CN111593124B - UGT3A2 gene and application of protein coded by same in auxiliary diagnosis of upper gastrointestinal tumor - Google Patents

UGT3A2 gene and application of protein coded by same in auxiliary diagnosis of upper gastrointestinal tumor Download PDF

Info

Publication number
CN111593124B
CN111593124B CN202010514159.0A CN202010514159A CN111593124B CN 111593124 B CN111593124 B CN 111593124B CN 202010514159 A CN202010514159 A CN 202010514159A CN 111593124 B CN111593124 B CN 111593124B
Authority
CN
China
Prior art keywords
ugt3a2
gene
cancer
protein
adenocarcinoma
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Active
Application number
CN202010514159.0A
Other languages
Chinese (zh)
Other versions
CN111593124A (en
Inventor
宋昕
靳艳
王立东
赵学科
王盼盼
杨媛啧
范宗民
韩雪娜
王苒
李贝
秦艳茹
李秀敏
陈志国
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
First Affiliated Hospital of Zhengzhou University
Xinxiang Medical University
Original Assignee
First Affiliated Hospital of Zhengzhou University
Xinxiang Medical University
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by First Affiliated Hospital of Zhengzhou University, Xinxiang Medical University filed Critical First Affiliated Hospital of Zhengzhou University
Priority to CN202010514159.0A priority Critical patent/CN111593124B/en
Publication of CN111593124A publication Critical patent/CN111593124A/en
Application granted granted Critical
Publication of CN111593124B publication Critical patent/CN111593124B/en
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
    • C12Q1/6886—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material for cancer
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K45/00—Medicinal preparations containing active ingredients not provided for in groups A61K31/00 - A61K41/00
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00—Antineoplastic agents
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/85—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
    • C12N15/86—Viral vectors
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/87—Introduction of foreign genetic material using processes not otherwise provided for, e.g. co-transformation
    • C12N15/90—Stable introduction of foreign DNA into chromosome
    • C12N15/902—Stable introduction of foreign DNA into chromosome using homologous recombination
    • C12N15/907—Stable introduction of foreign DNA into chromosome using homologous recombination in mammalian cells
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N5/00—Undifferentiated human, animal or plant cells, e.g. cell lines; Tissues; Cultivation or maintenance thereof; Culture media therefor
    • C12N5/06—Animal cells or tissues; Human cells or tissues
    • C12N5/0602—Vertebrate cells
    • C12N5/0693—Tumour cells; Cancer cells
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
    • G01N33/573—Immunoassay; Biospecific binding assay; Materials therefor for enzymes or isoenzymes
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
    • G01N33/574—Immunoassay; Biospecific binding assay; Materials therefor for cancer
    • G01N33/57407—Specifically defined cancers
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
    • G01N33/574—Immunoassay; Biospecific binding assay; Materials therefor for cancer
    • G01N33/57407—Specifically defined cancers
    • G01N33/57446—Specifically defined cancers of stomach or intestine
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
    • G01N33/574—Immunoassay; Biospecific binding assay; Materials therefor for cancer
    • G01N33/57484—Immunoassay; Biospecific binding assay; Materials therefor for cancer involving compounds serving as markers for tumor, cancer, neoplasia, e.g. cellular determinants, receptors, heat shock/stress proteins, A-protein, oligosaccharides, metabolites
    • G01N33/57488—Immunoassay; Biospecific binding assay; Materials therefor for cancer involving compounds serving as markers for tumor, cancer, neoplasia, e.g. cellular determinants, receptors, heat shock/stress proteins, A-protein, oligosaccharides, metabolites involving compounds identifable in body fluids
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/10—Type of nucleic acid
    • C12N2310/20—Type of nucleic acid involving clustered regularly interspaced short palindromic repeats [CRISPRs]
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2510/00—Genetically modified cells
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2740/00—Reverse transcribing RNA viruses
    • C12N2740/00011—Details
    • C12N2740/10011—Retroviridae
    • C12N2740/15011—Lentivirus, not HIV, e.g. FIV, SIV
    • C12N2740/15041—Use of virus, viral particle or viral elements as a vector
    • C12N2740/15043—Use of virus, viral particle or viral elements as a vector viral genome or elements thereof as genetic vector
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2800/00—Nucleic acids vectors
    • C12N2800/10—Plasmid DNA
    • C12N2800/106—Plasmid DNA for vertebrates
    • C12N2800/107—Plasmid DNA for vertebrates for mammalian
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/158—Expression markers
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N2333/00—Assays involving biological materials from specific organisms or of a specific nature
    • G01N2333/90—Enzymes; Proenzymes
    • G01N2333/91—Transferases (2.)
    • G01N2333/91091—Glycosyltransferases (2.4)
    • G01N2333/91097—Hexosyltransferases (general) (2.4.1)
    • G01N2333/91102—Hexosyltransferases (general) (2.4.1) with definite EC number (2.4.1.-)

Abstract

The invention belongs to the technical field of medical biology, and discloses a UGT3A2 gene as an upper gastrointestinal tumor marker and a protein coded by the same, wherein the expression of the UGT3A2 gene in tissues of esophageal cancer, cardiac cancer and gastric cancer is detected by RT-PCR and immunohistochemical techniques respectively, and compared with matched paracancer normal tissues, the expression of the UGT3A2 gene in the cancer tissues is obviously higher than that of the matched paracancer normal tissues. The protein level of UGT3A2 in serum is detected by ELISA technology, and compared with normal population, the content of UGT3A2 protein in upper digestive tract tumor (esophageal cancer, cardiac cancer and gastric cancer) patients is obviously higher than that of normal population. Therefore, by detecting the expression level of UGT3A2 gene expression products in the tissue sample, the auxiliary diagnosis of upper gastrointestinal tumors (esophageal cancer, cardiac cancer and gastric cancer) can be carried out, and reference basis is provided for the diagnosis of digestive tract tumors by clinicians.

