CN111593040B - Dermatan sulfate lyase and application thereof - Google Patents
Dermatan sulfate lyase and application thereof Download PDFInfo
- Publication number
- CN111593040B CN111593040B CN202010569652.2A CN202010569652A CN111593040B CN 111593040 B CN111593040 B CN 111593040B CN 202010569652 A CN202010569652 A CN 202010569652A CN 111593040 B CN111593040 B CN 111593040B
- Authority
- CN
- China
- Prior art keywords
- dlase
- dermatan sulfate
- lyase
- asn
- gly
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/88—Lyases (4.)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
- C12P19/00—Preparation of compounds containing saccharide radicals
- C12P19/26—Preparation of nitrogen-containing carbohydrates
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/527—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving lyase
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Y—ENZYMES
- C12Y402/00—Carbon-oxygen lyases (4.2)
- C12Y402/02—Carbon-oxygen lyases (4.2) acting on polysaccharides (4.2.2)
Abstract
The invention relates to dermatan sulfate lyase and application thereof. The enzyme activity of the dermatan sulfate lyase DLase for degrading dermatan sulfate is 800-1800U/mg, the nucleotide sequence of the coding gene is shown as SEQ ID NO.1 or SEQ ID NO.2, and the amino acid sequence is shown as SEQ ID NO.3 or SEQ ID NO. 4. The dermatan sulfate lyase DLase provided by the invention has higher activity of degrading dermatan sulfate, solves the problem that the dermatan sulfate specificity degrading enzyme activity is low and is not beneficial to large-scale production and application in the prior art, and has better temperature stability.
Description
Technical Field
The invention relates to dermatan sulfate lyase and application thereof, belonging to the technical field of genetic engineering.
Background
Chondroitin Sulfate (CS)/Dermatan Sulfate (DS) is a major type of glycosaminoglycan (GAGs) covalently linked to core proteins by a linker sequence (-gluca-Gal-Xyl-O-Ser) to form Proteoglycans (PGs) (Lindahl, u.1965), which are widely distributed on the cell surface and in the extracellular matrix and are involved in various physiological and pathological processes of cells, including development of the nervous system (Faissner, a.1994, Clement, a.m.1998), injury repair (Trowbridge, j.m.2002), cell division growth, intercellular signal transduction, etc. (Nandi, s.2006, Taylor, k.r.2006). These diverse functions are attributed to the diversity of the CS/DS structure. CS is formed by repeating and linking disaccharide units consisting of D-glucuronic acid (GlcUA) and N-acetyl-D-galactosamine (GalNAc). D-glucuronic acid is changed to L-iduronic acid (IdoUA) and DS (Maccarana, M.2006) by the action of C-5 epimerase. Thus, CS and DS chains are often present in mammalian tissues in a CS-DS copolymeric structure (Izumikawa, T.2004, Cheng, F.1994). During biosynthesis, the CS/DS chain is further modified by sulfotransferase, typically at C-4 and/or C-6 of GalNAc, and/or C-2 of GlcUA/IdoUA, to form a unique domain. These specific domains are distributed in specific cell tissues and interact with various proteins such as cytokines and growth factors to participate in the physiopathological processes of the body (Sugahara, K.2003). Therefore, the study of the specific structure of CS/DS is important for the study of its function.
The heterogeneity of CS and DS structures hinders the study of their functions, and the current methods for their structural analysis are mainly Nuclear Magnetic Resonance (NMR) and Mass Spectrometry (MS) (lindardt, r.j.2006). In addition, the CS/DS lyase with specific activity is also an effective tool for researching the structure function relationship of CS/DS and preparing bioactive oligosaccharides. These lyases specifically cleave the 1, 4-glycosidic bond between GalNAc and GlcUA/IdoUA residues by a β -elimination reaction, thereby generating an unsaturated double bond on the uronic acid residue with a specific uv absorption at 232nm (Garron, m.l. 2010). Some of these lyases can degrade hyaluronic acid (Hyaluronan, HA), CS and DS, such as the commercial chondroitin sulfate lyase abc (csase abc) from Proteus vulgaris (Yamagata, t.1968); some specifically cleave the GalNAc β 1-4GlcUA glycosidic bond of CS in CS/DS sugar chains, such as CSase ACI from Flavobacterium heparinum and CSase ACII from Arthrobacter aurescens (Hiyama, K.1975).
However, only one enzyme CSase B which can specifically cleave GalNAc β 1-4IdoUA glycosidic bond of DS in CS/DS sugar chain has been identified. The enzyme was first observed by Hoffman from f. heprinum, and then separately tested by Michelacci and Dietrich. In 2001, the Pojasek clone expressed CSase B in F.heprinum (Pojasek K.2001). Besides, no other related reports about lyase for specifically degrading DS are found.
Disclosure of Invention
The invention provides dermatan sulfate lyase and application thereof, aiming at the defects of the prior art, in particular to the problems that the quantity of the existing dermatan sulfate specificity degrading enzymes is rare and the specific enzyme activity is low, which is not beneficial to large-scale production and application. The invention discloses two dermatan sulfate lyase candidate genes in an NCBI database by utilizing a bioinformatics technology, and performs heterologous cloning expression and application on the dermatan sulfate lyase candidate genes.
The technical scheme of the invention is as follows:
the enzyme activity of the dermatan sulfate lyase DLase for degrading dermatan sulfate is 800-1800U/mg.
According to the invention, the preferable reaction pH of the dermatan sulfate lyase DLase is 6-10, and the reaction temperature is 10-50 ℃.
According to the invention, the preferable enzyme activity of the dermatan sulfate lyase DLase for degrading dermatan sulfate is 911-1630U/mg.
According to the invention, the preferable reaction pH of the dermatan sulfate lyase DLase is 9-10, and the reaction temperature is 40 ℃.
According to the invention, the dermatan sulfate lyase DLase preferably keeps more than 70% of enzyme activity after being thermally treated for 24 hours at 0-40 ℃.
Further preferably, the dermatan sulfate lyase DLase keeps more than 80% of enzyme activity after being thermally treated at 0-40 ℃ for 24 hours.
According to the invention, the dermatan sulfate lyase DLase promotes the enzyme activity under the condition of calcium ion concentration of 20-40 mM.
Preferably, according to the invention, the dermatan sulphate lyase DLase inhibits its enzymatic activity in the presence of hyaluronic acid, chondroitin sulphate, heparin and/or heparan sulphate.
Preferably, according to the invention, the dermatan sulphate lyase DLase is an endo-type enzyme.
Preferably, the nucleotide sequence of the coding gene of the dermatan sulfate lyase DLase is shown as SEQ ID NO.1 or SEQ ID NO. 2.
