and Group6 are the main types; zijuan tea Tree Ty3-gypsy can be divided into 7 groups (Group1 to Group7) (see FIG. 5) wherein Group1 and Group7 are the main types.

2.3 design and screening of IRAP molecular marker primers

The separated tea tree Ty3-gypsy retrotransposon sequences are subjected to multiple alignment by using ClustalX software, 20 IRAP molecular marker primers are designed in relatively conserved regions (AFLHGDLEEEIYM, LKKSLYGLKQAPR, VCKLNKALYGLKQAPRAWF, DQCVYV and LLLYVDDML), primers with stable, clear and good polymorphism in band pattern are screened out (see table 2), and F1R2, F4R1 and F6R1 are selected as three pairs of ideal primers.

TABLE 2 IRAP primer information

3 IRAP molecular marker detection

3.1 PCR amplification

Carrying out PCR amplification on the extracted DNA sample by using the screened primers F1R2, F4R1 and F6R1, wherein the amplification system isDie Plate (genomic DNA)1.25ng, PCR mix 12.5. mu.L, PrimerF 1.3. mu.L, Primer R1.3. mu.L, template DNA ₂0.5μL,ddHO 9.4μL. The amplification procedure is as follows in table 3.

TABLE 3 PCR amplification program Table

3.2 electrophoretic detection

Detecting the PCR amplification result by polyacrylamide gel, which comprises the following steps:

(1) the two vertical electrophoresis glue-making glass plates are cleaned by installing the glass plates, two notch partition plate strips (1.0mm or 1.5mm) are stuck on the glue-making glass plates by purified water or vaseline, and then the two glue-making glass plates are arranged on an electrophoresis tank and clamped and stabilized at two sides by a clamp.

(2) And (3) weighing a proper amount of agarose according to the requirement of the sealing adhesive, weighing a corresponding TBE solution to prepare a 1% agarose solution, and adding the 1% agarose solution into the bottom of the gel glass plate made by the electrophoresis apparatus by using a pipette to cool for later use.

(3) The gel is prepared by weighing 5.33mL of purified water, 2.67mL of 30% acrylamide solution, 2mL of 5 xTBE solution, 80 μ L of 10% ammonium persulfate solution and 10 μ L of TEMED solution according to the proportion, mixing uniformly, slowly pouring the prepared solution into the middle of a gel-making glass plate (taking care not to generate bubbles), and then inserting the gel-making glass plate into a corresponding electrophoresis comb.

(4) And (3) spotting the extracted DNA samples and the Loading Buffer are uniformly mixed in sequence and are sequentially spotted into spotting holes of the gel, and a DNA marker is spotted into the last spotting hole as a reference.

(5) Electrophoresis is carried out by connecting two electrodes of an electrophoresis tank with an electrophoresis apparatus, pouring 0.1 tank two-electrode pair electrophoresis buffer solution into the electrophoresis tank, and carrying out electrophoresis at 180V for about 1h until the bottom of the colloid is finished.

(6) Fixing the polyacrylamide gel with the prepared glass plate after electrophoresis is taken down and placed in a sample washing tray filled with purified water, carefully taking down the gel and placing the gel in a dyeing tray, pouring a fixing solution (prepared by 40mL of purified water, 50mL of ethanol solution and 10mL of glacial acetic acid solution, and the solution is used at present) for fixing for about 30min, and keeping shaking in the fixing process.

(7) Silver staining the fixed gel is washed with purified water for two to three times, and the time is about 5S. Then pouring silver staining solution (silver nitrate is dissolved in 100mL of purified water according to 0.2 g), and carrying out silver staining for 12-15 min while maintaining shaking during the silver staining process.

(8) And (4) washing the silver-dyed gel with purified water for two to three times for about 2S. Then pouring color development liquid (prepared by dissolving 1.5.g of sodium hydroxide in 100mL of purified water, adding 1mL of formaldehyde and 20 muL of 10mg/L sodium thiosulfate, and then using the mixture at present), developing for 5min to 8min, and keeping shaking during the color development process.

(9) And (3) washing the gel subjected to color development with purified water for two to three times, pouring the gel into a self-sealing bag to spread the polyacrylamide gel, discharging water, and placing the gel in a cabinet which is not easy to damage and is protected from light for later observation.

4 data processing

At the same migration site of each primer, a data matrix was established with a band designated "1" and with no band designated "0". And (3) calculating the similarity coefficient among the materials by using NTSYS software and NTSYSpc software, and performing cluster analysis by using a UPGMA method.

5 IRAP molecular marker detection result and analysis

5.1 IRAP-PCR amplification results

According to a 25-mu-L reaction system, 68 samples are subjected to IRAP-PCR amplification, and amplification products are displayed by polyacrylamide gel electrophoresis and silver staining. The partial electrophoretograms are shown in FIGS. 6-1 to 6-6.

5.2 fingerprint map construction

As seen from the results of IRAP-PCR amplification, the ancient tree tea and Taidi tea have obvious difference in amplification results of different primers. In Table 4, the amplification results of the products obtained by the amplification of the three pairs of primers are between 200bp and 300bp, and the bands are clear. The amplification result of the primer F4R1 is that the ancient tree tea is between 100bp and 200bp, the amplification quantity is large, the band is clear, and the band of the Taiji tea is deleted in the region; on the contrary, the amplification results of the Taiji tea are concentrated between 500bp, the bands are clear, the bands of the corresponding region of the ancient tree tea are deleted, and the difference between two tea species can be distinguished through the amplification results of the same primers. Compared with the amplified main band of F1R2, F4R1 and F6R1, the former is between 200bp and 300bp, and the latter is between 100bp and 200bp, so that the method can be used for distinguishing and comparing between species primers.