Description

UGT3A2 gene and application of protein coded by same in auxiliary diagnosis of upper gastrointestinal tumor
Technical Field
The invention belongs to the technical field of medical biology, and particularly relates to an UGT3A2 gene and application of a protein coded by the gene in auxiliary diagnosis of upper gastrointestinal tumors.
Background
The upper gastrointestinal tumor is not only the world, but also the high-incidence tumor in China, esophageal cancer, cardiac cancer and gastric cancer are the most common malignant tumors of the upper gastrointestinal tract, the morbidity of the esophageal cancer and the gastric cancer is respectively positioned at the seventh position and the fifth position, and the mortality related to the tumor is respectively positioned at the sixth position and the third position. In China, the morbidity and mortality of esophageal cancer and gastric cancer are both in the front of malignant tumors. Since the 80's of the 20 th century, the incidence of cardiac adenocarcinoma has shown a significant upward trend worldwide. China is one of the countries with high incidence rate and high death rate of cardia adenocarcinoma. Early studies of cardiac cancer have been classified as esophageal cancer or gastric cancer, and recently, adenocarcinoma occurring within 5cm above and below the esophagogastric junction has been classified as esophagogastric junction or junction adenocarcinoma in western countries and further classified into 3 categories according to anatomical sites, i.e., the first category is: adenocarcinoma at the far end of the esophagus is 1-5 cm above the junction of the esophagus and the stomach; the second type is: cardia adenocarcinoma, from 1cm above the esophagogastric junction to 2cm below the junction; the third type is: gastric adenocarcinoma below the cardia, 2-5 cm below the esophagogastric junction. Chinese people mainly take type II (> 97%), rarely type I (< 2%), and less type III. The analysis of the occurrence parts of cardia adenocarcinoma in the high-incidence region of Henan province by Wang Li Dong and other researches show that more than 95 percent of cardia cancer occurs within about 2cm above and below the boundary line. Therefore, the cardia cancers referred to in this patent are all the second category — cardia adenocarcinoma (GCA). Chenwanqing and the like find that esophageal cancer is high and accompanied by high incidence of cardia cancer through epidemic investigation on digestive tract tumors in high incidence areas of esophageal cancer. In conclusion, esophageal cancer, cardiac cancer and gastric cancer are common upper gastrointestinal malignant tumors in China, and particularly in high-incidence esophageal cancer areas in China.
The upper gastrointestinal tumor has hidden onset, unobvious early symptoms, low early detection rate, late disease stage when confirmed, wide invasion range and high malignancy, and has seriously influenced the possibility of the patient to receive radical treatment and the treatment effect. The prognosis of upper gastrointestinal tumor is closely related to the course of disease when the diagnosis is confirmed, and early discovery, early diagnosis and early treatment are crucial to improving the survival of upper gastrointestinal tumor patients. Therefore, the regular examination of the high risk group is beneficial to reducing the death rate of the patient and improving the long-term survival rate. Therefore, it is urgently needed to find a high-sensitivity and high-specificity upper digestive tract related molecular marker and use the marker as a basis for clinical diagnosis, prognosis judgment and individualized treatment. The molecular indexes related to the upper gastrointestinal tract discovered at present are few and are accepted and applied clinically, and the auxiliary diagnosis of the molecular indexes on the upper gastrointestinal tumor patients is still in a preliminary exploration stage. Therefore, there is a need in the art for molecular markers that can be used for the auxiliary diagnosis of upper gastrointestinal tumors.
Therefore, the tumor marker related to the new upper gastrointestinal tumor is found, and the early diagnosis and the early treatment can be realized, so that the method is very important for improving the survival rate and the survival quality of the patient. The research team of the inventor finds that UGT3A2 gene is related to the occurrence and development of upper gastrointestinal tumors. At present, experimental reports about UGT3A2 gene in tumor-related fields are still blank, especially in the research field of upper gastrointestinal tumors.
Disclosure of Invention
In view of the problems and disadvantages of the prior art, it is an object of the present invention to provide a marker for auxiliary diagnosis of upper gastrointestinal tumors; the invention also aims to provide application of a detection reagent of UGT3A2 gene or protein coded by the gene in preparing auxiliary diagnosis products for upper gastrointestinal tumors; the invention also aims to provide application of the expression inhibitor of UGT3A2 gene in preparing a medicament for treating digestive tumors.
The invention firstly provides a molecular marker for auxiliary diagnosis of digestive tract tumor, and the molecular marker is UGT3A2 gene and/or UGT3A2 gene expression product. The expression product of the UGT3A2 gene comprises UGT3A2 mRNA and UGT3A2 protein. The UGT3A2 gene (UDP glycotransferase family 3 member A2) is a polynucleotide sequence for coding UGT3A2 protein, and the accession number of the GenBank is NM-174914.4. The UGT3A2 protein (UDP-glucoronosyltransferase 3A2) has a GenBank accession number NP-777574.2.
The expression conditions of UGT3A2 gene in upper gastrointestinal tumor (esophageal squamous carcinoma, cardia adenocarcinoma and gastric adenocarcinoma) cancer tissues and matched paracancer normal tissues are detected by real-time fluorescence quantitative PCR (RT-PCR), and the expression of UGT3A2 mRNA in the esophageal squamous carcinoma cancer tissues is found to be higher than that of the matched paracancer normal tissues, the expression of UGT3A2 mRNA in the cardia adenocarcinoma cancer tissues is higher than that of the matched paracancer normal tissues, and the expression of UGT3A2 mRNA in the gastric adenocarcinoma cancer tissues is higher than that of the matched paracancer normal tissues, so that the UGT3A2 gene is up-regulated in the upper gastrointestinal tumor (esophageal squamous carcinoma, cardia adenocarcinoma and gastric adenocarcinoma) tissues to different degrees.
The expression conditions of UGT3A2 protein in upper gastrointestinal tumor (esophageal squamous carcinoma, cardia adenocarcinoma and gastric adenocarcinoma) cancer tissues and matched paracancer normal tissues are detected by an immunohistochemical method, and the positive expression rate of UGT3A2 protein in the esophageal squamous carcinoma cancer tissues is found to be remarkably higher than that of the matched paracancer normal tissues, the positive expression rate of UGT3A2 protein in the cardia adenocarcinoma cancer tissues is found to be remarkably higher than that of the matched paracancer normal tissues, and the positive expression rate of UGT3A2 protein in the gastric adenocarcinoma cancer tissues is remarkably higher than that of the matched paracancer normal tissues.
The expression conditions of UGT3A2 protein in the serum of esophageal cancer patients, cardia adenocarcinoma patients, gastric adenocarcinoma patients and normal persons are detected by enzyme-linked immunosorbent assay (ELISA), and the content of UGT3A2 in the serum of esophageal squamous cancer patients, cardia adenocarcinoma patients and gastric adenocarcinoma patients is obviously higher than that of normal persons, so that the content of UGT3A2 in the serum of esophageal squamous cancer patients, cardia adenocarcinoma patients and gastric adenocarcinoma patients is obviously different.
The invention also provides application of a UGT3A2 gene or a detection reagent of the encoded protein thereof in preparation of auxiliary diagnosis products for upper gastrointestinal tumors.
According to the above-mentioned use, preferably, the detection reagent is used for detecting the expression level of UGT3A2 gene in the sample; more preferably, the detection reagent is used for detecting the expression level of UGT3A2 mRNA and UGT3A2 protein in the sample.
According to the application, the product detects the expression level of UGT3A2 gene in a sample through RT-PCR, real-time quantitative PCR, in-situ hybridization, northern blotting, a high-throughput sequencing platform, immunohistochemistry or enzyme-linked immunosorbent assay.
According to the above-mentioned application, preferably, the product contains a specific primer for amplifying UGT3A2 gene, a probe hybridized with nucleotide sequence of UGT3A2 gene or an antibody specifically bound with UGT3A2 protein.
According to the above-mentioned application, preferably, the specific primer sequence for amplifying UGT3A2 gene is specifically as follows:
the nucleotide sequence of the forward primer amplified by UGT3A2 is as follows: 5'-GCAGGAGGCAACAGCACAT-3' (SEQ ID NO. 1);
the nucleotide sequence of the reverse primer amplified by UGT3A2 is as follows: 5'-ATGGAGCCCAAGGTCACAA-3' (SEQ ID NO. 2).
Preferably, the antibody is a polyclonal antibody or a monoclonal antibody according to the above-mentioned use.
According to the above-mentioned application, preferably, the upper gastrointestinal tumor includes esophageal cancer, cardiac cancer, and gastric cancer. More preferably, the esophageal cancer is esophageal squamous carcinoma, the cardiac cancer is cardiac adenocarcinoma, and the gastric cancer is gastric adenocarcinoma.
Preferably, the sample is tissue, serum or cells, according to the above-mentioned application.
According to the above-mentioned use, preferably, the product is a chip, a preparation or a kit.
The invention also provides application of the expression inhibitor of UGT3A2 gene in preparing a medicament for treating digestive tumor.
According to the application, preferably, the expression inhibitor of UGT3A2 gene comprises sgRNA specifically targeting UGT3A2 gene, and the nucleotide sequence of the sgRNA is shown in any one of SEQ ID NO. 3-SEQ ID NO. 5.
Wherein, sgRNA 1: AATCATATCAAGTTATCAGT (SEQ ID NO. 3);
sgRNA2：CAGAGGTCGAGCAAAATCAA(SEQ ID NO.4)；
sgRNA3：GCAGCGAGTGCTTCTTCTAG(SEQ ID NO.5)。
the invention also provides a method for constructing a cell line stably knocking out UGT3A2 gene, which comprises the following steps:
(1) adding CACCG (calcium carbonate concentrate) to the 5 'end of a sgRNA with a nucleotide sequence shown in any one of SEQ ID No. 3-SEQ ID No.5 to obtain a forward oligonucleotide, synthesizing a DNA complementary strand of the sgRNA according to the nucleotide sequence of the sgRNA, adding AAAC (anaerobic-anoxic-oxic) to the 5' end of the DNA complementary strand to obtain a reverse oligonucleotide, and denaturing, annealing and forming a double strand by the forward oligonucleotide and the reverse oligonucleotide;
(2) connecting the double strands prepared in the step (1) with a Cas9 vector to obtain a Cas9 single-vector plasmid;
(3) carrying out lentivirus packaging and detection on the Cas9 single-vector plasmid obtained in the step (2) to obtain a lentivirus recombinant expression vector;
(4) infecting a tumor cell line (an esophageal squamous carcinoma cell line or a gastric adenocarcinoma cell line) in vitro by the lentivirus recombinant expression vector prepared in the step (3), screening stable cells, and obtaining a cell strain with the UGT3A2 gene stably knocked out.
The invention also provides an esophageal squamous carcinoma cell line with the UGT3A2 gene stably knocked out and a gastric adenocarcinoma cell line with the UGT3A2 gene stably knocked out, which are constructed by the method.
Compared with the prior art, the invention has the following positive beneficial effects:
(1) the invention provides a novel upper gastrointestinal tumor marker-UGT 3A2 gene and/or UGT3A2 gene expression product, the positive expression rate of UGT3A2 in cancer tissue is obviously higher than that of matched paracancer normal tissue, and the auxiliary diagnosis of upper gastrointestinal tumor (esophageal squamous cell carcinoma, cardia adenocarcinoma and gastric adenocarcinoma) can be carried out by detecting the expression level of UGT3A2 gene expression product in sample (tissue, serum or cell), thereby providing reference basis for the diagnosis of upper gastrointestinal tumor for clinician.
(2) The invention firstly proposes that UGT3A2 gene is related to proliferation, invasion and metastasis of tumor cells, UGT3A2 can promote proliferation, invasion and metastasis of tumor cells and inhibit apoptosis of tumor cells, and can be used as a new upper gastrointestinal tumor treatment target. The sgRNA guide sequence of the specific targeting UGT3A2 gene provided by the invention can efficiently inhibit or knock out UGT3A2 expression in a target cell by using a CRISP-Cas9 technology, induces apoptosis of a tumor cell, reduces invasion and transfer capacity of the tumor cell and the like, further inhibits growth of the tumor cell, and has important significance in treatment of tumors.
Drawings
FIG. 1 is a graph showing the expression results of UGT3A2 mRNA in esophageal squamous carcinoma tissues and paired paracarcinoma normal tissues.
FIG. 2 is an immunohistochemical staining micrograph of UGT3A2 protein in paracarcinoma normal esophageal squamous epithelial tissue paired with esophageal squamous carcinoma.
FIG. 3 is an immunohistochemical staining micrograph of UGT3A2 protein in esophageal squamous carcinoma tissues.
FIG. 4 is a graph showing the results of ELISA detection of the UGT3A2 protein content in the serum of esophageal squamous carcinoma, cardia adenocarcinoma, gastric adenocarcinoma, and normal control population, wherein ESCC indicates esophageal squamous carcinoma, GCA indicates cardia adenocarcinoma, and GAC indicates gastric adenocarcinoma.
FIG. 5 is a ROC graph of UGT3A2 in the test esophageal squamous carcinoma group and the normal control group.
FIG. 6 is a graph of the results of UGT3A2 mRNA expression in cardiac adenocarcinoma tissue and paired paracancerous normal tissue.
FIG. 7 is an immunohistochemical staining micrograph of UGT3A2 protein in pericancerous normal glandular epithelial tissue paired with cardiac adenocarcinoma.
FIG. 8 is a microscopic image of immunohistochemical staining of UGT3A2 protein in cardiac adenocarcinoma cancer tissue.
FIG. 9 is a ROC plot of UGT3A2 in the cardiac adenocarcinoma-detected group and the normal control group.
FIG. 10 is a graph showing the results of UGT3A2 mRNA expression in gastric adenocarcinoma tissue and paired paracancerous normal tissue.
FIG. 11 is an immunohistochemical staining micrograph of UGT3A2 protein in paracancerous normal gastric glandular epithelial tissue paired with gastric adenocarcinoma.
FIG. 12 is an immunohistochemical staining micrograph of UGT3A2 protein in gastric adenocarcinoma tissue.
FIG. 13 is a ROC plot of UGT3A2 in the gastric adenocarcinoma test group and the normal control group.