Preferably, the amino acid sequence of the dermatan sulfate lyase DLase is shown as SEQ ID NO.3 or SEQ ID NO. 4.
The dermatan sulfate lyase DLase is applied to the preparation of bioactive polysaccharide.
The application of the dermatan sulfate lyase DLase in identifying the CS/DS structure.
The invention has the technical characteristics and beneficial effects that:
1. the invention discovers two potential dermatan sulfate Lyase (DS Lyase, DLase) candidate genes DLase 1 and DLase 2 from NCBI database by utilizing bioinformatics analysis, the candidate genes have lower homology with the coding gene of the known dermatan sulfate Lyase CSase B, and are dermatan sulfate lyases from other sources except CSase B in F.heparinum expressed by Pojasek clone, and the candidate genes are cloned and expressed to discover that both the two enzymes have higher DS Lyase activity, thereby having important application value in CS/DS structural function research, active oligosaccharide preparation and related biomedical research and enriching the variety and quantity of the dermatan sulfate lyases.
2. The dermatan sulfate lyase DLase 1 and DLase 2 related by the invention have higher dermatan sulfate degrading activity, the enzyme activity can respectively reach 911U/mg and 1630U/mg, which is far higher than the reported CSase B enzyme activity of 84.6U/mg, the problem that the activity of the dermatan sulfate specific degrading enzyme in the prior art is not beneficial to large-scale production and application is solved, and simultaneously, the two enzymes have better pH and temperature stability than the reported CSase B, the dermatan sulfate lyase DLase 1 can still keep more than 70% of the enzyme activity after heat treatment for 24 hours at 0-40 ℃, and the dermatan sulfate lyase DLase 2 can still keep more than 80% of the enzyme activity after heat treatment for 24 hours at 0-40 ℃.
3. The dermatan sulfate lyase DLase 1 and DLase 2 are endo-type enzymes, can specifically cut beta-1, 4-glycosidic bonds between GalNAc and IdoUA residues through beta-elimination reaction, can selectively degrade DS structures in CS/DS samples, is used for specific analysis of DS composition structures in CS/DS related samples, selective degradation removal of DS components, preparation of DS oligosaccharides, quality control analysis of related products and the like, is an effective tool for researching CS/DS structure function relationship and preparing bioactive oligosaccharides, and has good application prospect.
Drawings
FIG. 1 is a three-dimensional protein structure model of dermatan sulfate lyase DLase 1 (FIG. A) and DLase 2 (FIG. B);
FIG. 2 is a polyacrylamide gel electrophoresis diagram of the expression and purification of recombinant dermatan sulfate lyase DLase 1 (FIG. A) and DLase 2 (FIG. B);
wherein: lane 1, protein molecular weight standards, bands from top to bottom of 116kD, 66.2kD, 45kD, 35kD, 25kD, 18.4 kD; lane 2, the thalli before wall breaking of the control strain, the loading amount of 10 μ L, lane 3, the bacterial liquid after wall breaking of the recombinant bacteria, the loading amount of 10 μ L, lane 4, the supernatant after wall breaking of the recombinant bacteria, the loading amount of 10 μ L, lane 5, the DLase 1 purified by a nickel column, and the loading amount of 10 μ L; arrows indicate the target protein;
FIG. 3 is a graph showing the effect of pH on the activity of dermatan sulfate lyase DLase 1 (panel A) and DLase 2 (panel B); in the figure, the ordinate is relative activity;
FIG. 4 is a graph showing the effect of temperature on the activity of dermatan sulfate lyase DLase 1 (panel A) and DLase 2 (panel B); in the figure, the abscissa is temperature and the ordinate is relative activity;
FIG. 5 is a graph showing the effect of temperature on the stability of dermatan sulfate lyase DLase 1 (panel A) and DLase 2 (panel B); in the figure, the abscissa is time, and the ordinate is relative activity;
FIG. 6 is a graph showing the effect of metal ions and chemical reagents on the activity of dermatan sulfate lyase DLase 1 (FIG. A) and DLase 2 (FIG. B); in the figure, the ordinate is relative activity;
FIG. 7 is a graph showing the effect of different concentrations of calcium ions on the activity of dermatan sulfate lyase DLase 1 (panel A) and DLase 2 (panel B); in the figure, the abscissa is CaCl 2 Concentration, ordinate is relative activity;
FIG. 8 is a graph showing the effect of various types and concentrations of glycosaminoglycans on the activity of dermatan sulfate lyase DLase 1 (panel A) and DLase 2 (panel B); in the figure, the ordinate is relative activity;
FIG. 9 is a High Performance Liquid Chromatography (HPLC) analysis of the degradation products of dermatan sulfate by dermatan sulfate lyase DLase 1 (panel A) and DLase 2 (panel B) at different times;
wherein: 1, unsaturated octasaccharides; 2, unsaturated hexasaccharide; 3, unsaturated tetrasaccharide; 4, disulfating an unsaturated disaccharide; 5, monosulfating the unsaturated disaccharide.
Detailed Description
The following examples are set forth to provide a general disclosure of some of the techniques used to practice the invention, and are not intended to limit the scope of the invention. The inventors have made the best effort to ensure accuracy with respect to individual parameters (e.g., amounts, temperature, etc.) in the examples, but some experimental error and deviation should be considered. Unless otherwise indicated, molecular weight in the present invention refers to average molecular weight and temperature to degrees celsius. The drugs and reagents mentioned in the examples are all common commercial products unless otherwise specified.
Example 1, acquisition and sequence analysis of dermatan sulfate lyase candidate genes.
The dermatan sulfate lyase candidate gene was identified using NCBI (National Center for Biotechnology Information,http://www.ncb1.nlm.nih.gov/) The analysis software Basic Local Alignment Search Tool (BLAST,http://blast.ncb1.nlm.nih.gov/Blast.cgi) And (6) analyzing and obtaining. The dermatan sulfate lyase DLase 1 is from Pseudomonas saltans, the coding region of the gene is 1539bp (NCBI registration number: AAO78455), the nucleotide sequence of the gene is shown as SEQ ID NO.1, and the gene has 57 percent of homology with the reported coding gene cslB (AAC83384.1) gene of the dermatan sulfate lyase CSase B. The dermatan sulfate lyase DLase 2 is from uncultured bacteria, the length of a gene coding region is 1461bp (NCBI registration number: SCH13530.1), the nucleotide sequence of the gene coding region is shown as SEQ ID NO.2, and the gene coding region has homology of only 43 percent with the reported gene cslB (AAC83384.1) of the dermatan sulfate lyase CSase B.