TABLE 4 IRAP fingerprint identification code of different tea tree varieties

5.3 tea tree germplasm genetic relationship analysis based on IRAP molecular marker

Through the analysis of IRAP-PCR fingerprint, UPGMA of Ntsypc software is utilized to construct a tea tree clustering relation tree (see figure 7) as a sample, and tea tree samples collected from Jinggu county, Lianghe county and partial Pu' er tea tree fine variety fields are positioned at the bottom end of the clustering tree to form a group. The tea tree resources are collected from Puer cities, West Union counties and Jingmai mountains, and are gathered in the other branch, wherein the tea tree resources comprise individual Puer cities, West Union counties and Jingmai counties, and are positioned at the bottom ends of the branches and are transition species of the previous group. While Yiwu, Mantou brick, Yuanyang, Jingmaishan and samples collected from Lincang are clearly grouped. Therefore, the IRAP molecular marker developed by the research has regionality and can distinguish tea tree resources in different tea areas in Yunnan province.

The invention researches IRAP molecular marker development based on Ty3-gypsy retrotransposon transcriptive enzyme sequence and applies to tea plant germplasm resources. Amplifying the Yunjin 10# and the Zijuan by PCR technology to obtain 41 Yunjin 10# Ty3-gypsy reverse transcriptase sequences, wherein the sequence length range is between 260-269bp, and the average length is 267.5 bp; zijuan Ty3-gypsy reverse transcriptase sequence 42 with sequence length range between 260 and 269, and average length of 267.3 bp. The length of both tea-like sequences is the most over 269bp, and the Ty3-gypsy retrotransposon transcriptase sequence composition is found to be similar to the results of other plant species, which indicates the homology of the two sequences in species, and also indicates that the Ty3-gypsy retrotransposon transcriptases have certain conservation among different species genes.

The Ty3-gypsy retrotransposons are widely distributed in the genome of tea trees and play an important role in the diversity of the varieties of the genome of the tea trees. The analysis of the experiment shows that the polymorphic sites of the Yunan 10# and the Zijuan tea tree are 236 and 232, the nucleic acid polymorphism indexes Pi are 0.53355 and 0.53532 respectively, the clone sequences of the polymorphic sites are mostly haplotypes, and the haplotype diversity index (haplotype (gene) diversity) Hd is 1.000 and 0.998 respectively. Therefore, the obtained tea plant species has rich genetic resources, high genetic diversity and the Ty3-gypsy retrotransposon has the potential of developing molecular markers by integrating the information.

In the invention, the IRAP-PCR result is analyzed and the IRAP fingerprint spectrum is constructed, and the obtained clustering analysis chart can distinguish tea tree resources in different tea areas, so that the IRAP molecular marker is the first research on the aspects of application of the IRAP molecular marker to clustering analysis among tea tree varieties, germplasm source places and the like. Tea is an important agricultural economic product in Yunnan province, tea germplasm resources are very rich, and with the development of agricultural science and technology, the variety of tea breeding is more and more, but the difference between germplasm materials is smaller and smaller, and the tea breeding is difficult to distinguish by depending on the phenotype alone. The germplasm of the tea tree is distinguished by using a molecular marking method of the DNA of the tea tree, so that the method is stable in result, high in efficiency and not easy to influence the environment.

Finally, it is noted that the above-mentioned preferred embodiments illustrate rather than limit the invention, and that, although the invention has been described in detail with reference to the above-mentioned preferred embodiments, it will be understood by those skilled in the art that various changes in form and detail may be made therein without departing from the scope of the invention as defined by the appended claims.

Claims (3)

1. IRAP molecular marker primer based on development of tea tree retrotransposon sequence is characterized in that: the IRAP molecular marker primer comprises F1R2, F4R1 and F6R1, and the sequences of the primers are as follows:

（1）F1R2:

Primer F: CTGAAGGAGGAGATTTAT，

Primer R: CGTAAAGCAGGAGTATGATGAA；

（2）F4R1:

Primer F: ACGGTGATTTGGAGGAGGAA，

Primer R: TCGTCGACATAAACAATAAG；

（3）F6R1:

Primer F: GTATGGCCTCAAGCAAGCAC，

Primer R: TCGTCGACATAAACAATAAG。

the application of the IRAP molecular marker primer in genetic relationship analysis and genetic diversity analysis of tea trees is characterized in that: a DNA sample of a tea tree variety to be tested is used as a template, and PCR amplification is carried out on the DNA sample by using the primers F1R2, F4R1 and F6R1 as described in claim 1.

3. Use according to claim 2, characterized in that: the PCR amplification procedure was as follows:

(1) F1R 2: pre-denaturation at 94 ℃ for 10 min; denaturation at 94 deg.C for 45s, annealing at 51 deg.C for 45s, extension at 72 deg.C for 1min, and returning to denaturation cycle for 36 times; final extension at 72 deg.C for 10 min;

(2) F4R 1: pre-denaturation at 94 ℃ for 10 min; denaturation at 94 deg.C for 45s, annealing at 52 deg.C for 45s, extension at 72 deg.C for 1min, and returning to denaturation cycle for 36 times; final extension at 72 deg.C for 10 min;

(3) F6R 1: pre-denaturation at 94 ℃ for 10 min; denaturation at 94 deg.C for 45s, annealing at 52 deg.C for 45s, extension at 72 deg.C for 1min, and returning to denaturation cycle for 36 times; final extension 72 ℃ for 10 min.

Images