FIG. 14 is a vector map of GV393 synthesized for transfection.
FIG. 15 is a graph showing the expression results of UGT3A2 mRNA in esophageal squamous carcinoma cell lines EC9706, Eca-109, TE-1 and esophageal normal mucosal epithelium SHEE.
FIG. 16 is a graph showing the results of UGT3A2 mRNA expression in gastric adenocarcinoma cell lines AGS, MGC80-3, SGC-7901 and gastric normal mucosal epithelial cells GES-1.
FIG. 17 is a diagram showing the results of cell proliferation assay of an esophageal squamous carcinoma cell line (TE1-sg) and a gastric adenocarcinoma cell line (MGC80-3-sg) in which UGT3A2 gene was stably knocked out; wherein A is an esophageal squamous carcinoma cell line TE1-sg with UGT3A2 gene stably knocked out; b is gastric adenocarcinoma cell line MGC80-3-sg with UGT3A2 gene stably knocked out.
FIG. 18 is a graph showing the results of apoptosis detection of an esophageal squamous carcinoma cell line (TE1-sg) and a gastric adenocarcinoma cell line (MGC80-3-sg) in which UGT3A2 gene was stably knocked out.
FIG. 19 is a graph showing the results of colony formation detection of an esophageal squamous carcinoma cell line (TE1-sg) and a gastric adenocarcinoma cell line (MGC80-3-sg) in which the UGT3A2 gene was stably knocked out.
FIG. 20 is a diagram showing the results of Celigo scratch assay of esophageal squamous carcinoma cell line (TE1-sg) and gastric adenocarcinoma cell line (MGC80-3-sg) stably knock-out UGT3A2 gene.
FIG. 21 is a graph showing the results of Transwell cell migration assay of an esophageal squamous cell carcinoma cell line (TE1-sg) and a gastric adenocarcinoma cell line (MGC80-3-sg) in which the UGT3A2 gene was stably knocked out.
FIG. 22 is a graph showing the results of Transwell cell invasion assay of esophageal squamous cell carcinoma cell line (TE1-sg) and gastric adenocarcinoma cell line (MGC80-3-sg) stably knocked out the UGT3A2 gene.
Detailed Description
The present invention will be described in further detail with reference to the following examples, which are not intended to limit the scope of the present invention.
The experimental methods in the following examples, which do not indicate specific conditions, all employ conventional techniques in the art, or follow the conditions suggested by the manufacturers; the reagents or instruments used are not indicated by the manufacturer, and are all conventional products commercially available.
Among these, the cell lines used in the examples: the three esophageal squamous cancer cell lines comprise TE1, EC9706, Eca-109, an esophageal normal mucosal epithelial cell SHEE; three gastric adenocarcinoma cell lines AGS, MGC80-3 and SGC-7907, a gastric mucosal epithelial immortalized cell GES-1. All cell lines were purchased from Kjekay GeneChemicals, Inc. of Shanghai.
SPSS 25.0 software for data statistics and analysis; p <0.05 represents statistically significant results.
UGT3A2 gene and its expression product for value analysis of esophageal squamous carcinoma diagnosis
Example 1: expression condition research of UGT3A2 mRNA in esophageal squamous carcinoma tissue and paracarcinoma normal tissue matched with esophageal squamous carcinoma tissue
1. Collecting samples:
cancer tissues of 30 cases of esophageal squamous carcinoma patients and matched paracancer normal tissue samples of the esophageal squamous carcinoma patients are collected, all samples come from fresh samples after esophageal squamous carcinoma operations, patients before the operations do not carry out radiotherapy and chemotherapy, the operations are the first treatment scheme, the samples are quickly frozen in liquid nitrogen after being taken, and then the samples are frozen and stored in a refrigerator at the ultralow temperature of minus 80 ℃. The esophageal squamous carcinoma tissue and the matched paracarcinoma normal tissue sample used in the invention are from the national key laboratory of prevention and treatment of esophageal carcinoma of province co-construction of Zhengzhou university. Each patient signed an informed consent prior to sampling, according to the rules prescribed by the ethical review board.
The RT-PCR is used for detecting the expression level of UGT3A2 mRNA in 30 cases of esophageal squamous carcinoma tissues and matched paracarcinoma normal tissues, and the specific operation steps are as follows:
2. experimental methods
(1) Extraction of RNA from tissues:
collected esophageal squamous carcinoma tissue and paired paracancerous normal tissue samples were removed from liquid nitrogen, the tissue samples were cut to approximately 3mm by 3mm size on dry ice with a sterile razor blade, and placed in 1.5mL EP tubes containing 1mL Trizol lysate. And immersing the working head of the superfine homogenizer into Trizol lysate for 5-10s to inactivate RNA enzyme, and then carrying out tissue grinding. After completion of the trituration, centrifuge at 4 ℃, 5000rpm, 3min, discard the pellet, pipette the supernatant into a new 1.5mL EP tube. Add 200. mu.L of chloroform to each tube, manually invert the EP tube for 15s, and allow to stand at room temperature for 10 min. Centrifuge at 12800rpm for 15min at 4 ℃. Absorbing the upper layer liquid, transferring to a new 1.5mLEP tube, adding equal volume of precooled isopropanol, mixing uniformly, and standing for 10min at 4 ℃. After centrifugation at 12800rpm for 12min at 4 ℃, the supernatant was discarded. 1mL of 75% ethanol (freshly made up with DEPC water) was added and the precipitate washed. Centrifuge at 11800rpm for 5min at 4 ℃ and discard most of the supernatant. Centrifuge again at 11800rpm for 5min at 4 deg.C, discard the supernatant, and dry at room temperature. When the RNA precipitate is basically transparent, RNase-free water (the addition volume depends on the RNA precipitate amount) is added until the RNA precipitate is completely dissolved, and the concentration and the quality of the extracted RNA are analyzed and determined by a Nanodrop2000/2000C spectrophotometer.
(2) Synthesis of cDNA:
using M-MLV Reverse Transcriptase kit, purchased from Promega (cat # M1701-10000U), reverse transcribing the above extracted RNA into cDNA, comprising the following steps: mu.L of Oligo dT (0.5ug/uL) and 2.0ug of Total RNA were added to the PCR vials and supplemented with RNase-Free H2And O to 10uL, evenly mixing, centrifuging, carrying out water bath at 70 ℃ for 10min, immediately placing in an ice-water mixture for ice bath, and annealing Oligo dT and the template. The mixture was reacted (on ice) in the reaction system shown in Table 1, mixed well and centrifuged briefly.
TABLE 1 reverse transcription reaction System
Reagent Adding amount of each tube
5×RT buffer 4uL
10mM dNTPs 2uL
Rnasin(40U/uL) 0.4uL
M-MLV-RTase(200U/uL) 1uL
RNase-Free H2O 2.6uL
Note: the dNTPs are a mixture of dATP, dCTP, dGTP and dTTP, and have a concentration of 10 mM.
The reaction system is reacted in water bath at 42 ℃ for 1h, then the RTase is inactivated in water bath at 70 ℃ for 10min, and the obtained RT product-cDNA is stored at-20 ℃ for later use.
(3) And (3) RT-PCR detection:
and detecting the relative expression quantity of UGT3A2 mRNA in the esophageal squamous carcinoma cancer tissue and the matched paracarcinoma normal tissue by RT-PCR reaction by taking GAPDH as an internal reference, and determining the expression difference between the two tissues.
Amplification primers for UGT3A2 mRNA were:
UGT3A2 mRNA-F：5'-GCAGGAGGCAACAGCACAT-3'(SEQ ID NO.1)；
UGT3A2 mRNA-R：5'-ATGGAGCCCAAGGTCACAA-3'(SEQ ID NO.2)。
amplification primers for GAPDH mRNA were:
GAPDH mRNA-F：5'-TGACTTCAACAGCGACACCCA-3'；
GAPDH mRNA-R：5'-CACCCTGTTGCTGTAGCCAAA-3'。
the reaction system (12uL system) was prepared in the proportions shown in Table 2.
TABLE 2 Real-time PCR reaction System (12uL System)
Reagent Adding amount of each tube
SYBR premix ex taq 6.0uL
Primer mix (5. mu.M) 0.3uL
Stencil (reverse transcription product) 0.6uL
RNase-Free H2O 5.1uL
Real-Time PCR was performed by the two-step method and melting curves were generated and programmed as in Table 3.
TABLE 3 two-step Real-Time PCR reaction System Programming
Figure BDA0002529368810000071
After the reaction, data analysis was performed, 2-ΔΔCtThe relative expression level of UGT3a2 mRNA was calculated.
3. Conclusion of the experiment
Real-Time PCR detected the expression level of UGT3A2 mRNA in 30 cases of esophageal squamous carcinoma tissues and matched paracarcinoma normal tissues, and the detection result is shown in FIG. 1. As can be seen from FIG. 1, the expression level of UGT3A2 mRNA in the esophageal squamous carcinoma cancer tissue is significantly higher than that in the paired paracancer paired normal tissue (P <0.001), which indicates that the expression level of UGT3A2 mRNA is related to the occurrence of esophageal squamous carcinoma, and can be used as a tumor marker of esophageal squamous carcinoma for clinical auxiliary diagnosis of esophageal squamous carcinoma.
Example 2: expression condition research of UGT3A2 protein in esophageal squamous carcinoma tissue and paracarcinoma normal tissue matched with esophageal squamous carcinoma tissue
1. Collecting samples:
cancer tissues of 150 cases of esophageal squamous carcinoma patients and matched paracancer normal tissue samples of the esophageal squamous carcinoma patients are collected, all samples are paraffin tissue samples after esophageal squamous carcinoma operations, patients before the operations do not carry out radiotherapy and chemotherapy, and the operations are the preferred treatment scheme. The esophageal squamous carcinoma and the matched paracancer normal tissue sample used in the invention are from the national key laboratory of prevention and treatment of esophageal carcinoma of province co-construction of Zhengzhou university. Each patient signed an informed consent prior to sampling, according to the rules prescribed by the ethical review board.
The expression level of UGT3A2 protein in 150 cases of esophageal squamous carcinoma tissues and matched paracancer normal epithelial tissues is detected by an immunohistochemical method, and the expression level is scored and analyzed.
2. Experimental methods
(1) Immunohistochemistry:
paraffin slice is dewaxed conventionally to water, EDTA (PH9.0) high pressure repair (after heating and boiling by an electromagnetic oven, the sample is put in a pressure cooker to be heated continuously, the air is sprayed by an air spraying valve for 2 minutes, the heating is stopped, the sample is naturally cooled to room temperature), and the slice is put in a PBS buffer solution (PH7.4) decoloring shaking table to shake and wash for 3 times, 5min each time. 3% H2O2Incubating at room temperature in dark for 25min, and washing the slices in PBS buffer (pH7.4) for 5min each time by shaking in a shaking table for 3 times. After the sections were slightly spun off, UGT3A2 antibody (1:100, from Novus Biologicals, cat. NBP2-32468) was added and placed in a wet box overnight at 4 ℃. The next day the wet box was taken out and returned to room temperature, and the slices were washed 3 times in PBS buffer (pH7.4) with shaking in a shaking table for 5min each time. After the section is slightly dried, a secondary antibody (HRP mark) of the corresponding species of the primary antibody is added into the ring, the incubation is carried out for 50min at room temperature, and the section is placed into a PBS buffer solution (PH7.4) for decoloration and shaking and washing by a shaking table for 3 times, 5min each time. Drying the slices slightly, adding Diaminobenzidine (DAB) solution under a microscope for color development, washing the slices with tap water to stop color development, counterstaining with hematoxylin for 3min, returning the hematoxylin to blue with the blue solution, and washing with running water. Conventional dehydration, xylene clarity, neutral gum mounting, and microscopic observation.
(2) Immunohistochemical scoring criteria:
the staining intensity of positive cells and the percentage of positive cells are considered together.
Color development strength: the cell-free cytoplasm color development is 0 point, the weaker cell cytoplasm color development (light yellow) is 1 point, the medium cell cytoplasm color development (brown) is 2 points, and the stronger cell cytoplasm color development (brown) is 3 points.
Percentage of positive cells: the cell-free cytoplasm is 0 point, the cell cytoplasm of the tumor cells with the cell cytoplasm number less than or equal to 1/3 is 1 point, the cell cytoplasm number of the tumor cells with the cell cytoplasm number of 1/3-2/3 is 2 points, and the cell cytoplasm number of the tumor cells with the cell cytoplasm number of more than 2/3 is 3 points. The final scoring result is recorded by the color development intensity score multiplied by the positive cell percentage score; the score 0 is negative, the score 1-3 is weak positive, the score 4-7 is medium positive, and the score 7-9 is strong positive. Finally, the evaluation criteria are that 0 is negative expression and more than or equal to 1 is positive expression.
3. Conclusion of the experiment
FIG. 2 is a representative immunohistochemical staining micrograph of UGT3A2 protein in normal squamous epithelium of esophagus, 2A and 2B show negative expression of UGT3A2 protein in normal squamous epithelium of esophagus, and 2C and 2D show weak positive expression in normal squamous epithelium of esophagus.
FIG. 3 is a microscopic image of immunohistochemical staining of representative UGT3A2 protein in esophageal squamous carcinoma tissue, wherein 3A and 3B are negatively expressed, and 3C and 3D are positively expressed.
According to statistics, in 150 esophageal squamous carcinoma tissue samples, 56.0% (84/150) of the samples are positively stained; in 150 cases of paracarcinoma normal tissue samples, only 13.3% (20/150) of the samples were positively stained; further statistical analysis by chi-square test shows that the UGT3A2 protein has significant difference in expression level of esophageal squamous carcinoma tissues and paracarcinoma normal epithelial tissues (P < 0.05).
The experimental result further indicates that the UGT3A2 gene expression level (UGT3A2 protein) has a significant difference between the esophageal squamous carcinoma tissue and the normal epithelial tissue, the UGT3A2 protein has a significant correlation with the occurrence of the esophageal squamous carcinoma, and the UGT3A2 protein can be used as a marker of the esophageal squamous carcinoma for diagnosis and treatment of the esophageal squamous carcinoma.
Example 3: UGT3A2 protein content detection in serum and evaluation for esophageal squamous carcinoma diagnosis value
1. Collecting samples:
serum samples from 60 patients with esophageal squamous carcinoma (esophageal squamous carcinoma group) and 40 normal persons (normal control group) of national key laboratory of provincial co-construction of Zhengzhou university were collected and stored at-80 ℃. Among them, the serum of the esophageal squamous carcinoma patient is collected when the patient is initially diagnosed as esophageal squamous carcinoma and does not receive any chemoradiotherapy, and the serum of the normal person is the serum of a healthy person who is examined by gastroscopy and is confirmed to have no digestive tumor by biopsy.