The protein sequence of dermatan sulfate lyase DLase 1 coded by the nucleotide sequence SEQ ID NO.1 consists of 512 amino acids, the amino acid sequence is shown as SEQ ID NO.3, and the theoretical molecular weight of the protein is about 56.32 kD. With a Simple Modular Architecture Research Tool (SMART,http://smart.embl_heidelberg.de/) The structural information of dermatan sulfate lyase DLase 1 is analyzed, and the result shows that the 1 st to 21 st amino acids at the N end are signal peptide sequences, and the 26 th to 414 th amino acid sequences belong to the 6 th superfamily of polysaccharide lyase. (ii) with SWISS-MODEL homology modeling Serverhttp:// swissmodel.expasy.org) Homologous modeling is performed on the three-dimensional structure of the protein of dermatan sulfate lyase DLase 1, and the finally obtained three-dimensional structure model of the protein is shown in FIG. 1A.
The protein sequence of dermatan sulfate lyase DLase 2 coded by the nucleotide sequence SEQ ID NO.2 consists of 486 amino acids, the amino acid sequence is shown in SEQ ID NO.4, and the theoretical molecular weight of the protein is about 53.46 kD. With a Simple Modular Architecture Research Tool (SMART,http://smart.embl_heidelberg.de/) Analyzing the structural information of dermatan sulfate lyase DLase 2, the result shows that the 1 st to 19 th amino acids at the N end are signal peptide sequences, and the 24 th to 409 th amino acidsThe amino acid sequence belongs to the 6 superfamily of polysaccharide lyases. (ii) with SWISS-MODEL homology modeling Serverhttp:// swissmodel.expasy.org) Homologous modeling is performed on the three-dimensional structure of the protein of dermatan sulfate lyase DLase 2, and the finally obtained three-dimensional structure model of the protein is shown in FIG. 1B.
Example 2 recombinant expression of the DLase 1 gene and the DLase 2 gene in E.coli.
Respectively taking the nucleotide sequences shown in SEQ ID No.1 and SEQ ID No.1 as PCR templates, synthesizing the PCR templates by using a Huada gene, and carrying out PCR amplification, wherein the primers are as follows:
forward primer rDLase 1-F: GCATATGAAGCATATTCTGGTGGCGAGCG；
Reverse primer rDLase 1-R: GCTCGAGGTTGTTGCGATCACGTGCCAGC；
Forward primer rDLase 2-F: GCATATGGAAAATATTACCGTGGGCACCACC；
Reverse primer rDLase 2-R: GCTCGAGCTGTGCAAAGATACCAGTCTCGGC。
In the forward and reverse primers, underlined base sequences are the restriction sites for the restriction enzymes NdeI and XhoI, respectively. Primerstar HS DNA polymerase was purchased from Takara Shuzo and the PCR reaction system was performed according to the manufacturer's instructions.
And (3) PCR reaction conditions: pre-denaturation at 94 ℃ for 5 min; denaturation at 94 ℃ for 40s, annealing at 60 ℃ for 30s, extension at 72 ℃ for 2min, and 35 cycles; extension at 72 deg.C for 10min, and stabilization at 4 deg.C for 15 min.
After PCR amplification is carried out on gene fragments of DLase 1 and DLase 2, double enzyme digestion treatment is carried out on a PCR product and a pET-30a expression vector by using restriction enzymes NdeI and XhoI respectively, and then agarose gel electrophoresis is utilized to recover a target gene fragment subjected to double enzyme digestion. The restriction enzymes NdeI and XhoI used in the process were obtained from Takara Bio Inc., the pET-30a vector was obtained from Novagen, USA, and the system, reaction temperature and reaction time for the reaction of the enzyme with the substrate were in accordance with the instructions.
Connecting the PCR product recovered by double enzyme digestion with the pET-30a expression vector subjected to the same double enzyme digestion, transforming the connection product into an escherichia coli DH5 alpha strain, and coating the strain on a Luria-Bertani culture medium solid plate containing 50 mu g/mL kanamycin sulfate; culturing at 37 deg.C for 12h, selecting single clone to contain 50 μ g/mL kanamycin sulfate liquid Luria-Bertani culture medium, shake culturing at 37 deg.C and 200rpm for 12h, and extracting plasmid; and then carrying out PCR verification on bacterial liquid by using a forward primer and a reverse primer, obtaining an amplification product with a correct size as a result, preliminarily proving that the constructed recombinant plasmid is correct, taking out 20 mu L of the recombinant plasmid, sending the recombinant plasmid to a bio-engineering company for sequencing, wherein sequencing results show that a DLase 1 gene fragment (SEQID NO.1) and a DLase 2 gene fragment (SEQID NO.2) are successfully and respectively inserted between NdeI and XhoI enzyme cutting sites of a pET-30a expression vector, the insertion direction is correct, and base mutation, deletion and addition are not generated, so that the constructed recombinant plasmid is further proved to be correct, and the recombinant expression vectors are named as pET30a-DLase 1 and pET30 DLase 2. T4 DNA ligase was purchased from TaKaRa, and the ligation reaction system, reaction temperature and reaction time were in accordance with the instructions.
The recombinant plasmids pET30a-DLase 1 and pET30a-DLase 2 are respectively transformed into Escherichia coli BL21(DE3) (purchased from Novagen, USA), then the induced expression of the recombinant dermatan sulfate lyase DLase 1 and DLase 2 is carried out according to the operation steps provided by the company, the target protein is purified by Ni Sepharose 6Fast Flow (GE) gel, then the purified target protein is detected by polyacrylamide gel electrophoresis, the detection result is shown in figure 2, the purified recombinant dermatan sulfate lyase DLase 1 and DLase 2 are both single bands on the electrophoresis gel, the positions are identical with the predicted molecular weight, and the purity is 95%.
Example 3 enzymatic Properties analysis of recombinant dermatan sulfate lyases DLase 1 and DLase 2
1. Effect of pH on enzyme Activity
Mixing dermatan sulfate 3mg/mL, reaction buffer solution of 150mM NaAc-HAc (pH5.0-6.0) and 150mM NaH, DLase 1 or DLase 2, and deionized water at a ratio of 10:10:3:7 (by volume) 2 PO 4 -Na 2 HPO 4 (pH6.0-8.0), 150mM Tris-HCl (pH 7.0-10.0). Reacting at 30 deg.C for 10min, and measuring enzyme by ultraviolet spectrophotometryThe activity, the detection result is shown in fig. 3A, the recombinant dermatan sulfate lyase DLase 1 reaches the maximum activity in Tris-HCl (pH 10.0), the activity is the second activity in NaAc-HAc (pH 6.0), but in consideration of the influence of excessively high pH on the stability of subsequent metal ions, NaAc-HAc (pH 6.0) is finally selected as the pH of the subsequent experimental reaction; the recombinant dermatan sulfate lyase DLase 2 reached maximum activity in Tris-HCl (pH 9.0) (FIG. 3B), and thus the optimal reaction pH was 9.0.
The method for measuring the enzyme activity by the ultraviolet method refers to the prior art (Yamagata, T.1968), takes the inactivated enzyme as a negative control, and utilizes a spectrophotometer to measure 232nm light absorption of a reaction product to judge the production of the product so as to judge the enzyme activity.
2. Influence of temperature on the enzymatic Activity
Mixing 3mg/mL dermatan sulfate, 150mM NaAc-HAc (pH 6.0) buffer solution (used for DLase 1 enzyme solution reaction) with pH7.0 or 150mM Tris-HCl (pH 9.0) (used for DLase 2 enzyme solution reaction) buffer solution, DLase 1 enzyme solution or DLase 2 enzyme solution and deionized water according to the ratio of 10:10:3:7 (volume ratio), respectively reacting for 10min at the conditions of 0 ℃,10 ℃,20 ℃, 30 ℃,40 ℃, 50 ℃, 60 ℃ and 70 ℃, after the reaction is finished, measuring the enzyme activity according to an ultraviolet spectrophotometry, wherein the detection result is shown in figure 4, the DLase 1 and the DLase 2 reach the maximum activity at 40 ℃, and the optimal reaction temperature of the recombinant dermatan sulfate lyase DLase 1 and the DLase 2 is shown to be 40 ℃.
3. Effect of temperature on enzyme stability
Carrying out heat treatment on the DLase 1 enzyme solution and the DLase 2 enzyme solution at different temperatures of 0-70 ℃ for 1,2, 4, 8, 12 and 24 hours, then respectively determining residual enzyme activity with dermatan sulfate of 3mg/mL at the optimal temperature and the optimal pH, wherein the enzyme activity of the enzyme solution without heat treatment is defined as 100% relative activity, and the detection result is shown in figure 5A, and the recombinant dermatan sulfate lyase DLase 1 can still maintain more than 70% of the enzyme activity after heat treatment at 0-40 ℃ for 24 hours. DLase 1 has better temperature stability than reported CSase B. The recombinant dermatan sulfate lyase DLase 2 can still maintain more than 80% of enzyme activity after heat treatment at 0-40 ℃ for 24h (figure 5B), and compared with the reported CSase B, the DLase 2 also has better temperature stability.
4. Effect of Metal ions on enzyme Activity
Mixing 3mg/mL dermatan sulfate, 150mM NaAc-HAc (pH 6.0) buffer solution (used for DLase 1 enzyme solution reaction) with pH7.0 or 150mM Tris-HCl (pH 9.0) (used for DLase 2 enzyme solution reaction), DLase 1 or DLase 2 enzyme solution and deionized water according to the proportion of 10:10:3:4 (volume ratio), then adding different metal ions into the reaction system, wherein the final concentration of the added metal ions is 10mM, reacting for 10min at 40 ℃, detecting the residual enzyme activity according to an ultraviolet spectrophotometry after the reaction is finished, and defining the enzyme activity without the added metal ions as 100%. The results are shown in FIG. 6A, Ag + ,Hg 2+ ,Fe 2 + ,Cu 2+ ,Zn 2+ ,Fe 3+ ,Cr 3+ EDTA and SDS have strong inhibitory effect on the activity of DLase 1 enzyme, Ca 2+ ,Mg 2+ ,Mn 2+ And Ba 2+ Has higher promotion effect on the enzyme activity of DLase 1. As shown in FIG. 6B, Ag + ,Co 2+ ,Pb 2+ ,Cu 2+ ,Zn 2+ ,Fe 3+ EDTA, and SDS have a strong inhibitory effect on the activity of DLase 2 enzyme, Ca 2+ ,Hg 2+ ,Mn 2+ ,Cr 3+ And Ba 2+ Has higher promotion effect on the enzyme activity of DLase 2.
5. Effect of calcium ion concentration on enzymatic Activity
Mixing 3mg/mL dermatan sulfate, 150mM NaAc-HAc (pH 6.0) buffer solution (used for DLase 1 enzyme solution reaction) with pH7.0 or 150mM Tris-HCl (pH 9.0) (used for DLase 2 enzyme solution reaction), DLase 1 or DLase 2 enzyme solution and deionized water according to the proportion of 10:10:3:4 (volume ratio), then adding calcium ions with different concentrations of 0,10,20,40,80,160,320mM into a reaction system, reacting for 10min at 40 ℃, and detecting the residual enzyme activity by an ultraviolet spectrophotometry after the reaction is finished, wherein the detection result is shown in figure 7A, and the concentration of the calcium ions of 20-40mM has a strong promotion effect on the DLase 1 enzyme activity. As shown in FIG. 7B, the calcium ion concentration of 20-40mM has a strong promoting effect on the enzyme activity of DLase 2, and in order to reduce the use of the calcium ion concentration, the calcium ion concentration of 20mM is selected as the optimal reaction concentration for subsequent experiments.
Example 4 determination of enzyme Activity of recombinant dermatan sulfate lyase DLase 1 and DLase 2
1. Enzyme activity determination of recombinant dermatan sulfate lyase DLase 1 and DLase 2
Mixing 3mg/mL dermatan sulfate, 150mM NaAc-HAc (pH 6.0) buffer solution (used for DLase 1 enzyme solution reaction) with pH7.0 or 150mM Tris-HCl (pH 9.0) (used for DLase 2 enzyme solution reaction), DLase 1 or DLase 2 enzyme solution, deionized water and 200mM calcium ions according to the proportion of 10:10:3:4:3 (volume ratio), reacting for 0-10min under the optimal condition of 40 ℃, and measuring the enzyme activity according to the ultraviolet spectrophotometry after the reaction is finished. Meanwhile, the protein content of the enzyme solution of DLase 1 and DLase 2 is measured by using a protein quantitative kit purchased from Kangji century company, and the result shows that: the specific activity of the recombinant dermatan sulfate lyase DLase 1 to dermatan sulfate is 911U/mg, and the specific activity of the recombinant dermatan sulfate lyase DLase 2 to dermatan sulfate is 1630U/mg.
Definition of enzyme activity unit: the amount of enzyme required to produce 1 micromole of unsaturated double bonds per minute.