2. Experimental methods
And detecting the content of UGT3A2 protein in serum samples of the esophageal squamous carcinoma group and the normal control group by adopting an enzyme-linked immunosorbent assay, and analyzing. And (3) detecting UTG3A2 protein in serum by adopting a double-antibody sandwich ELISA-indirect method. The specific operation is as follows:
(1) preparing a UGT3A2 capture antibody solution: UGT3A2 monoclonal antibody (purchased from Creative diagnostic company, product number DCABH-17340) is added into coating buffer solution, so that the concentration of UGT3A2 monoclonal antibody is 1-8 ug/ml, and UGT3A2 capture antibody solution is obtained.
(2) UGT3a2 capture antibody solution coated elisa plate: adding the prepared UGT3A2 capture antibody solution into a sample application hole of a 96-hole enzyme label plate, wherein the sample application amount is 100 ul/hole, meanwhile, a standard substance hole, a positive control hole, a negative control hole and a blank control hole are also arranged on the 96-hole enzyme label plate, 100ul UGT3A2 capture antibody solution is added into the standard substance hole, the positive control hole and the negative control hole, and 100ul coating buffer solution is added into the blank control hole; the microplate was sealed with sealing tape to prevent evaporation, and left overnight at 4 ℃ for incubation. Taking off the sealing adhesive tape the next day, sucking out the liquid in each hole, then adding 400ul of washing buffer solution into each hole for washing, repeating the washing for 3 times, washing for 3min each time, and after washing, reversely buckling the ELISA plate on a paper towel for drying.
(3) And (3) sealing: adding a blocking solution (PBST buffer solution containing 2% BSA) into the sample application holes of the coated 96-hole enzyme label plate, wherein the sample addition amount is 300 ul/hole, and removing the blocking solution after incubating for 2h at room temperature; and then adding 400ul of washing buffer solution into each hole for washing, repeatedly washing for 3 times, washing for 3min each time, and drying the washed 96-hole enzyme label plate at 37 ℃ to obtain the 96-hole enzyme label plate coated with the UGT3A2 capture antibody.
(4) Diluting a serum sample by using a sample diluent (PBST buffer solution containing 1% BSA) according to the proportion of 1:100, and then sequentially adding the diluted serum sample into a sample application hole of a 96-hole enzyme label plate coated with a UGT3A2 capture antibody, wherein the sample application amount is 100 ul/hole; 100ul of standard substances with different dilution times are respectively added into each standard substance hole, UGT3A2 positive control serum (UGT3A2 positive control serum is esophageal squamous carcinoma patient serum with positive UGT3A2 protein detected by ELISA and Western blot methods), UGT3A2 negative control serum (UGT3A2 negative control serum is normal human serum with normal population average content detected by ELISA and Western blot methods), and sample diluent without serum is added into the blank control hole; incubate at room temperature for 2 hours, then discard the liquid in the wells and wash 5 times with wash buffer.
(5) And (3) adding a UGT3A2 polyclonal antibody (purchased from NOVUS Biological, with the code number of H00167127-B01P) solution with the concentration of 50-400 ng/mL into each spot sample well of the 96-well enzyme label plate treated in the step (4), wherein the sample adding amount is 100 ul/well, incubating in an incubator at 37 ℃ for 60 minutes, discarding liquid in the spot sample well after the incubation is finished, and washing for 5 times by using a washing buffer solution.
(6) And (3) adding Horse Radish Peroxidase (HRP) labeled goat anti-rabbit polyclonal antibody into each sample application hole of the 96-hole enzyme label plate processed in the step (5), wherein the sample application amount is 100 ul/hole, incubating for 60 minutes in an incubator at 37 ℃, discarding liquid in the sample application hole after the incubation is finished, and washing for 5 times by using a washing buffer solution.
(7) And (4) adding 100 mu l of TMB substrate solution into each sample application hole of the 96-hole enzyme label plate processed in the step (6) for color development, and placing the mixture in a water bath at 37 ℃ in a dark place for color development for 20-30 minutes. When a color change occurs, 50. mu.l of a stop solution (10% sulfuric acid) is added to each well to stop the color reaction, and the OD value of each well is measured at 450nm with an automatic microplate reader and zeroed with a blank control.
(8) A standard curve was plotted based on the concentration of the standard and the OD value and the concentration of UTG3A2 protein in each serum sample was calculated.
And further carrying out ROC analysis according to an experimental result of UGT3A2 protein content in the serum detected by an ELISA method to obtain a ROC curve, and evaluating the value of UGT3A2 protein for diagnosing esophageal squamous cell carcinoma according to the ROC curve. The ROC curve can be drawn using software and systems in the prior art, such as SPSS, SAS, R language, etc.
3. Conclusion of the experiment
The detection of tumor markers in serum is currently the most common method for clinical early diagnosis of tumors, and the research detects the content of UGT3A2 protein in serum samples of esophageal squamous carcinoma groups and normal control groups by using an ELISA technology, and the result is shown in figure 4: UGT3A2 is expressed in the esophageal squamous carcinoma group in a much higher amount than that in the normal control group, and has a significant difference (P < 0.001). Therefore, the expression level of UGT3A2 protein in serum can distinguish esophageal squamous cell carcinoma from normal control population, and has important value for early diagnosis of esophageal squamous cell carcinoma.
FIG. 5 is a diagram showing the results of ROC curve analysis of the content of UGT3A2 protein in the serum of the esophageal squamous carcinoma group and the normal control group. As can be seen from FIG. 5, the area under the ROC curve (AUC) was 0.93, and the sensitivity and specificity of the UGT3A2 protein for diagnosis of esophageal squamous cell carcinoma were 93.4% and 92.5%, respectively. Therefore, the UGT3A2 protein has high specificity and high sensitivity as a diagnostic marker of esophageal squamous carcinoma.
UGT3A2 gene and its expression product for analyzing value of cardia adenocarcinoma (GCA) diagnosis
Example 4: expression of UGT3A2 mRNA in cardiac adenocarcinoma cancer tissue and its paired paracarcinoma normal tissue
1. Collecting samples:
the method comprises the steps of collecting cancer tissues of 30 cases of patients with cardia adenocarcinoma and matched paracancer normal tissue samples of the cancer tissues, wherein all samples are from fresh samples after the cardia adenocarcinoma surgery, and patients before the surgery do not undergo radiotherapy and chemotherapy, the surgery is a first treatment scheme, the samples are quickly frozen in liquid nitrogen after being taken, and then the samples are frozen and stored in a refrigerator at the ultralow temperature of-80 ℃. The cardia adenocarcinoma and the paracancer normal tissue sample matched with the cardia adenocarcinoma are from national key laboratories of provincial co-construction esophageal cancer prevention and treatment of Zhengzhou university. Each patient signed an informed consent prior to sampling, according to the rules prescribed by the ethical review board.
2. Experimental methods
The specific experimental method for detecting the expression level of UGT3A2 mRNA in 30 cases of cardiac adenocarcinoma tissues and paracarcinoma normal tissues by Real-Time PCR is the same as that in example 1, and is not repeated herein.
3. Conclusion of the experiment
The Real-Time PCR detected the expression level of UGT3A2 mRNA in 30 cases of cardiac adenocarcinoma tissue and paracarcinoma normal tissue, and the detection results are shown in FIG. 6. As can be seen from FIG. 6, the expression level of UGT3A2 mRNA in the cardiac adenocarcinoma tissue is significantly higher than that in the paracancer normal tissue (P <0.001), which indicates that the expression level of UGT3A2 mRNA is related to the occurrence of cardiac adenocarcinoma, and can be used as a tumor marker of cardiac adenocarcinoma for clinical auxiliary diagnosis of cardiac adenocarcinoma.
Example 5: expression condition research of UGT3A2 protein in cardia adenocarcinoma cancer tissue and paracarcinoma normal tissue matched with cardia adenocarcinoma cancer tissue
1. Collecting samples:
collecting 150 cases of cancer tissues of patients with cardia adenocarcinoma and matched paracancer normal tissue samples of the cancer tissues, wherein all samples are from fresh samples after the cardia adenocarcinoma operation, the patients before the operation do not carry out radiotherapy and chemotherapy, the operation is the first treatment scheme, and the samples are frozen and stored at minus 80 ℃. The cardia adenocarcinoma and the paracancer normal tissue sample matched with the cardia adenocarcinoma are from national key laboratories of provincial co-construction esophageal cancer prevention and treatment of Zhengzhou university. Each patient signed an informed consent prior to sampling, according to the rules prescribed by the ethical review board.
2. Experimental methods
The expression level of UGT3A2 protein in 150 cases of cardiac adenocarcinoma tissues and matched paracancer normal epithelial tissues is detected by an immunohistochemical method, and the expression level is scored and analyzed.
The detailed procedures of immunohistochemical method and scoring criteria are the same as in example 2 and will not be described herein.
3. Conclusion of the experiment
FIG. 7 is a representative UGT3A2 protein immunohistochemical staining micrograph in normal cardia glandular epithelium, 7A, 7B show UGT3A2 protein negative expression in normal cardia glandular epithelium, 7C, 7D show weak positive expression in normal cardia glandular epithelium.
FIG. 8 is a representative photograph of immunohistochemical staining of UGT3A2 protein in cardiac adenocarcinoma tissue, with negative expression of 8A and 8B and positive expression of 8C and 8D.
According to statistics, 58.6% (88/150) of 150 samples of the cardia adenocarcinoma cancer tissues are positively stained; in 150 cases of cardia cancer paranormal glandular epithelial tissue samples, only 14% (21/150) of the samples are positively stained; further statistical analysis using chi-square test revealed that there was a significant difference in the expression levels of UGT3a2 protein between the cardiac adenocarcinoma cancerous tissue and the paracancerous normal epithelial tissue (P < 0.05).
The experimental result further shows that the UGT3A2 gene expression level (UGT3A2 protein) has a significant difference between the cardiac adenocarcinoma cancer tissue and the normal epithelial tissue, the UGT3A2 protein has a significant correlation with the occurrence of cardiac adenocarcinoma, and the UGT3A2 protein can be used as a cardiac adenocarcinoma marker for diagnosis and treatment of cardiac adenocarcinoma.
Example 6: UGT3A2 protein content detection in serum and evaluation of cardia adenocarcinoma diagnosis value
1. Collecting samples:
serum samples from 60 patients with cardiac adenocarcinoma (cardiac adenocarcinoma group) and 40 normal persons (normal control group) of national key laboratory of provincial co-construction esophageal cancer prevention and treatment of Zhengzhou university were collected and stored at-80 ℃. Among them, the serum of patients with cardiac adenocarcinoma is collected when the patients were initially diagnosed as cardiac adenocarcinoma and did not receive any chemoradiotherapy, and the normal human serum is the serum of healthy persons who were examined by gastroscopy and confirmed to have no digestive tumor by biopsy.
2. Experimental methods
Enzyme-linked immunosorbent assay is adopted to detect the content of UGT3A2 protein in the cardia adenocarcinoma group and the normal control group, and the analysis is carried out. The specific operation of the ELISA was the same as in example 3 and will not be described further.
And further carrying out ROC analysis according to the experiment result of UGT3A2 protein content in the serum detected by an ELISA method to obtain a ROC curve.
3. Conclusion of the experiment
The content of UGT3A2 protein in the serum samples of the cardia adenocarcinoma group and the normal control group is detected by ELISA technology, and the result is shown in FIG. 4. As can be seen from FIG. 4, the expression level of UGT3A2 in the cardia adenocarcinoma group is much higher than that in the normal control group, and has significant difference (P < 0.001). Therefore, the expression level of UGT3A2 protein in serum can distinguish cardia adenocarcinoma from normal control population, and has important value for early diagnosis of cardia adenocarcinoma.
FIG. 9 is a ROC graph obtained by ROC analysis of the content of UGT3A2 protein in the serum of the cardiac adenocarcinoma group and the normal control group. As shown in the figure, the area under the ROC curve (AUC) is 0.9271, and the sensitivity of the UGT3A2 protein for diagnosing cardia adenocarcinoma is 95.1%, and the specificity is 92.5%. The UGT3A2 protein has high specificity and high sensitivity as a cardiac adenocarcinoma diagnostic marker.
Value analysis of (III) UGT3A2 gene and expression product thereof for Gastric Adenocarcinoma (GAC) diagnosis
Example 7: expression of UGT3A2 mRNA in gastric adenocarcinoma tissue and its paired paracarcinoma normal tissue
1. Collecting samples:
cancer tissues of 30 gastric adenocarcinoma patients and matched paracancer normal tissue samples thereof are collected, all samples are from fresh specimens after gastric adenocarcinoma surgery, patients before surgery do not undergo radiotherapy and chemotherapy, the surgery is the first treatment scheme, the samples are taken, quickly frozen in liquid nitrogen, and then transferred to-80 ℃ for cryopreservation. The gastric adenocarcinoma and the matched paracancer normal tissue sample used in the invention are from the national key laboratory of prevention and treatment of esophageal cancer of provincial co-construction of Zhengzhou university. Each patient signed an informed consent prior to sampling, according to the rules prescribed by the ethical review board.
2. Experimental methods
The specific experimental method for detecting the expression level of UGT3A2 mRNA in 30 cases of gastric adenocarcinoma tissues and paracarcinoma normal tissues by Real-Time PCR is the same as that in example 1, and is not repeated herein.
3. Conclusion of the experiment
Real-Time PCR detected the expression level of UGT3A2 mRNA in 30 cases of gastric adenocarcinoma tissues and paracarcinoma normal tissues, and the detection results are shown in FIG. 10. As can be seen from FIG. 10, the expression level of UGT3A2 mRNA in the gastric adenocarcinoma tissue is significantly higher than that in the paracancer normal tissue (P <0.001), which indicates that the expression level of UGT3A2 mRNA is related to the occurrence of gastric adenocarcinoma, and can be used as a tumor marker of gastric adenocarcinoma for clinical auxiliary diagnosis of gastric adenocarcinoma.
Example 8: expression condition research of UGT3A2 protein in gastric adenocarcinoma tissue and paracarcinoma normal tissue matched with gastric adenocarcinoma tissue
1. Collecting samples:
cancer tissues of 150 patients with gastric adenocarcinoma and matched paracancer normal tissue samples thereof are collected, all samples are from fresh specimens after gastric adenocarcinoma surgery, patients before surgery do not undergo radiotherapy and chemotherapy, the surgery is the first treatment scheme, and the samples are taken and then placed at minus 80 ℃ for cryopreservation. The gastric adenocarcinoma and the matched paracancer normal tissue sample used in the invention are from the national key laboratory of prevention and treatment of esophageal cancer of provincial co-construction of Zhengzhou university. Each patient signed an informed consent prior to sampling, according to the rules prescribed by the ethical review board.
2. Experimental methods
The expression level of UGT3A2 protein in 150 cases of gastric adenocarcinoma tissues and matched paracancer normal epithelial tissues is detected by an immunohistochemical method, and the expression level is scored and analyzed.
The detailed procedures of immunohistochemical method and scoring criteria are the same as in example 2 and will not be described herein.
3. Conclusion of the experiment
FIG. 11 is a representative immunohistochemical staining micrograph of UGT3A2 protein in normal gastric glandular epithelium, 11A and 11B show negative expression of UGT3A2 protein in normal gastric glandular epithelium, and 11C and 11D show weak positive expression in normal gastric glandular epithelium.
FIG. 12 is a representative immunohistochemical staining micrograph of UGT3A2 protein in gastric adenocarcinoma tissue, wherein 12A and 12B are negatively expressed and 12C and 12D are positively expressed. Indicating that UGT3A2 protein has positive expression in gastric adenocarcinoma tissue to different degrees.
According to statistics, 63.3% (95/150) of 150 gastric adenocarcinoma tissue samples are positively stained; in 150 cases of samples of paragastric carcinoma normal glandular epithelial tissues, only 12.6% (19/150) of the samples are positively stained; further statistical analysis using chi-square test revealed that there was a significant difference in the expression levels of UGT3a2 protein between gastric adenocarcinoma tissue and paracancerous normal epithelial tissue (P < 0.05).
The experimental result further shows that the UGT3A2 gene expression level (UGT3A2 protein) has obvious difference between gastric adenocarcinoma tissues and paracancer normal tissues, the UGT3A2 protein has obvious correlation with the occurrence of gastric adenocarcinoma, and the UGT3A2 protein can be used as a marker of gastric adenocarcinoma for diagnosis and treatment of gastric adenocarcinoma.
Example 9: UGT3A2 protein content detection in serum and evaluation for gastric adenocarcinoma diagnostic value
1. Collecting samples:
serum samples from 60 patients with gastric adenocarcinoma (gastric adenocarcinoma group) and 40 normal persons (normal control group) in national key laboratory of provincial co-construction of Zhengzhou university for esophageal cancer control were collected and stored at-80 ℃. Among them, the serum of patients with gastric adenocarcinoma is collected when the patients were initially diagnosed with gastric adenocarcinoma and did not receive any radiotherapy and chemotherapy, and the normal human serum is the serum of healthy persons who were examined by gastroscopy and confirmed to have no upper digestive tumor by biopsy.
2. Experimental methods
And detecting the content of UGT3A2 protein in the gastric adenocarcinoma group and the normal control group by adopting enzyme-linked immunosorbent assay and analyzing. The specific operation of the ELISA was the same as in example 3 and will not be described further.
And further carrying out ROC analysis according to the experiment result of UGT3A2 protein content in the serum detected by an ELISA method to obtain a ROC curve.
3. Conclusion of the experiment
In the study, the content of UGT3A2 protein in serum samples of the gastric adenocarcinoma group and the normal control group is detected by using an ELISA technology, and the result is shown in FIG. 4. As can be seen from FIG. 4, the expression level of UGT3A2 in gastric adenocarcinoma patients is much higher than that in normal control population, and has significant difference (P < 0.001). Therefore, the expression level of UGT3A2 protein in serum can distinguish gastric adenocarcinoma from normal control population, and the method has important value in early diagnosis of gastric adenocarcinoma.
FIG. 13 is a ROC plot of serum assayed UGT3A2 protein for diagnosis of gastric adenocarcinoma. As can be seen from fig. 13, the area under the ROC curve (AUC) was 0.9267, and the sensitivity of the UGT3a2 protein for gastric adenocarcinoma diagnosis was 91.8%, and the specificity was 92.5%. The UGT3A2 protein has high specificity and high sensitivity as a diagnostic marker of gastric adenocarcinoma.
(IV) construction method of cell line stably knocking out UGT3A2 gene
Example 10: construction of cell line stably knocking UGT3A2 gene out
And respectively taking the esophageal cancer cell line and the gastric adenocarcinoma cell line as target cells to construct a cell line stably knocking out UGT3A2 gene. The specific experimental operation steps are as follows:
1. design and Synthesis of sgRNA
The transcript of UGT3A2 gene is used as a molecular target to design 3 sgRNA sequences capable of targeting UGT3A2 gene. sgRNA target sequences include PCA03947, PCA03948, PCA03949, the specific nucleotide sequences of which are shown in table 4. The sequence synthesis oligo information based on the sgRNA target described above is shown in table 5.
Table 4 sequences of sgRNA targets targeting UGT3a2 gene
sgRNA numbering sgRNA sequence
PCA03947 AATCATATCAAGTTATCAGT(SEQ.ID.NO.3)
PCA03948 CAGAGGTCGAGCAAAATCAA(SEQ.ID.NO.4)
PCA03949 GCAGCGAGTGCTTCTTCTAG(SEQ.ID.NO.5)
TABLE 5 sequence Synthesis of sgRNA target targeting UGT3A2 Gene DNA Single-stranded oligo information
NO. 5’ STEM 3'
UGT3A2-sgRNA(03947-1)-a CACCg AATCATATCAAGTTATCAGT
UGT3A2-sgRNA(03947-1)-b aaac ACTGATAACTTGATATGATT c
UGT3A2-sgRNA(03948-1)-a CACCg CAGAGGTCGAGCAAAATCAA
UGT3A2-sgRNA(03948-1)-b aaac TTGATTTTGCTCGACCTCTG c
UGT3A2-sgRNA(03949-1)-a CACCg GCAGCGAGTGCTTCTTCTAG
UGT3A2-sgRNA(03949-1)-b aaac CTAGAAGAAGCACTCGCTGC c
2. Construction of Cas9 Single vector plasmid
(1) Designing a sgRNA sequence of a targeted UGT3A2 gene according to the step 1, designing and synthesizing a single-stranded DNA oligo (PAGE purification), wherein the two ends of the sgRNA sequence contain BsmBI enzyme digestion sites sticky ends, dissolving the synthesized primer dry powder in an annealing buffer solution, carrying out water bath at 95 ℃ for 15min, then naturally cooling to room temperature to form double-stranded DNA with sticky ends, and diluting the annealed product to 200 times for use.
(2) The viral vector Lenti-Cas9-sgRNA-GV393 vector (figure 14) has BsmBI enzyme cutting sites, and is cut by BsmBI enzyme, and the enzyme cutting system (20 mu L system) is as follows: BsmBi L. mu.L, 10 XBuffer Tango 2. mu.L, plasmid L. mu.L, DTT (20mM) 1. mu.L, ddH 20 to 20. mu.l. The enzyme digestion conditions are as follows: the enzyme was cleaved at 37 ℃ for 3 hours or overnight. And (3) connecting the enzyme-digested vector with the annealed double strand prepared in the step (1) by using T4 ligase, wherein a connecting system (10 mu L) is as follows: linearized vector DNA 50 ng/. mu.L 2. mu.L, annealed double-stranded DNA 0.5. mu.L, 10 XT 4 buffer 1. mu.L, pEG 40001. mu.L, T4 DNA Ligase 1. mu.L, ddH2And O is supplemented to 10 mu L. Ligation was performed at 16 ℃ for 3 hours or overnight.
(3) The sgRNA fragment-ligated vector was transformed into competent cells.
Put 100 μ l of TOP10 competent cells on ice, add 10 μ l of ligation solution after they have melted completely, flick the tube wall to mix well, and let stand in ice for 30 minutes. The water bath was heat-shocked at 42 ℃ for 90 seconds. The competence was quickly transferred to ice and ice-cooled for 2-5 minutes. Mu.l of LB medium (the medium may be heated to 37 ℃ C. by a water bath) was added to each tube, and then the competence was transferred to a shaker at 37 ℃ and incubated for 1 hour at constant temperature. Centrifuging at 5000rpm for 1 min, removing 500. mu.l of supernatant, blowing and mixing uniformly, and uniformly spreading on Amp resistant LB solid medium. The plate was inverted and incubated overnight in a 37 ℃ incubator. The next day, colonies were identified by PCR.
(4) And (4) performing PCR identification on the positive clone, and selecting the positive clone for sequencing.
Selecting clone colonies for PCR identification, wherein a forward primer sequence is a plasmid consensus sequence, a reverse primer sequence uses an antisense strand of an oligo sequence of sgRNA, and a PCR system (20 ul): 2 XTaq plus master mix 10ul, Primer (+)0.5ul, Primer (-)0.5ul, colony, ddH2And O is supplemented to 20 mu L. PCR reaction program settings are as in table 6:
TABLE 6 two-step Real-Time PCR reaction System Programming
Figure BDA0002529368810000161
And (3) carrying out electrophoresis on the PCR product, selecting a positive clone (a colony of the sgRNA fragment is connected, and a band with the size of 343bp appears in the electrophoresis), inoculating a transformant of the positive clone into an LB culture medium (containing antibiotics), culturing at 37 ℃ for 12-16h, taking a cultured bacterial liquid for sequencing, and comparing and analyzing a sequencing result with a target gene sequence.
(5) Plasmid extraction: the correctly verified bacterial liquid was transferred to 10ml LB liquid medium containing antibiotics, cultured overnight at 37 ℃, and plasmid-extracted using endotoxin-free plasmid miniprep kit (Qiagen) according to the procedure of the specification.
3. Packaging and quality testing of lentiviruses
Co-transfecting 293T cells with a tool vector plasmid carrying a target gene or a target sequence, a virus packaging Helper plasmid (Helper 1.0) and a virus packaging Helper plasmid (Helper 2.0).
Plasmid transfection and lentivirus harvesting
24h before transfection, adjusting the cell density, inoculating the cells in a cell culture dish, and performing transfection when the cell density reaches 80%. 2h before transfection, the medium was changed to serum-free medium. 20. mu.g of plasmid carrying UGT3A2 gene vector, pHelper1.015. mu.g, and pHelper2.010. mu.g were added to the EP tube, and the mixture was adjusted to 1ml and left for 15 min. Mixing well, and continuing culturing. After 6 hours, the culture medium was discarded, washed with PBS, and 20ml of cell culture medium (10% culture serum) was added and cultured for 48 to 72 hours.
② slow virus concentration and purification
And (3) collecting the supernatant of the 293T cells after transfection, centrifuging at 4 ℃ for 4000g/min multiplied by 10min, filtering into a 40ml ultracentrifuge tube, centrifuging for 2h in an ultracentrifuge, discarding the supernatant, adding a virus preservation solution, and repeatedly blowing and beating a heavy suspension liquid. After the solution is fully dissolved, the solution is centrifuged at 10000rpm/min multiplied by 5min at high speed, and the supernatant is subpackaged.
Quality detection of lentivirus
And (3) detecting the physical state, sterility and virus titer of the lentivirus.
4. Infecting target cells to obtain esophageal squamous cancer cell line and gastric adenocarcinoma cell line with UGT3A2 gene stably knocked out
(1) Selection of target cells:
and (3) constructing a cell line for stably knocking UGT3A2 gene out by taking an esophageal cancer cell line and a gastric adenocarcinoma cell line (a cardia adenocarcinoma cell line which can be used for research is not found at present) as target cells.
The results of the detection of UGT3A2 mRNA expression in esophageal squamous carcinoma cell lines EC9706, Eca-109, TE-1 and esophageal normal mucosal epithelium SHEE by Real-Time PCR are shown in FIG. 15. The results of detection of UGT3A2 mRNA expression in gastric adenocarcinoma cell lines AGS, MGC80-3, SGC-7901 and gastric normal mucosal epithelial cells GES-1 by Real-Time PCR as described above are shown in FIG. 16.
As can be seen from FIG. 15, the UGT3A2 gene was expressed in low abundance in SHEE, EC9706, Eca-109 cells and in high abundance in TE-1. As can be seen from FIG. 16, the UGT3A2 gene was expressed in low abundance in AGS, MGC80-3, SGC-7901, and in moderate abundance in GES-1 in gastric normal mucosal epithelial cells.
Based on the expression levels of UGT3a2 in various cell lines, high abundance tumor cell lines were selected for later experiments. Therefore, in the esophageal squamous carcinoma cell line, the TE1 cell line is selected as a tool cell line for later experiments. Cell lines with medium-high expression in gastric adenocarcinoma cell lines were not selected, and the MGC80-3 cell line with relatively highest expression among AGS, MGC80-3 and SGC-7901 was selected as a tool cell line for later experiments.
(2) Lentivirus infection:
regulating growth state of esophageal squamous cell carcinoma cell line TE1 and gastric adenocarcinoma cell line MGC80-3, subjecting cells in logarithmic growth phase to pancreatin digestion to obtain cell suspension, and mixing the cell suspension (cell number is about 5 × 10)4) Inoculating in 6-well plate at 37 deg.C with 5% CO2And (5) culturing in an incubator until the cell fusion degree reaches about 30%, and adding 10ul of constructed lentivirus with UGT3A2 gene knockout according to the MOI value of the cells. GFP expression was observed under a fluorescent microscope with reference to the infection time points determined in the preliminary experiment. Cell status was observed after 12 h: if no obvious cytotoxicity exists, the culture medium is replaced after the culture is continued for 24 hours; if there is a significant cytotoxic effect, the medium is replaced immediately. After 3 days of infection, the fluorescence expression was directly observed to determine the infection efficiency. The fluorescence rate reaches about 70-80%, the cell confluence degree reaches about 80%, an esophageal squamous carcinoma cell line TE1 and a gastric adenocarcinoma cell line MGC80-3 which are successfully knocked out by UGT3A2 genes are constructed, and cells are collected for downstream experiments.
Enzyme digestion detection of sgRNA Activity by Surveyor method (mismatch enzyme method)
The target sequence will be repaired by non-homologous recombination due to the lack of a repair template after Cas/sgRNA cleavage. Thus, mismatches are formed by denaturation and annealing of the target sequence after PCR amplification. The mismatch enzyme will recognize the mismatched heteroduplexes and cleave. The products were run for electrophoresis and the ratio of cleaved to uncleaved bands was compared, which reflected both the activity of Cas/sgRNA.