2. Effect of different kinds and concentrations of glycosaminoglycan on enzymatic Activity
Mixing dermatan sulfate 3mg/mL, NaAc-HAc (pH 6.0) buffer solution (for DLase 1 enzyme solution reaction) with 150mM pH7.0 or Tris-HCl (pH 9.0) (for DLase 2 enzyme solution reaction) with 150mM, DLase 1 or DLase 2 enzyme solution, deionized water and 200mM calcium ions according to the ratio of 10:10:3:4:3 (volume ratio), then adding different glycosaminoglycans with final concentration of 0,0.5,1,2mg/mL into the reaction system, reacting for 1min at 40 ℃, and after the reaction is finished, measuring the enzyme activity according to the ultraviolet spectrophotometry. As shown in FIG. 8, other glycosaminoglycans (HA, CS, Hep, HS) than dermatan sulfate have inhibitory effects on the enzyme activities of DLase 1 (FIG. 8A) and DLase 2 (FIG. 8B), and the inhibitory effects are gradually increased with the increase of the glycosaminoglycan concentration. Among them, heparin has the strongest inhibitory effect on enzyme activity.
Example 5 High Performance Liquid Chromatography (HPLC) analysis of degradation products of recombinant dermatan sulfate lyases DLase 1 and DLase 2
Mixing 3mg/mL dermatan sulfate, 150mM NaAc-HAc (pH 6.0) buffer (for DLase 1 enzyme solution reaction) of pH7.0 or 150mM Tris-HCl (pH 9.0) (for DLase 2 enzyme solution reaction), DLase 1 or DLase 2 enzyme solution, deionized water and 200mM calcium ions according to a ratio of 10:10:3:4:3 (volume ratio), reacting at 40 ℃ for different times (0, 0.5,1, 3, 10, 30, 120, 360min), and taking degradation products for HPLC analysis, wherein the HPLC analysis conditions are that a gel column: superdex peptide 10/300GL (GE); mobile phase: 0.2M ammonium bicarbonate; flow rate: 0.4 mL/min; detection conditions are as follows: UV232 nm.
As shown in FIG. 9, during the degradation of polysaccharides, the recombinant dermatan sulfate lyase DLase 1 (FIG. 9A) and DLase 2 (FIG. 9B) both produce oligosaccharides with a larger molecular weight, and then degrade the oligosaccharides into oligosaccharides with a smaller molecular weight, and finally convert the oligosaccharides into disaccharides. The results indicate that DLase 1 and DLase 2 belong to endo-type dermatan sulfate lyase.
The dermatan sulfate lyase DLase 1/DLase 2 can specifically cut beta-1, 4-glycosidic bond between GalNAc and IdoUA residue through beta-elimination reaction, so that the DS structure in a CS/DS sample can be selectively degraded, and the dermatan sulfate lyase is used for specificity analysis of DS composition structure in a CS/DS related sample, selective degradation removal of DS components, preparation of DS oligosaccharide, quality control analysis of related products and the like.
SEQUENCE LISTING
<110> Shandong university
<120> dermatan sulfate lyase and use thereof
<160> 4
<170> PatentIn version 3.5
<210> 1
<211> 1539
<212> DNA
<213> Pseudopedobacter saltans
<400> 1
atgaataaaa ggacacttgt tttaggtttt gttttactat gctttgccct gccaacatgg 60
gcaaagcata ttcttgttgc ttctgtaaaa gaagtttata gtaaggttga tcagcttaaa 120
gccggcgata cattgctgct aaaagacggt atctataaag atatccaatt ggttgttaaa 180
cgctctggaa gtaaagaaaa accaattgtt attgctgcgc aaaacggagg aaaggttttc 240
tttaccggtg atgccaaggt agaattgaga ggtgaatatc ttgtccttaa ggatatctat 300
tttaaagacg gaaatcgcaa tgtcaatcaa tggaaatcgc atgggccggg tttggtggct 360
atttacggta gttataaccg cgtaaccgga tgtgttttta atgcttttga cgaagccaac 420
tctgcttata ttaccacttc tttaacagag gaaggaaaag taccaaaaca ttgccgtata 480
gaccattgtg tctttaccga taaaatcact ttcgatcagg taattaactt aaataacaga 540
cccagagccg ataaggaaag caaggttttg ggcgaggcta tgtatcatcg tatagaccat 600
tgctttttct ctaatccgcc aaagccagga aatgcaggtg gcggtattcg tgttggttat 660
taccgaaatg atatcggccg gtgcctgata gattctaacc tttttgtcag acaagattcg 720
gaagctgaaa tcgtgaccag caaatcgcag gagaatgttt attatggtaa taccatttta 780
aattgtcagg gaacattaaa cttcagacat ggcgataagc aagtagctct aaataacttt 840
tttatcagta cagataataa atatggctac ggcggaatgt ttgtttgggg aagtcagcat 900
atcatagcca ataactattt caatctgaaa aagactatca aggccagagg gaatgccgct 960
ttgtatctta atccaggacc ggaaggttct gaacatgctt tggctttcaa ctcgttaatc 1020
gtcaataatt tttttgatga taataatggt tacgatatca attttgaacc gttattagaa 1080
agaagaaagg agtttgctaa agaggtgaat gccgagttta aactacctta taacatcacg 1140
attgaaggaa atctttttgc aagcaagcag ggcgataaac atattccatt cttaggaaat 1200