The transfected cells from each experimental group were collected and the sample genome was extracted using a genomic DNA extraction kit (purchased from TIANGEN, cat # DP 304-02). PCR amplification primers were designed, and the sequences of the PCR amplification primers are shown in Table 7. PCR reaction is carried out according to a PCR system and a reaction program in a gene knockout and mutation detection kit (purchased from Jisheng medicine, the cargo number MB001-1004) specification to obtain a hybrid DNA product, and then enzyme digestion is carried out to screen active sgRNA.
TABLE 7 PCR amplification primer sequences
Figure BDA0002529368810000181
And (4) screening an optimal target point through result identification: PCA03947 target was most active.
(IV) knocking out the effect of UGT3A2 gene on cell proliferation, migration, invasion and apoptosis of esophageal squamous cell carcinoma cell line TE1 and gastric adenocarcinoma cell line MGC80-3
Example 11: influence of knockout of UGT3A2 gene on cell proliferation, migration, invasion and apoptosis of esophageal squamous carcinoma cell line TE1 and gastric adenocarcinoma cell line MGC80-3 is explored
Cell proliferation, migration, invasion and apoptosis experiments were performed using esophageal squamous cell carcinoma cell line TE1 and gastric adenocarcinoma cell line MGC80-3, in which UGT3A2 gene was successfully knocked out, constructed in example 10, while esophageal squamous cell carcinoma cell line TE1 (denoted as NC1) and gastric adenocarcinoma cell line MGC80-3 (denoted as NC2), in which UGT3A2 gene was not knocked out, were used as controls.
MTT method for detecting cell proliferation experiment
(1) Experimental methods
After trypsinization of each experimental group of cells in logarithmic growth phase, the complete medium was resuspended into a cell suspension. Cells were counted using a hemocytometer. The plating cell density was determined according to the growth rate of the cells (most of them were 2000 cells/well). And (3) repeating wells per group for 3-5, wherein each well is 100 mu L, and 5 96-well plates are used for continuous detection for 5 days, and the number of cells added into each well is ensured to be consistent in the plate paving process. Uniformly laying the plates, placing at 37 ℃ and 5% CO2Culturing in an incubator. Starting on the next day after plating and 4 hours before termination of the culture, 10. mu.l of 5mg/mL MTT (purchased from DH343-2, product number of Biotechnology, Inc., Beijing ancient China) was added to each well without changing the medium. After 4h, the medium was aspirated and 100. mu.L DMSO was added to each well to stop the reaction. And oscillating the oscillator for 5-10 min, detecting an OD value by an enzyme-labeling instrument at 490nm, and performing statistical drawing on data. The results are shown in FIG. 17.
(2) Conclusion of the experiment
As can be seen from A in FIG. 17, the esophageal squamous cell line TE1 inhibited cell proliferation after knockout of UGT3A2 gene (P <0.05) compared with the control NC 1; as seen from B in FIG. 17, the gastric adenocarcinoma cell line MGC80-3 inhibited cell proliferation after knocking out UGT3A2 gene (P <0.05) as compared with the control NC 2.
Experiment for detecting apoptosis by Annexin V-APC single staining method
Experimental groups were set according to experimental needs, 3 replicate wells per group, and apoptosis assays were performed at specific time points (5 days post infection):
(1) the experimental steps are as follows:
collecting cell culture supernatant of each experimental group after infection in a 5ml centrifuge tube, washing the cells once by D-Hanks, digesting the cells by pancreatin, terminating the culture supernatant, and collecting the cells in the same 5ml centrifuge tube. Each group is provided with three multiple holes. 1500rmp, 5min centrifugation, discard supernatant. The cell pellet was washed once with PBS, centrifuged at 1500rmp for 5min, and the cells were collected. The cell pellet was washed once with 1 Xbinding buffer, centrifuged at 1500rmp for 5min, and the cells were collected. 1ml (the volume of staining buffer added is determined according to the amount of cell pellet, so that the final density of the cell suspension is 1X 106-1×107Individual cells/ml) 1 × stabilizing buffer resuspended cell pellet. 100ul (1X 10) of cell suspension was taken5-1×106Cells), 5ul annexin V-APC (purchased from Saimer Feishell technology, cat. No. 88-8007) was added for staining, and 10-15min was protected from light at room temperature. Transferring the sample to a flow type machine loading pipe, and loading the sample on a machine for detection. The detection results are shown in fig. 18.
(2) Conclusion of the experiment
As can be seen from FIG. 18, apoptosis of the esophageal cancer cell line TE1 stably knocking out UGT3A2 gene was significantly promoted (P <0.05) as compared with the control group NC 1; compared with a control group NC2, the apoptosis of the gastric adenocarcinoma cell line MGC80-3 with the UGT3A2 gene stably knocked out is obviously promoted (P < 0.05).
3. Clone formation experiments
(1) Experimental procedure
After transfection, each experimental group of cells was inoculated into 6-well plate culture plates, 200 cells were added to each well, and 2 duplicate wells were set. The inoculated cells were further cultured in an incubator for 14 days, cultured conventionally and observed for cell state. The cell clones were photographed under a fluorescent microscope before termination of the experiment, and the cells were washed 2 times with PBS for more than one time at termination of the experimentCells were fixed with paraformaldehyde, washed 2 times with PBS, stained with Giemsa for 10min, ddH2Washing cells for 3 times, taking pictures with a digital camera, counting surviving clones (>50 cells/clone). The results of the experiment are shown in FIG. 19.
(2) Conclusion of the experiment
As can be seen from FIG. 19, the cell clone of the esophageal cancer cell line TE1 stably knocking out the UGT3A2 gene was significantly suppressed (P <0.05) as compared with the control NC 1; compared with the control group NC2, the gastric adenocarcinoma cell line MGC80-3 stably knocking out UGT3A2 gene has no significant difference in the influence on cell clone (P > 0.05).
4. Cell scratch test
(1) Experimental procedure
After transfection, each experimental group of cells was seeded in a 96-well plate, and about 5X 10 cells were added to the wells4The specific number of the cells is different from cell to cell, so that the cells can be fully paved overnight. The low-concentration serum culture solution is changed in the morning next day, so that the influence on the cell state caused by overhigh cell density is avoided. In the afternoon of the next day, the central portion of the lower end of the 96-well plate was aligned with a scratching instrument and slightly pushed upward to form scratches. Gently rinse 2 times with serum-free medium, add serum-free medium, and take pictures for 0 h. Put at 37 ℃ with 5% CO2Culturing in an incubator. After 16-18 hours of incubation, the cells were removed, scanned and photographed using a fluorescence microscope (with the central shaded area of 96 wells as a reference, and the scratch in the center of the image). The results of the experiment are shown in FIG. 20.
(2) Conclusion of the experiment
As can be seen from FIG. 20, the deletion of UGT3A2 gene in the esophageal cancer cell line TE1 has high migration surface inhibition rate on esophageal squamous cell carcinoma cells, and the migration ability is obviously inhibited (P < 0.05). The UGT3A2 gene is knocked out in a gastric adenocarcinoma cell line MGC80-3, and the influence on the cell migration capacity is not significant (P > 0.05).
Transwell cell migration experiment
The influence of the target gene on the cell transfer ability was verified by examining the migration of the target cells into the serum-containing medium in the Transwell chamber.
(1) Experimental procedure
Take out the Transwell testKit (from Corning, cat. No. 3422), the desired number of chambers were placed in a new 24-well plate, 100. mu.L serum-free medium was added to the upper chamber, and the chamber was placed at 37 ℃ for 1 h. Serum-free cell suspensions of the cells of each experimental group after transfection were prepared and counted, and the cell number was adjusted according to the preliminary experiment, generally 105Perwell (24 well plate). The medium was carefully removed from the upper chamber and 100. mu.L of cell suspension was added, and 600. mu.L of 30% FBS medium was added to the lower chamber. The incubation was carried out in an incubator at 37 ℃ for a period of time (the specific time was adjusted according to the preliminary experiment). The chamber was inverted on absorbent paper to remove the medium, the non-transferred cells in the chamber were gently removed with a cotton swab, and the chamber was fixed in a 4% paraformaldehyde fixing solution for half an hour. After fixation, the small chamber is taken out, the surface fixing liquid of the small chamber is sucked dry by using absorbent paper, 1-2 drops of dyeing liquid are dripped to the lower surface of the membrane to dye and transfer cells for 1-3 min, then the small chamber is soaked and washed for several times, and air is dried. Taking a picture by a microscope: for each Transwell cell, fields of view were randomly selected and 100 × 4 photographs and 200 × 9 photographs were taken. Counting by 200 × pictures, data analysis was performed to compare the difference in cell transfer capacity between the experimental group and the control group: calculating the number of transferred cells in each group, standard deviation, analyzing T-Test to obtain P value, and judging whether significant difference (P) exists<0.05, there was a significant difference, otherwise there was no significant difference). The experimental results are shown in fig. 21.
(2) Conclusion of the experiment
As can be seen in FIG. 21, the removal of UGT3A2 gene in the esophageal cancer cell line TE1 results in a decrease in the migration ability of esophageal squamous cell carcinoma cells (P <0.05), which indicates that UGT3A2 can promote the migration of esophageal squamous cell carcinoma cells. The UGT3A2 gene is knocked out in a gastric adenocarcinoma cell line MGC80-3, and the effect on the migration capacity of gastric adenocarcinoma cells is not significant (P > 0.05).
Transwell cell invasion assay
(1) Experimental procedure
Transwell cell invasion experiments were performed using an invasion kit (purchased from Corning, cat # 354480). The kit was removed from the freezer at-20 ℃ and the desired number of chambers were placed in a new 24-well plate and allowed to return to room temperature in a sterile worktop. Adding 500 μ L serum-free culture medium into the upper and lower chambers respectively, and placing in 37 deg.C incubator for 2 hr to make Matrigel mediumThe stratum corneum rehydrates. Serum-free cell suspensions of the cells of each experimental group after transfection were prepared and counted, and the cell number was adjusted according to the preliminary experiment, generally 105Perwell (24 well plate). After rehydration of the Matrigel matrix layer was complete, the chambers were all transferred to a new well plate, the medium was carefully removed from the upper chamber and 500 μ L of cell suspension was added, and 750 μ L of 30% FBS medium was added to the lower chamber. At the same time, the cell suspension was used to spread one MTS 96 well plate, approximately 5000 cells were seeded per well, and OD570 was measured after seeding as an invasion reference. The incubation was carried out in an incubator at 37 ℃ for a period of time (the specific time was adjusted according to the preliminary experiment). And reversely buckling the chamber on absorbent paper to remove the culture medium, lightly removing the non-invasive cells in the chamber by using a cotton swab, dripping 2-3 drops of Giemsa dye solution to the lower surface of the membrane to dye and transfer the cells for 3-5min, soaking and washing the chamber for several times, and airing in the air. Taking a picture by a microscope: for each cell, the field of view was randomly selected and 100 × 4 photographs and 200 × 9 photographs were taken. Counting by 200 × pictures, data analysis is performed to compare the difference of the cell invasion capacity of the experimental group and the control group: and (4) calculating the number of invasive metastatic cells of each group, calculating the standard deviation, analyzing the T-Test to obtain a P value, and judging whether the significant difference exists (if the P is less than 0.05, the significant difference exists, otherwise, the significant difference does not exist). The results of the experiment are shown in FIG. 22.
(2) Conclusion of the experiment
As can be seen in FIG. 22, when UGT3A2 gene is knocked out in the esophageal cancer cell line TE1, the invasion capacity of esophageal squamous cell carcinoma cells is reduced (P is less than 0.05), and the UGT3A2 can promote the invasion of the esophageal squamous cell carcinoma cell line. The UGT3A2 gene is knocked out from the gastric adenocarcinoma cell line MGC80-3, the invasion capacity of gastric adenocarcinoma cells is reduced (P <0.05), and the UGT3A2 can promote the invasion of the gastric adenocarcinoma cells.
In conclusion, after UGT3A2 gene is knocked out by the esophageal squamous carcinoma cell line, the tumor cell proliferation can be inhibited, the migration and invasion of the tumor cell can be promoted, and the apoptosis of the tumor cell can be promoted. After UGT3A2 gene is knocked out by the gastric adenocarcinoma cell line, the tumor cell growth can be inhibited, the tumor cell apoptosis can be promoted, the tumor cell invasion can be promoted, but the tumor cell migration is not obviously influenced.
Although specific embodiments of the invention have been described in detail, those of ordinary skill in the art will understand that. Various modifications and substitutions of those details may be made in light of the overall teachings of the disclosure, and such changes are intended to be within the scope of the present invention. The full scope of the invention is given by the appended claims and any equivalents thereof.
Sequence listing
<110> first subsidiary Hospital of Zhengzhou university
Medical college of New county
<120> UGT3A2 gene and application of protein coded by same in auxiliary diagnosis of upper gastrointestinal tumor
<160> 5
<170> SIPOSequenceListing 1.0
<210> 1
<211> 19
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 1
gcaggaggca acagcacat 19
<210> 2
<211> 19
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 2
atggagccca aggtcacaa 19
<210> 3
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 3
aatcatatca agttatcagt 20
<210> 4
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 4
cagaggtcga gcaaaatcaa 20
<210> 5
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 5
gcagcgagtg cttcttctag 20