ctggataaga ataaccttca gaacaattat agtttcggac aaatggctaa tgataaattg 1260
tttaccaatg taaagccaac gaccgacggt tcttataacc cgcaaagtta taaaggatat 1320
cagttagcta acgttaagga tattaagaat attgaaggga ttgatctgga tatccaaaat 1380
ctaatcaata aaggaataga aggaaaccca ctaacatgga atgatgtacg tccgtcatgg 1440
ttagtggaaa taccaggatc ttacgccaaa gaaggtacac tggatcagga aactaaaata 1500
cgttttcaaa gggttttggc aagagacaga aataactaa 1539
<210> 2
<211> 1461
<212> DNA
<213> uncultured Bacteroides
<400> 2
atgaaacgca tattatcaat tcttccatca ctggcctttg ccacctgtgt catggctgaa 60
aacattacag taggcacaac gcaagacctc gtaaatgctg cggcaacagt aaaacccggc 120
gatactattc tattgaccga cggaacatac agagacctac gtcttacggt aactgcagac 180
ggaacaggcg acaagatgat aaccataaaa gcccagaacc cgggcaaagc atatatctcc 240
ggcaattcag caatcgaact ccgcggagat tacatccacc tgtcgggatt gtatttcaag 300
gacggcagca gaaatcctag cgaatggaaa actcacggcc ctggtatagt aagcatttat 360
gccgaccatt gcgaagtgtc agactgcctg ttctacgatt tcgataacgc taactcatca 420
tatatatcta ccaatctaga cgaaacaggc catgtacctc aatattgcca tatacaccac 480
tgtgcatttg taggcaaaac aacccaggat caggttataa atcttaataa caccaaaaag 540
aaaaccctgg aaggagaacc tggaaaaccg atgtatcacc gcatcagcta ttgctatttc 600
tccaatcccc caaagaaagg caatgccgga ggcggtatca gagtaggcta ctggcgcaaa 660
gactacggaa gatgtctgat agaccacaac ctgtttgaaa gacaagactc tgaagccgag 720
attgtgacaa gcaaatctat ggagaatgta tatttcgcca acacattcat caactgtcgc 780
ggaacactta atttccgtca tggcgacaag caggttgccc tgaacaacat attcatagga 840
tcagacgaaa tgtacggtta tggcggcatg tacatctggg gtagtaacca cattataggc 900
aataacttct tttatcttcc taaaacgatg aaagacagag gatacgcagg tatatatttc 960
aactgcggac cgaaagcaag cgaacacgct ctggcatacg atatggtggt agtgagcaat 1020
acttttatag ctgtacaagg aacagcattc aaccttgcgc ctatgtatga cagacgtctg 1080
aaagcctttg gagatgcagc agaattgcct cacgacataa catttgtcaa caattatata 1140
tcttcccaca acaagacaaa gtctatctgg tacgaggaaa aaggcaactc agccaatcag 1200
aaatgggaag gcaatgtgtg ttcaggcata aatgttacgg gcataaaagg ctgggagaac 1260
ggtacagcac ccaaaggcat caccacagaa gagttaacaa aaattcttcc atacacatct 1320
atcgaaggaa tagacatgga tttcgtaaag gtactctcca ctcctcttca ggacaaacct 1380
ctgaacaaaa agattaccgg tccttcatgg tgtgacgaat acccgggcaa ttatgccgaa 1440
acgggcatct tcgcacagta a 1461
<210> 3
<211> 512
<212> PRT
<213> Pseudopedobacter saltans
<400> 3
Met Asn Lys Arg Thr Leu Val Leu Gly Phe Val Leu Leu Cys Phe Ala
1 5 10 15
Leu Pro Thr Trp Ala Lys His Ile Leu Val Ala Ser Val Lys Glu Val
20 25 30
Tyr Ser Lys Val Asp Gln Leu Lys Ala Gly Asp Thr Leu Leu Leu Lys
35 40 45
Asp Gly Ile Tyr Lys Asp Ile Gln Leu Val Val Lys Arg Ser Gly Ser
50 55 60
Lys Glu Lys Pro Ile Val Ile Ala Ala Gln Asn Gly Gly Lys Val Phe
65 70 75 80
Phe Thr Gly Asp Ala Lys Val Glu Leu Arg Gly Glu Tyr Leu Val Leu
85 90 95
Lys Asp Ile Tyr Phe Lys Asp Gly Asn Arg Asn Val Asn Gln Trp Lys
100 105 110
Ser His Gly Pro Gly Leu Val Ala Ile Tyr Gly Ser Tyr Asn Arg Val
115 120 125
Thr Gly Cys Val Phe Asn Ala Phe Asp Glu Ala Asn Ser Ala Tyr Ile
130 135 140
Thr Thr Ser Leu Thr Glu Glu Gly Lys Val Pro Lys His Cys Arg Ile
145 150 155 160
Asp His Cys Val Phe Thr Asp Lys Ile Thr Phe Asp Gln Val Ile Asn
165 170 175
Leu Asn Asn Arg Pro Arg Ala Asp Lys Glu Ser Lys Val Leu Gly Glu
180 185 190
Ala Met Tyr His Arg Ile Asp His Cys Phe Phe Ser Asn Pro Pro Lys
195 200 205
Pro Gly Asn Ala Gly Gly Gly Ile Arg Val Gly Tyr Tyr Arg Asn Asp
210 215 220
Ile Gly Arg Cys Leu Ile Asp Ser Asn Leu Phe Val Arg Gln Asp Ser
225 230 235 240
Glu Ala Glu Ile Val Thr Ser Lys Ser Gln Glu Asn Val Tyr Tyr Gly
245 250 255
Asn Thr Ile Leu Asn Cys Gln Gly Thr Leu Asn Phe Arg His Gly Asp
260 265 270
Lys Gln Val Ala Leu Asn Asn Phe Phe Ile Ser Thr Asp Asn Lys Tyr
275 280 285
Gly Tyr Gly Gly Met Phe Val Trp Gly Ser Gln His Ile Ile Ala Asn
290 295 300
Asn Tyr Phe Asn Leu Lys Lys Thr Ile Lys Ala Arg Gly Asn Ala Ala
305 310 315 320
Leu Tyr Leu Asn Pro Gly Pro Glu Gly Ser Glu His Ala Leu Ala Phe
325 330 335
Asn Ser Leu Ile Val Asn Asn Phe Phe Asp Asp Asn Asn Gly Tyr Asp
340 345 350
Ile Asn Phe Glu Pro Leu Leu Glu Arg Arg Lys Glu Phe Ala Lys Glu
355 360 365
Val Asn Ala Glu Phe Lys Leu Pro Tyr Asn Ile Thr Ile Glu Gly Asn
370 375 380
Leu Phe Ala Ser Lys Gln Gly Asp Lys His Ile Pro Phe Leu Gly Asn
385 390 395 400
Leu Asp Lys Asn Asn Leu Gln Asn Asn Tyr Ser Phe Gly Gln Met Ala
405 410 415
Asn Asp Lys Leu Phe Thr Asn Val Lys Pro Thr Thr Asp Gly Ser Tyr