Claims (9)

  1. The application of a detection reagent of the expression level of UGT3A2 gene or its coded protein in the preparation of auxiliary diagnosis products for upper gastrointestinal tract tumor, wherein the upper gastrointestinal tract tumor is esophageal squamous carcinoma, cardia adenocarcinoma or gastric adenocarcinoma.
  2. 2. The use of claim 1, wherein the product detects the expression level of UGT3a2 gene in a sample by reverse transcription PCR, real-time quantitative PCR, in situ hybridization, Northern blotting, microarray, high throughput sequencing platform, immunohistochemical staining or enzyme-linked immunosorbent assay.
  3. 3. The use according to claim 1, wherein said product comprises a primer specific for amplification of UGT3a2 gene, a probe hybridizing to nucleotide sequence of UGT3a2 gene or an antibody specifically binding to UGT3a2 protein.
  4. 4. The use according to claim 3, characterized in that the specific primer sequences for amplifying the UGT3A2 gene are shown as SEQ ID No.1 and SEQ ID No. 2; the antibody is a monoclonal antibody or a polyclonal antibody.
  5. 5. The use according to claim 2, wherein the product is a chip, a preparation or a kit; the sample is tissue, serum or cells.
  6. Application of an inhibitor of UGT3A2 gene expression level in preparing a medicament for treating esophageal squamous carcinoma.
  7. Use of an inhibitor of UGT3a2 gene expression level in the manufacture of a medicament for inhibiting the proliferation and invasiveness of cells in gastric adenocarcinoma.
  8. 8. The use of claim 6 or 7, wherein the UGT3A2 gene expression inhibitor comprises sgRNA specifically targeting UGT3A2 gene, and the nucleotide sequence of the sgRNA is shown in any one of SEQ ID NO. 3-SEQ ID NO. 5.
  9. 9. The construction method of the esophageal squamous carcinoma cell line TE1 stably knocking out UGT3A2 genes comprises the following steps:
    (1) adding CACCG to the 5 'end of the sgRNA of claim 8 to obtain a forward oligonucleotide, synthesizing a DNA complementary strand of the sgRNA according to the nucleotide sequence of the sgRNA, adding AAAC to the 5' end of the DNA complementary strand to obtain a reverse oligonucleotide, and denaturing, annealing and forming a double strand by the forward oligonucleotide and the reverse oligonucleotide;
    (2) connecting the double strands prepared in the step (1) with a Cas9 vector to obtain a Cas9 single-vector plasmid;
    (3) carrying out lentivirus packaging and detection on the Cas9 single-vector plasmid prepared in the step (2) to obtain a lentivirus recombinant expression vector;
    (4) infecting the lentiviral recombinant expression vector prepared in the step (3) with an esophageal squamous carcinoma cell line TE1 in vitro, screening stable cells, and obtaining the esophageal squamous carcinoma cell line TE1 with UGT3A2 gene stably knocked out.
CN202010514159.0A 2020-06-08 2020-06-08 UGT3A2 gene and application of protein coded by same in auxiliary diagnosis of upper gastrointestinal tumor Active CN111593124B (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN202010514159.0A CN111593124B (en) 2020-06-08 2020-06-08 UGT3A2 gene and application of protein coded by same in auxiliary diagnosis of upper gastrointestinal tumor

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN202010514159.0A CN111593124B (en) 2020-06-08 2020-06-08 UGT3A2 gene and application of protein coded by same in auxiliary diagnosis of upper gastrointestinal tumor

Publications (2)

Publication Number Publication Date
CN111593124A CN111593124A (en) 2020-08-28
CN111593124B true CN111593124B (en) 2020-12-22

Family

ID=72184782

Family Applications (1)

Application Number Title Priority Date Filing Date
CN202010514159.0A Active CN111593124B (en) 2020-06-08 2020-06-08 UGT3A2 gene and application of protein coded by same in auxiliary diagnosis of upper gastrointestinal tumor

Country Status (1)

Country Link
CN (1) CN111593124B (en)

Family Cites Families (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN110295147A (en) * 2019-07-22 2019-10-01 新乡医学院 The rapid identification method and its application of proliferation phenotype after functional gene knocks out in a kind of esophageal carcinoma cell line

Also Published As

Publication number Publication date
CN111593124A (en) 2020-08-28

Similar Documents

Publication Publication Date Title
CN105779618B (en) A kind of new diagnosis and treatment target gene of Dendritic cell and its application
CN108949768B (en) RAB22A-NoeFs fusion gene line for diagnosing and/or treating osteosarcoma and application thereof
CN106834486B (en) Osteosarcoma molecular diagnosis and treatment marker and application thereof
CN109266743B (en) A kind of cancer markers and application thereof
CN111593124B (en) UGT3A2 gene and application of protein coded by same in auxiliary diagnosis of upper gastrointestinal tumor
CN105886625B (en) Application of the CHKA gene in preparation cancer of the esophagus diagnosis and treatment product
CN113929764B (en) Breast phylliform tumor molecular marker CD146 and application thereof
CN107625780B (en) Non-small cell lung cancer diagnosis marker microRNA-1253 and application thereof in medicine and diagnosis kit
CN110317878A (en) A kind of long-chain non-coding RNA and its application for bladder cancer diagnosis and treatment monitoring
CN111424082A (en) Application of lncRNA-SNHG6 gene in preparation of medicine for treating osteosarcoma
CN110628911B (en) Diagnosis and treatment target gene of epithelial ovarian cancer and application thereof
CN114002431A (en) Application of TNNT1 in preparation of virus-type hepatocellular carcinoma diagnostic kit and preparation or screening of anti-liver cancer drugs
CN110951873A (en) Bone and sarcoma marker, application thereof and kit
CN107881237B (en) Lung cancer diagnosis marker microRNA-4317 and application thereof in medicines and diagnosis kit
CN113604568B (en) Application of HPV16 integration target combined with iron death regulatory gene in preparation of cervical cancer early treatment kit
CN111088357A (en) Tumor marker for ESCC and application thereof
CN110742899A (en) Application of miR-140 in preparation of medicine for inhibiting breast cancer proliferation and migration
CN104740649B (en) Applications of the PLEKHA5 in tumour diagnostic reagent is prepared
CN110577952A (en) Application of long non-coding RNA in diagnosis and treatment of breast cancer
CN113122626B (en) Application of KLC3 gene as marker in diagnosis and treatment of ovarian cancer
CN113122628B (en) Application of CLEC5A gene as marker in diagnosis and treatment of endometrial cancer
CN115976203B (en) Application of HAP1 in preparation of products for diagnosing, preventing and/or treating gastric cancer
CN113122627B (en) Application of IGFL4 gene as marker in diagnosis and treatment of ovarian cancer
CN113122625B (en) Application of SMCO2 gene as marker in diagnosis and treatment of endometrial cancer
CN116814796B (en) Cervical lesion marker and application thereof in diagnosis and prognosis evaluation

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
GR01 Patent grant
GR01 Patent grant