420 425 430
Asn Pro Gln Ser Tyr Lys Gly Tyr Gln Leu Ala Asn Val Lys Asp Ile
435 440 445
Lys Asn Ile Glu Gly Ile Asp Leu Asp Ile Gln Asn Leu Ile Asn Lys
450 455 460
Gly Ile Glu Gly Asn Pro Leu Thr Trp Asn Asp Val Arg Pro Ser Trp
465 470 475 480
Leu Val Glu Ile Pro Gly Ser Tyr Ala Lys Glu Gly Thr Leu Asp Gln
485 490 495
Glu Thr Lys Ile Arg Phe Gln Arg Val Leu Ala Arg Asp Arg Asn Asn
500 505 510
<210> 4
<211> 486
<212> PRT
<213> uncultured Bacteroides
<400> 4
Met Lys Arg Ile Leu Ser Ile Leu Pro Ser Leu Ala Phe Ala Thr Cys
1 5 10 15
Val Met Ala Glu Asn Ile Thr Val Gly Thr Thr Gln Asp Leu Val Asn
20 25 30
Ala Ala Ala Thr Val Lys Pro Gly Asp Thr Ile Leu Leu Thr Asp Gly
35 40 45
Thr Tyr Arg Asp Leu Arg Leu Thr Val Thr Ala Asp Gly Thr Gly Asp
50 55 60
Lys Met Ile Thr Ile Lys Ala Gln Asn Pro Gly Lys Ala Tyr Ile Ser
65 70 75 80
Gly Asn Ser Ala Ile Glu Leu Arg Gly Asp Tyr Ile His Leu Ser Gly
85 90 95
Leu Tyr Phe Lys Asp Gly Ser Arg Asn Pro Ser Glu Trp Lys Thr His
100 105 110
Gly Pro Gly Ile Val Ser Ile Tyr Ala Asp His Cys Glu Val Ser Asp
115 120 125
Cys Leu Phe Tyr Asp Phe Asp Asn Ala Asn Ser Ser Tyr Ile Ser Thr
130 135 140
Asn Leu Asp Glu Thr Gly His Val Pro Gln Tyr Cys His Ile His His
145 150 155 160
Cys Ala Phe Val Gly Lys Thr Thr Gln Asp Gln Val Ile Asn Leu Asn
165 170 175
Asn Thr Lys Lys Lys Thr Leu Glu Gly Glu Pro Gly Lys Pro Met Tyr
180 185 190
His Arg Ile Ser Tyr Cys Tyr Phe Ser Asn Pro Pro Lys Lys Gly Asn
195 200 205
Ala Gly Gly Gly Ile Arg Val Gly Tyr Trp Arg Lys Asp Tyr Gly Arg
210 215 220
Cys Leu Ile Asp His Asn Leu Phe Glu Arg Gln Asp Ser Glu Ala Glu
225 230 235 240
Ile Val Thr Ser Lys Ser Met Glu Asn Val Tyr Phe Ala Asn Thr Phe
245 250 255
Ile Asn Cys Arg Gly Thr Leu Asn Phe Arg His Gly Asp Lys Gln Val
260 265 270
Ala Leu Asn Asn Ile Phe Ile Gly Ser Asp Glu Met Tyr Gly Tyr Gly
275 280 285
Gly Met Tyr Ile Trp Gly Ser Asn His Ile Ile Gly Asn Asn Phe Phe
290 295 300
Tyr Leu Pro Lys Thr Met Lys Asp Arg Gly Tyr Ala Gly Ile Tyr Phe
305 310 315 320
Asn Cys Gly Pro Lys Ala Ser Glu His Ala Leu Ala Tyr Asp Met Val
325 330 335
Val Val Ser Asn Thr Phe Ile Ala Val Gln Gly Thr Ala Phe Asn Leu
340 345 350
Ala Pro Met Tyr Asp Arg Arg Leu Lys Ala Phe Gly Asp Ala Ala Glu
355 360 365
Leu Pro His Asp Ile Thr Phe Val Asn Asn Tyr Ile Ser Ser His Asn
370 375 380
Lys Thr Lys Ser Ile Trp Tyr Glu Glu Lys Gly Asn Ser Ala Asn Gln
385 390 395 400
Lys Trp Glu Gly Asn Val Cys Ser Gly Ile Asn Val Thr Gly Ile Lys
405 410 415
Gly Trp Glu Asn Gly Thr Ala Pro Lys Gly Ile Thr Thr Glu Glu Leu
420 425 430
Thr Lys Ile Leu Pro Tyr Thr Ser Ile Glu Gly Ile Asp Met Asp Phe
435 440 445
Val Lys Val Leu Ser Thr Pro Leu Gln Asp Lys Pro Leu Asn Lys Lys
450 455 460
Ile Thr Gly Pro Ser Trp Cys Asp Glu Tyr Pro Gly Asn Tyr Ala Glu
465 470 475 480
Thr Gly Ile Phe Ala Gln
485
Claims (5)
1. A method for preparing bioactive polysaccharide by utilizing dermatan sulfate lyase DLase is characterized in that 3mg/mL dermatan sulfate, 150mM NaAc-HAc buffer solution with pH6.0 or 150mM Tris-HCl buffer solution with pH 9.0, DLase enzyme solution, deionized water and 200mM calcium ions are mixed according to the volume ratio of 10:10:3:4:3, and the mixture reacts for 0.5-360 min at 40 ℃ to obtain lysate containing bioactive polysaccharide; the nucleotide sequence of the coding gene of the dermatan sulfate lyase DLase is shown as SEQ ID NO.1 or SEQ ID NO. 2; the NaAc-HAc buffer solution with the pH value of 6.0 is used for the cleavage reaction of the dermatan sulfate lyase shown in SEQ ID NO.1, and the Tris-HCl buffer solution with the pH value of 9.0 is used for the cleavage reaction of the dermatan sulfate lyase shown in SEQ ID NO. 2.
2. The method of claim 1, wherein the dermatan sulfate lyase DLase is an endo-type enzyme that specifically cleaves the β -1, 4-glycosidic bond between GalNAc and IdoUA residues by a β -elimination reaction.
3. The method of claim 1, wherein the biologically active polysaccharide comprises an unsaturated octasaccharide, an unsaturated hexasaccharide, an unsaturated tetrasaccharide, a disulphated unsaturated disaccharide, and a monosulphated unsaturated disaccharide.
4. The method of claim 1, wherein the dermatan sulfate lyase DLase inhibits its enzymatic activity in the presence of hyaluronic acid, chondroitin sulfate, heparin and/or heparan sulfate.
5. The method according to claim 1, wherein the dermatan sulfate lyase DLase has an activity of 800 to 1800U/mg for degrading dermatan sulfate.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202010569652.2A CN111593040B (en) | 2020-06-20 | 2020-06-20 | Dermatan sulfate lyase and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202010569652.2A CN111593040B (en) | 2020-06-20 | 2020-06-20 | Dermatan sulfate lyase and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN111593040A CN111593040A (en) | 2020-08-28 |
| CN111593040B true CN111593040B (en) | 2022-08-30 |
Family
ID=72189858
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202010569652.2A Active CN111593040B (en) | 2020-06-20 | 2020-06-20 | Dermatan sulfate lyase and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN111593040B (en) |
Families Citing this family (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN112251426B (en) * | 2020-10-18 | 2022-07-26 | 山东大学 | Chondroitin sulfate lyase, and coding gene and application thereof |
Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102277345A (en) * | 2011-08-22 | 2011-12-14 | 深圳市海普瑞药业股份有限公司 | Method for preparing chondroitinase B and chondroitinase AC from flavobacterium heparinum |
| CN103103173A (en) * | 2011-11-11 | 2013-05-15 | 清华大学 | Chondrosulphatase B fusion protein, and coding gene and construction method thereof |
| AU2016204464A1 (en) * | 2003-05-16 | 2016-07-21 | Acorda Therapeutics, Inc. | Proteoglycan degrading mutants for treatment of cns |
| CN105802875A (en) * | 2016-03-11 | 2016-07-27 | 中国海洋大学 | Bacterium and chondrosulphatase ABC generated by same |
Family Cites Families (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| ATE500842T1 (en) * | 2002-05-04 | 2011-03-15 | Acorda Therapeutics Inc | COMPOSITIONS AND METHODS FOR PROMOTING NEURONAL GROWTH |
| US6962699B2 (en) * | 2002-06-03 | 2005-11-08 | Massachusetts Institute Of Technology | Rationally designed polysaccharide lyases derived from chondroitinase B |
| ES2887949T3 (en) * | 2003-05-16 | 2021-12-29 | Acorda Therapeutics Inc | Proteoglycan-degrading mutants for CNS treatment |
| CA2558984A1 (en) * | 2004-03-10 | 2005-09-22 | Massachusetts Institute Of Technology | Recombinant chondroitinase abc i and uses thereof |
-
2020
- 2020-06-20 CN CN202010569652.2A patent/CN111593040B/en active Active
Patent Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| AU2016204464A1 (en) * | 2003-05-16 | 2016-07-21 | Acorda Therapeutics, Inc. | Proteoglycan degrading mutants for treatment of cns |
| CN102277345A (en) * | 2011-08-22 | 2011-12-14 | 深圳市海普瑞药业股份有限公司 | Method for preparing chondroitinase B and chondroitinase AC from flavobacterium heparinum |
| CN103103173A (en) * | 2011-11-11 | 2013-05-15 | 清华大学 | Chondrosulphatase B fusion protein, and coding gene and construction method thereof |
| CN105802875A (en) * | 2016-03-11 | 2016-07-27 | 中国海洋大学 | Bacterium and chondrosulphatase ABC generated by same |
Non-Patent Citations (9)
| Title |
|---|
| Biochemical Characterization of the Chondroitinase B Active Site;Kevin Pojasek et al.;《THE JOURNAL OF BIOLOGICAL CHEMISTRY》;20021231;第277卷(第34期);第31179–31186页 * |
| Isolation and Expression in Escherichia coli of cslA and cslB, Genes Coding for the Chondroitin Sulfate-Degrading Enzymes Chondroitinase AC and Chondroitinase B, Respectively, from Flavobacterium heparinum;A L Tkalec et al.;《APPLIED AND ENVIRONMENTAL MICROBIOLOGY》;20000131;第66卷(第1期);第29-35页 * |
| Liolios,K et al..Pseudopedobacter saltans DSM 12145 chromosome，complete genome，ACCESSION：CP002545.《Genbank》.2017,第1-3页. * |
| Pseudopedobacter saltans DSM 12145 chromosome，complete genome，ACCESSION：CP002545;Liolios,K et al.;《Genbank》;20170830;第2-3页注释部分 * |
| Recombinant Expression, Purification, and Kinetic Characterization of Chondroitinase AC and Chondroitinase B from Flavobacterium heparinum;Kevin Pojasek et al.;《THE JOURNAL OF BIOLOGICAL CHEMISTRY》;20011231;第286卷(第2期);第343-351页 * |
| uncultureed Bacteroides sp.isolated 2789STDY5834843 genome assembly，contig:SCcontig 000001，whole genome shotgun sequence，Acession：FMDY01000001;Genbank;《Genbank》;20160816;第1-2页注释部分 * |
| 微生物硫酸软骨素裂解酶的研究进展;蔡苏兰 等;《沈阳药科大学学报》;20040131;第21卷(第1期);第76-80页 * |
| 海洋来源硫酸软骨素降解酶的研究进展;王文爽等;《生命科学》;20190930;第31卷(第9期);第895页左栏第2段、第898页第2段 * |
| 硫酸软骨素裂解酶ABC的研究进展;李晔 等;《生物工程学报》;20150525;第31卷(第5期);第621-633页 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN111593040A (en) | 2020-08-28 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN107177612B (en) | Externally tangent type alginate lyase, gene and application thereof | |
| CN106811454B (en) | Truncated recombinant alginate lyase rAly1-T185N and coding gene and application thereof | |
| CN112251426B (en) | Chondroitin sulfate lyase, and coding gene and application thereof | |
| US11708567B2 (en) | Engineered aryl sulfate-dependent enzymes | |
| CN111593040B (en) | Dermatan sulfate lyase and application thereof | |
| CN114480350B (en) | Application of carrageenase in degrading kappa-carrageenan and furcellaran | |
| CN113755471A (en) | Chitosanase mutant and construction method and application thereof | |
| CN108531470B (en) | Fucoidin lyase TFLFM and preparation method and application thereof | |
| CN110511918B (en) | Alginate lyase system and application thereof | |
| CN109628426B (en) | Delta 4, 5-hexuronic acid-2-O-sulfatase, encoding gene and application thereof, and identification method of homologous enzyme | |
| CN110408566B (en) | Externally tangent chondroitin sulfate degrading enzyme and coding gene and application thereof | |
| CN107779443B (en) | Cellobiohydrolase mutants and uses thereof | |
| CA3233769A1 (en) | Mutated sulfotransferases and uses thereof | |
| CN110564747B (en) | Application of XylA gene with double functions of xylosidase and arabinofuranosidase | |
| CN111849949B (en) | Mannuronic acid C-5 epimerase/alginate lyase coding gene, enzyme, preparation and application | |
| CN113999830B (en) | Ocean-derived externally-tangent chondroitin sulfate sulfatase, and coding gene and application thereof | |
| CN114107248B (en) | Marine-derived endo-chondroitin sulfate sulfatase, and coding gene and application thereof | |
| US7217552B2 (en) | Sulfated fucogalactan digesting enzyme gene | |
| CN114616340A (en) | Process for the synthesis of anticoagulant polysaccharides | |
| CN113564139B (en) | Pasteurella heparin framework synthase BtHS1, mutant and application thereof | |
| CN113234709B (en) | Incision type alginate lyase and coding gene and application thereof | |
| CN110643586B (en) | Heparin skeleton synthase and coding gene and application thereof | |
| CN110982831B (en) | Application of gene AlgL23 with cold adaptability | |
| CN113136380B (en) | Broad-spectrum polysaccharide degrading enzyme rAly16-1 from streptomyces as well as coding gene and application thereof | |
| CN114958790B (en) | Heparin skeleton synthase, mutant and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |