CN111575411B - Blood-borne infection pathogen nucleic acid labeling kit and use method thereof - Google Patents

Abstract

The application relates to a blood-borne infectious pathogen nucleic acid labeling kit and a use method, wherein the nucleic acid labeling kit comprises a primer pair and a probe which are labeled with the 8 blood infectious disease nucleic acids. Also comprises a primer pair and a probe of hybridization control, positive control and negative control; and so on. The method adopts a fluorescent labeling mode to label the nucleic acid suspected of the 8 blood infectious diseases, and the displayed fluorescent labeling map can provide help for later analysis of medical experts. The application also solves the risk of patients who use blood for disease infection caused by blood transfusion in hospitals, ensures the safety of blood transfusion and blood products, and has obvious economic benefit and social benefit.

Description

Blood-borne infection pathogen nucleic acid labeling kit and use method thereof

Technical Field

The application belongs to the technical field of nucleic acid labeling kit contents, in particular to the technical field of nucleic acid labeling kit contents for blood-borne infection pathogens, and the result after fluorescent labeling can provide help for later-stage expert analysis.

Background

At present, the clinical diagnosis application of the international and domestic blood infectious disease gene marker kit is less. Blood borne diseases are infections through blood exchange, the four major common diseases being hepatitis b, hepatitis c, aids and dengue fever. The risk of infecting the above diseases is high, and because pathogens have a certain incubation period in human bodies and individual differences cause inconsistent symptoms caused by the existence and reproduction of pathogens in human bodies, the time spent for diagnosing the pathogens in hospitals after the human bodies are infected with the pathogens is long, and the patients cannot be treated with drugs in time. There is no public report on a gene chip for nucleic acid labeling of Hepatitis A Virus (HAV), Hepatitis B Virus (HBV), Hepatitis C Virus (HCV), Hepatitis D Virus (HDV), Hepatitis E Virus (HEV), Hepatitis G Virus (HGV), HIV and dengue fever (DV) pathogens on blood collected from a blood collection station in a blood bag. Therefore, a disease source marker capable of simultaneously marking the hepatitis A, B, E, G, Heptitis virus, AIDS virus and dengue fever within a period of time (4 hours) is developed, and the problem that the safety of blood transfusion and blood products is required to be solved is rapidly and efficiently solved.

Disclosure of Invention

The present application provides a solution to the above-mentioned problem and drawback. The technical problem to be solved by the project is to develop a gene chip capable of simultaneously and rapidly marking 8 pathogens of hepatitis A, B, E, G, Heheptitis, HIV and dengue fever.

The labeled product researched by the project exerts the high-throughput advantage of the gene chip, and can simultaneously label the pathogenic nucleic acids of Hepatitis A Virus (HAV), Hepatitis B Virus (HBV), Hepatitis C Virus (HCV), Hepatitis D Virus (HDV), Hepatitis E Virus (HEV), Hepatitis G Virus (HGV), HIV (HIV) and dengue fever (DV) in a clinical specimen by using the kit through the principles of gene amplification and molecular hybridization after one-time sampling. The project is technically innovative and practical.

The project develops and develops a gene chip labeling kit capable of labeling 8 joint tests of hepatitis A, hepatitis B, hepatitis C, hepatitis E virus and dengue fever infected in blood at the same time, and completes the manufacture of a gene chip by screening specific sequences of 8 pathogens and selecting an optimal probe sequence to label

The establishment of a quasi-marking method and a file system, the high-throughput nucleic acid marking technology represented by the formed gene chip and the gene chip in-vitro diagnostic reagent product are used for industrial development and application, a powerful tool is provided for blood source screening or clinical blood infectious disease monitoring, and the safety of clinical blood is improved.

The technical scheme is adopted for realizing the method.

A blood-borne infectious pathogen nucleic acid labeling kit, the nucleic acid labeling kit described herein comprising a primer pair for labeling HAV: HAV-FP-2-CY3, HAV-RP-2 and probes:

TTTTTTTTTTTTTTTAACAACTCACCAATATCCGCCGCTGTTACC, respectively; or

Primer pairs for labeling HBV: HBV endo-FP-CY 3-R, HBV exo-FP-R, HBV exo-RP-R, HBV endo-FP-R

And a probe: TTTTTTTTTTTTTTTCGAACCACTGAACAAATGG, respectively;

or a primer pair for labeling HCV: HCV-RP-2-CY3, HCV-FP-1, 2(1), HCV-FP-1, 2(2) and probes:

TTTTTTTTTTTTTTTGCCATAGTGGTCTGCGGAACCGGTGAGT；

or a primer pair for labeling HDV: HDV-FP-1.3-CY3, HDV-RP-3 and Probe:

TTTTTTTTTTTTTTTTAGAGAGATTTGTGGGTCCCATTCGCCATTA；

or a primer pair for labeling HEV: HEV-RP-2.3-CY3, HEV-FP-3 and probes:

TTTTTTTTTTTTTTTTCCCCTATATTCATCCAACCAACCCCTTTG；

or a primer pair for labeling HGV: HGV-FP-3-CY3, HGV-RP-3 and probes:

TTTTTTTTTTTTTTTCGCAGGCACAAGAGGAATCTTAACCTTCTC；

or primer pairs for labeling HIV: HIV-FP-1.2.3-CY3, HIV-RP-3 and probes:

TTTTTTTTTTTTTTTCTTCCTCATTGATGGTCTCTTTTAACATTTGC；

or a primer pair for labeling DV: DV-RP-cy3, DV-FP and probe:

TTTTTTTTTTCAGAGATCCTGCTGTCTCTACAGCAT。

further, the nucleic acid labeling kit described herein includes a positive control primer pair: IC-FP-1-cy3, IC-RP-1 and Probe: TTTTTTTTTTTTTTTGCTCATTGTAGAAGGTGTGGTGCCAGA are provided.

Further, the nucleic acid labeling kit described herein includes a hybridization control probe: TTTTTTTTTTTTTTTTTACTTCAGGGTGAGGATGCC are provided.

Further, the nucleic acid labeling kit described herein includes a negative control probe: TTTTTTTTTTTTTTT are provided. Further, the nucleic acid labeling kit PCR extension reaction system described in the present application: clinical templates or negative and positive quality control templates: 4.0 μ L, RT-PCR amplification reagent mix 12.5 μ L, RT-PCR amplification primer mix 7.5 μ L, RT-PCR enzyme mix 1 μ L, total volume 25.0 μ L.

Further, the PCR reaction parameters of the nucleic acid labeling kit described in the present application: 20min × 1cycle at 50 deg.C; 5min × 1cycle at 95 ℃; (94 ℃ 20s, 55 ℃ 30s, 65 ℃ 30s) x 35 cycles; 3min × 1cycle at 72 deg.C; storing at 12 deg.C.

Further, the nucleic acid labeling kit comprises a gene chip, wherein the gene chip is arranged to be rectangular, four repeats are arranged from left to right, the 1 st column and the last 1 st column are hybridization control sites, the 2 nd column is a positive control site, the 2 nd last column is a negative control site, and the rest sites are pre-labeled sample sites to be detected.

Further, the nucleic acid labeling kit comprises an eluent I and an eluent II; eluent I: preparing in a chip elution container according to the proportion of distilled water or purified water to 20 XSSC to 10 percent SDS to 100 to 5 to 1; eluent II: preparing in a chip elution container according to the proportion of distilled water or purified water to 20 XSSC to 10 percent SDS to 400 to 1 to 4; the eluent is used after hybridization of the gene chip, specifically, eluent I is used firstly, and shaking elution is carried out for 1 min; then using eluent II, shaking and eluting for 1 min; and after the elution is finished, naturally drying the chip or spin-drying the chip at a low speed.

The method for using the nucleic acid labeling kit is characterized by comprising the following steps:

(1) preparing instruments and consumables: preparing a constant-temperature heating table, a water bath constant-temperature oscillator, a glass slide rack and a glass slide elution container;

(2) preparing an eluent I and an eluent II;

(3) obtaining a nucleic acid sample or a suspected nucleic acid sample;

(4) PCR amplification and marking;

(5) and (3) hybridization: 5.1 heating the constant temperature heating table to 42 ℃, and fixing the chip by using a hybridization module preheated at 42 ℃;

5.2 adding 75 mu L of hybridization buffer solution into the amplification reaction tube, fully and uniformly mixing with the amplification product, dripping all the mixture into the corresponding microarray reaction chamber through the sample adding hole, and hybridizing for 30 min; the microarray area is prevented from being touched during operation, so that mixed liquid drops are prevented from falling on the surface of the hybridization module

(6) And (3) elution: preheating the eluent at 37 ℃ before elution, carefully taking the chip out of the hybridization module, and immediately putting the chip into an elution container to finish the elution process; eluting the eluent I for 1min by shaking; eluting the eluent II for 1min by shaking; after the elution is finished, the chip is naturally dried or spin-dried at low speed, and then scanning can be carried out;

(7) scanning: placing the dried chip in a laser scanner to complete laser scanning and obtain scanning data and a map; completing the nucleic acid labeling.

Further, in step 7 of the method of the present application, the laser scanning specifically includes: laser scanning was accomplished using a 532nm wavelength, 700 volt PMT voltage.

The primer pair and the probe of the technical method have extremely high specificity, and can well mark pathogens, so that the time spent on data analysis is saved, and data information marked by various virus nucleic acids is obtained in a shorter time. The method adopts a fluorescent labeling mode, can simultaneously label the nucleic acids of the suspected 8 pathogens, and the displayed fluorescent labeling map can provide help for later analysis of medical experts. The application also solves the risk of patients who use blood for disease infection caused by blood transfusion in hospitals, ensures the safety of blood transfusion and blood products, and has obvious economic benefit and social benefit.

The present application is further explained below with reference to the drawings and the detailed description.

Drawings

FIG. 1 is a diagram showing the arrangement of one of the structures of the gene chip of the present application.

FIG. 2 is a HAV signature of the present application.

FIG. 3 is a HBV marker map of the present application.

FIG. 4 is a HCV marker map of the present application.

FIG. 5 is a HDV signature of the present application.

Fig. 6 is an HEV tag map of the present application.

FIG. 7 is a HGV labeling scheme of the present application.

FIG. 8 is an HIV signature of the present application.

Fig. 9 is a DV label map of the present application.

FIG. 10 is a negative control marker map of the present application.

FIG. 11 is a graph of the total positive markers of the present application.

Detailed Description

A blood-borne infectious pathogen nucleic acid labeling kit, the nucleic acid labeling kit described herein comprising a primer pair for labeling HAV: HAV-FP-2-CY3, HAV-RP-2 and probes:

TTTTTTTTTTTTTTTAACAACTCACCAATATCCGCCGCTGTTACC, respectively; or

Primer pairs for labeling HBV: HBV endo-FP-CY 3-R, HBV exo-FP-R, HBV exo-RP-R, HBV endo-FP-R

And a probe: TTTTTTTTTTTTTTTCGAACCACTGAACAAATGG, respectively;

or a primer pair for labeling HCV: HCV-RP-2-CY3, HCV-FP-1, 2(1), HCV-FP-1, 2(2) and probes:

TTTTTTTTTTTTTTTGCCATAGTGGTCTGCGGAACCGGTGAGT；

or a primer pair for labeling HDV: HDV-FP-1.3-CY3, HDV-RP-3 and Probe:

TTTTTTTTTTTTTTTTAGAGAGATTTGTGGGTCCCATTCGCCATTA；

or a primer pair for labeling HEV: HEV-RP-2.3-CY3, HEV-FP-3 and probes:

TTTTTTTTTTTTTTTTCCCCTATATTCATCCAACCAACCCCTTTG；

or a primer pair for labeling HGV: HGV-FP-3-CY3, HGV-RP-3 and probes:

TTTTTTTTTTTTTTTCGCAGGCACAAGAGGAATCTTAACCTTCTC；

or primer pairs for labeling HIV: HIV-FP-1.2.3-CY3, HIV-RP-3 and probes:

TTTTTTTTTTTTTTTCTTCCTCATTGATGGTCTCTTTTAACATTTGC；

or a primer pair for labeling DV: DV-RP-cy3, DV-FP and probe:

TTTTTTTTTTCAGAGATCCTGCTGTCTCTACAGCAT。

further, the nucleic acid labeling kit described herein includes a positive control primer pair: IC-FP-1-cy3, IC-RP-1 and Probe: TTTTTTTTTTTTTTTGCTCATTGTAGAAGGTGTGGTGCCAGA are provided.

Further, the nucleic acid labeling kit described herein includes a hybridization control probe: TTTTTTTTTTTTTTTTTACTTCAGGGTGAGGATGCC are provided.

Further, the nucleic acid labeling kit described herein includes a negative control probe: TTTTTTTTTTTTTTT are provided. Further, the nucleic acid labeling kit PCR extension reaction system described in the present application: clinical templates or negative and positive quality control templates: 4.0 μ L, RT-PCR amplification reagent mix 12.5 μ L, RT-PCR amplification primer mix 7.5 μ L, RT-PCR enzyme mix 1 μ L, total volume 25.0 μ L.

Further, the PCR reaction parameters of the nucleic acid labeling kit described in the present application: 20min × 1cycle at 50 deg.C; 5min × 1cycle at 95 ℃; (94 ℃ 20s, 55 ℃ 30s, 65 ℃ 30s) x 35 cycles; 3min × 1cycle at 72 deg.C; storing at 12 deg.C.

Further, the nucleic acid labeling kit comprises a gene chip, wherein the gene chip is arranged to be rectangular, four repeats are arranged from left to right, the 1 st column and the last 1 st column are hybridization control sites, the 2 nd column is a positive control site, the 2 nd last column is a negative control site, and the rest sites are pre-labeled sample sites to be detected.

Further, the nucleic acid labeling kit comprises an eluent I and an eluent II; eluent I: preparing in a chip elution container according to the proportion of distilled water or purified water to 20 XSSC to 10 percent SDS to 100 to 5 to 1; eluent II: preparing in a chip elution container according to the proportion of distilled water or purified water to 20 XSSC to 10 percent SDS to 400 to 1 to 4; the eluent is used after hybridization of the gene chip, specifically, eluent I is used firstly, and shaking elution is carried out for 1 min; then using eluent II, shaking and eluting for 1 min; and after the elution is finished, naturally drying the chip or spin-drying the chip at a low speed.

The method for using the nucleic acid labeling kit is characterized by comprising the following steps:

(1) preparing instruments and consumables: preparing a constant-temperature heating table, a water bath constant-temperature oscillator, a glass slide rack and a glass slide elution container;

(2) preparing an eluent I and an eluent II;

(3) obtaining a nucleic acid sample or a suspected nucleic acid sample;

(4) PCR amplification and marking;

(5) and (3) hybridization: 5.1 heating the constant temperature heating table to 42 ℃, and fixing the chip by using a hybridization module preheated at 42 ℃;

5.2 adding 75 mu L of hybridization buffer solution into the amplification reaction tube, fully and uniformly mixing with the amplification product, dripping all the mixture into the corresponding microarray reaction chamber through the sample adding hole, and hybridizing for 30 min; the microarray area is prevented from being touched during operation, so that mixed liquid drops are prevented from falling on the surface of the hybridization module

(6) And (3) elution: preheating the eluent at 37 ℃ before elution, carefully taking the chip out of the hybridization module, and immediately putting the chip into an elution container to finish the elution process; eluting the eluent I for 1min by shaking; eluting the eluent II for 1min by shaking; after the elution is finished, the chip is naturally dried or spin-dried at low speed, and then scanning can be carried out;

(7) scanning: placing the dried chip in a laser scanner to complete laser scanning and obtain scanning data and a map; completing the nucleic acid labeling.

Further, in step 7 of the method of the present application, the laser scanning specifically includes: laser scanning was accomplished using a 532nm wavelength, 700 volt PMT voltage.

DNA sequences of 8 pathogens are obtained by searching a gene database, sequence comparison is carried out, DNA fragments with strong subtype conservation and specificity are searched, and primers are designed. Then, clinical samples were collected from the medical institutions, from which DNA fragments were obtained and subjected to clone sequencing.

DNA sequence listing of Table 18 pathogens

The performance of the PCR primers plays a decisive role in the PCR reaction. In a multiplex PCR amplification system, in order to improve the amplification homology, while keeping with the basic principle of primer design, similar annealing temperature and GC content need to be designed for each pair of primers, and the formation of secondary structures of the primers and dimers among the primers are reduced as much as possible, and the design general guiding principle is as follows:

A. the Tm of the primers should be 50-60 ℃ and the difference between Tm of the upstream primer and Tm of the downstream primer is not more than 2 ℃.

B. The GC content of the primer was around 50%.

C. The length of the primer is preferably 18-24nt, and the specificity and efficiency of amplification can be affected by the primer which is too long or too short.

D. The primer sequence avoids the 3' end ending with a.

E. Primer mismatching: the ambiguity of the 3 'end, i.e.the fact that the 3' end is not linked to three consecutive bases, should be avoided as much as possible, since even a single base mismatch at this position prevents primer extension and thus reduces the number of desired products.

Gc clamp: the inclusion of a G or C at the 3 'end of the primer increases the amplification efficiency of the primer, which promotes the proper binding of the 3' end of the primer to the template, since the GC clamp can form a more stable hydrogen bond.

G. The hairpin structure of the primer cannot be paired with 3 consecutive bases, which would otherwise limit the ability of the primer to bind to the site of interest.

H. In primer dimer, the pairing region should be avoided at the 3' end

Carrying out primer design screening, wherein the primer design parameters are set as the length of the primer to be 17-24 nt; tm 57 ± 3 ℃ with product lengths specified between 80 and 300 bp; and performing multiple PCR amplification verification on the primer pair to determine a multiple PCR amplification primer combination (shown in a table) suitable for the kit.

TABLE 2 primer sequence Listing

The probe design for labeling should satisfy the following conditions:

A. the length of the pathogen-labeled probe should be 27-35nt, and too long or too short will affect the specificity and hybridization efficiency.

B. The GC content of the probe is 30-60%, otherwise, the occurrence probability of nonspecific hybridization is increased.

C. The hybridization of the probe and the target molecule is influenced by the steric hindrance of the probe, and a 15nt Oligo dT linker can be connected to the 5' end of the probe to change the steric conformation. In addition, high-freedom covalent bonding of the probe and the substrate can be realized by introducing a chemical group (such as-NH 2) at the end of the probe, so that the hybridization kinetics are further improved, and the hybridization efficiency of the probe is remarkably improved.

D. No bases exceeding 4nt should form reverse complementary base pairs inside the probe base, otherwise, a hairpin structure is easily formed.

E. The same base is prevented from appearing repeatedly in the probe sequence, and is generally less than or equal to 4 nt. Since the probes are under the same hybridization conditions, different probes should have similar annealing temperatures.

F. Since the chip probes are reacted under the same hybridization conditions, different probes have similar annealing temperatures as much as possible.

And designing and screening the probe according to the design requirement.

NC in the product is a negative control probe, the sequence of the negative control probe is 15 continuous thymines (OligoT15), and the negative control probe is used for marking non-specific hybridization reaction which is possibly generated with a probe Linker sequence and monitoring the marking specificity of the kit.

HC is hybridization control probe, whose sequence is the reverse complementary sequence of the positive control (IC) labeled amplification primer, and is used to mark whether the chip hybridization system is normal.

IC is a sample extraction control and positive control probe, the sequence of which is a housekeeping gene beta-actin fragment in a human genome, and the probe is used for monitoring the quality of the sample and the effectiveness of a PCR amplification system.

The pathogen-labeled probes and control probes ultimately determined by the above study are shown in the table below.

TABLE 3 product Probe sequences

Preparation of Gene chip

According to the result analysis of the pre-experimental gene chip and clinical sample marking, 3 probe sequences are selected for each subtype to serve as marking target sites of 8 pathogen combined marking gene chips, 1 positive control site is simultaneously arranged, and each site is repeated for 4 times, so that the gene chip of 12 x 4 dot matrix is obtained.

Chip matrix design

(1) Matrix diagram design principle

According to the design and the requirements of the industry standard of "YYT 1153-2009 in vitro diagnosis DNA microarray chip", the designed chip matrix is shown in FIG. 1, and the design principle is as follows:

A. each labeled probe is designed with 4 repeated labeling sites to play a role in parallel experiments.

B. Hybridization control probe HC: the device is arranged at the left end and the right end of the matrix and is used for monitoring the stability of a chip hybridization system and simultaneously used for matrix positioning during chip scanning.

C. Spotting buffer BC: for adjusting the chip matrix structure.

D. Positive control probe IC: and the positive control and the specimen quality control are used for monitoring the effectiveness of the PCR amplification system and the specimen effectiveness.

E. Negative control probe NC: homology to Linker sequence of each probe was used to monitor chip hybridization specificity.

(2) Layout design principle of microarray on chip:

in order to improve the utilization rate of the substrate and improve the marking efficiency, 10 microarrays are designed for marking 10 independent specimens per substrate.

The specially designed hybridization module can effectively separate 10 microarray areas. Research proves that the sample adding pore of the hybridization module can effectively reduce the volatilization of the hybridization solution and ensure the normal operation of the hybridization reaction. The aluminum hybridization module has good heat conduction and heat retention performance, and can provide stable hybridization temperature for the microarray.

The silica gel sealing grid has reliable sealing performance, and no cross contamination between different microarrays in the hybridization process is ensured. The hybridization module can be cleaned independently after being used, so that the influence of residual PCR amplification-labeling products on subsequent experiments can be effectively eliminated, and the reliability of results is ensured.

Chip marking characteristics: specificity requires that there is no cross reaction between each site; the sensitivity requirement reaches 10³copies/ml。

Compared with clinical results obtained by implementing a fluorescent quantitative PCR method, the coincidence rate of the specificity and the sensitivity of the chip label is up to 98.7 percent.

To sum up: first, the innovation of the marking mode: the mode which can only repeatedly sample and mark for many times under the traditional condition is integrated and reduced into the high-efficiency mode of once-sampling comprehensive mark.

Second, breakthrough in specificity and accuracy: the specificity and the accuracy of the marking are improved to more than 95 percent.

Thirdly, breakthrough of parting: realizes accurate marking on the subtype level and leads the diagnosis and treatment to be more instructive. Fourth, breakthrough in sensitivity: the marking sensitivity reaches 10³copies/ml, can be marked during the infection window.

Fifth, breakthrough in cost control: the marking cost is saved by more than 50%.

The above description is only for the specific embodiment of the present application, and the common general knowledge of the known specific structure and characteristics in the scheme is not described herein too much. It should be noted that the above-mentioned embodiments do not limit the present application in any way, and all technical solutions obtained by means of equivalent substitution or equivalent transformation for those skilled in the art are within the protection scope of the present application. The scope of the claims of the present application shall be determined by the contents of the claims, and the description of the embodiments and the like in the specification shall be used to explain the contents of the claims.

<110> Kunming atlas-based biochip industries, Ltd

<120> blood-borne infection pathogen nucleic acid labeling kit and use method thereof

<160> 41

<210> 1

<211> 45

<212> DNA

<213> Artificial sequence

<400> 1

TTTTTTTTTTTTTTTAACAACTCACCAATATCCGCCGCTGTTACC

<210> 2

<211> 34

<212> DNA

<213> Artificial sequence

<400> 2

TTTTTTTTTTTTTTTCGAACCACTGAACAAATGG

<210> 3

<211> 43

<212> DNA

<213> Artificial sequence

<400> 3

TTTTTTTTTTTTTTTGCCATAGTGGTCTGCGGAACCGGTGAGT

<210> 4

<211> 46

<212> DNA

<213> Artificial sequence

<400> 4

TTTTTTTTTTTTTTTTAGAGAGATTTGTGGGTCCCATTCGCCATTA

<210> 5

<211> 45

<212> DNA

<213> Artificial sequence

<400> 5

TTTTTTTTTTTTTTTTCCCCTATATTCATCCAACCAACCCCTTTG

<210>6

<211> 45

<212> DNA

<213> Artificial sequence

<400> 6

TTTTTTTTTTTTTTTCGCAGGCACAAGAGGAATCTTAACCTTCTC

<210> 7

<211> 47

<212> DNA

<213> Artificial sequence

<400> 7

TTTTTTTTTTTTTTTCTTCCTCATTGATGGTCTCTTTTAACATTTGC

<210> 8

<211> 36

<212> DNA

<213> Artificial sequence

<400> 8

TTTTTTTTTTCAGAGATCCTGCTGTCTCTACAGCAT

<210> 9

<211> 42

<212> DNA

<213> Artificial sequence

<400> 9

TTTTTTTTTTTTTTTGCTCATTGTAGAAGGTGTGGTGCCAGA

<210>10

<211> 36

<212> DNA

<213> Artificial sequence

<400> 10

TTTTTTTTTTTTTTTTTACTTCAGGGTGAGGATGCC

<210> 11

<211> 15

<212> DNA

<213> Artificial sequence

<400> 11

TTTTTTTTTTTTTTT

<210>12

<211> 655

<212> DNA

<213> Artificial sequence

<400> 12

GTTTGCCTAGGCTATAGGCTAAATTTCCCTTTTCCCTTTCCCTTTATTGTTGTAAATATTAATTCCTGCAGGTTCAGGTTTCTTGGATTTGTTCCACTTTATGGACACTCATTTCACGCTTTCTGTCTGCTTTTCTTCCAGGGCTCTCCCCTTGCCCTAGGCTCTGGCCGTTGCGCCCGGCGGGGTCAACTCCATGATTAGCATGGAGCTGTAGGAGTCTAAATTGGGGACACAGATGTTGGGAACGTCACCTTGCAGTGTTAACTTGGCTTTCATGAAGCTTTTTGATCTTCCACAAGAGGTAGGCTACGGGTGAAACCTCTTAAGCTAATACTTCTATGAAGAGATGCTTTGGATAGGGTAACAGCGGCGGATATTGGTGAGTTATTTGACAAAAACCATTCAACGCCGGAGGACTGGCTCTCATCCAGTGGATGCATTAAGTGGATTGTCTGTCAGGGCTGTCTCTAGGTTTAATTCCTGACCTCTCTGTGCTTAGGGCAAACAAAACTTGGCCTTAAATGAGGTCCTGTGAGAGGGGACCTCGCCATTGAATGCTGGACATTTCTTTGGGGCCTTATGTTTTGTTTGCCTCTGAGGTACTCAGGGGCATTTAGGTTTTTCCTCATCAATAAATAATTATGAATATGTCCAG

<210> 13

<211> 887

<212> DNA

<213> Artificial sequence

<400> 13

CAACTTGTTGTCCTCCGATTTGTCCTGGTTATCGCTGGATGTGTCTGCGGCGTTTTATCATCTTCCTCTGCATCCTGCTGCTATGCCTCATCTTCTTGTTGGTTCTTCTGGACTATCAAGGTATGTTGCCCGTTTGTCCTCTAATTCCAGGATCATCAACCACCAGCACCGGACCATGCAAGACCTGCACGACTCCTGCTCAAGGAACCTCTATGTTTCCCTCATGTTGCTGTACAAAACCTACGGACGGAAACTGCACCTGTATTCCCATCCCATCATCCTGGGCTTTCGCAAAATACCTATGGGAGTGGGCCTCAGTCCGTTTCTCTTGGCTCAGTTTACTAGTGCCATTTGTTCAGTGGTTCGTAGGGCTTTCCCCCACTGTCTGGCTTTCAGTTATATGGATGATGTGGTTTTGGGGGCCAAGTCTGTACAACATCTTGAGTCCCTTTATGCCGCTGTTACCCATTTTCTTTTGTCTTTGGGTATACATTTAAACCCTCATAAAACAAAAAGATGGGGCTACTCCCTTAACTTCATGGGATATGTAATTGGAAGTTGGGGCACCTTACCCCAGGAACATATTGTGTTGAAAATCAAACAATGTTTTAGGAAACTTCCTGTAAATAGGCCTATTGATTGGAAGGTGTGTCAACGAATTGTGGGTCTTTTAGGATTTGCTGCTCCTTTCACACAATGTGGTTATCCTGCTTTAATGCCTTTATATGCATGTATACAAGCTAAACAGGCTTTTACTTTCTCGCCAACTTATAAGGCCTTTCTAAACAAACAATATCTGAACCTTTACCCCGTTGCGCGGCAACGGCCAGGTCTGTGCCAAGTGTTTGCTGACGCAACCCCCACTGGCTGGGGCTTGGCCATAGGCC

<210> 14

<211> 730

<212> DNA

<213> Artificial sequence

<400> 14

GCCAGCCCCCGATTGGGGGCGACACTCCACCATAGATCACTCCCCTGTGAGGAACTACTGTCTTCACGCAGAAAGCGTCTAGCCATGGCGTTAGTATGAGTGTCGTGCAGCCTCCAGGACCCCCCCTCCCGGGAGAGCCATAGTGGTCTGCGGAACCGGTGAGTACACCGGAATTGCCAGGACGACCGGGTCCTTTCTTGGATCAACCCGCTCAATGCCTGGAGATTTGGGCGTGCCCCCGCGAGACTGCTAGCCGAGTAGTGTTGGGTCGCGAAAGGCCTTGTGGTACTGCCTGATAGGGTGCTTGCGAGTGCCCCGGGAGGTCTCGTAGACCGTGCACCATGAGCACGAATCCTAAACCTCAAAGAAAAACCAAACGTAACACCAACCGCCGCCCACAGGACGTCAAGTTCCCGGGCGGTGGTCAGATCGTTGGCGGAGTTTACCTGTTGCCGCGCAGGGGCCCCAGGTTGGGCGTGCGCGCGACTAGGAAGACTTCCGAGCGGTCGCAACCTCGTGGAAGGCGACAACCTATCCCCAAGGCTCGCCATCCCGAGGGCAGGACCTGGGCTCAGCCTGGGTACCCTTGGCCCCTCTATGGCAATGAGGGCTTGGGGTGGGCAGGATGGCTCCTGTCACCCCGTGGCTCTCGGCCTAGTTGGGGCCCCACGGACCCCCGGCGTAGGTCGCGCAATTTGGGTAAGGTCATCGATACCCTCACGTGCGGCTT

<210> 15

<211> 604

<212> DNA

<213> Artificial sequence

<400> 15

CTGCAGGGTCCGCGTTCCATCCTTTCTTACCTGATGGCCGGCATGGTCCCAGCCTCCTCGCTGGCGCCGGCTGGGCAACATTCCGAGGGGACCGTCCCCTCGGTAATGGCGAATGGGACCCACAAATCTCTCTAGCTTCCCAGAGAGAAGCGAGAGAAAAGTGGCTCTCCCTTAGCCATCCGAGTGGACGTGCGTCCTCCTTCGGATGCCCAGGTCGGACCGCGAGGAGGTGGAGATGCCATGCCGACCCGAAGAGGAAAGAAGGACGCGAGACGCAAACCTGCGAGTGGAAACCCGCTTTATTCACTGGGGTCGACAACTCTGGGGAGAGGAGGGAGGGTCGGCTGGGAAGAGTATATCCTATGGGAATCCCTGGCTTCCCCTTATGTCCAGTCCCTCCCCGGTCCGAGTAAAGGGGGACTCCGGGACTCCTTGCATGCTGGGGACGAAGCCGCCCCCGGGCGCTCCCCTCGTTCCACCTTCGAGGGGGTTCACACCCCCAACCTGCGGGCCGGCTATTCTTCTTTCCCTTCTCTCGTCTTCCTCGGTCAACCTCCTAAGTTCCTCTTCCTCCTCCTTGCTGAGGTTCTTTCCCCCCGCCGAT

<210> 16

<211> 607

<212> DNA

<213> Artificial sequence

<400>16

ACTCGTTCATAACCTGATTGGCATGCTACAGGCTGTTGCTGATGGCAAGGCACATTTCACTGAGTCAGTAAAACCAGTGCTCGACTTGACAAATTCAATCTTGTGTCGGGTGGAATGAATAACATGTCTTTTGCTGCGCCCATGGGTTCGCGACCATGCGCCCTCGGCCTATTTTGTTGCTGCTCCTCATGTTTTTGCCTATGCTGCCCGCGCCACCGCCCGGTCAGCCGTCTGGCCGCCGTCGTGGGCGGCGCAGCGGCGGTTCCGGCGGTGGTTTCTGGGGTGACCGGGTTGATTCTCAGCCCTTCGCAATCCCCTATATTCATCCAACCAACCCCTTCGCCCCCGATGTCACCGCTGCGGCCGGGGCTGGACCTCGTGTTCGCCAACCCGCCCGACCACTCGGCTCCGCTTGGCGTGACCAGGCCCAGCGCCCCGCCGTTGCCTCACGTCGTAGACCTACCACAGCTGGGGCCGCGCCGCTAACCGCGGTCGCTCCGGCCCATGACACCCCGCCAGTGCCTGATGTCGACTCCCGCGGCGCCATCTTGCGCCGGCAGTATAACCTATCAACATCTCCCCTTACCTCTTCCGTGGCCACCGGCAC

<210> 17

<211> 531

<212> DNA

<213> Artificial sequence

<400> 17

AAGCCCCAGAAACCGACGCCTATCTAAGTAGACGCAATGACTCGGCGCCGACTCGGCGACCGGCCAAAAGGTGGTGGATGGGTGATGACAGGGTTGGTAGGTCGTAAATCCCGGTCATCCTGGTAGCCACTATAGGTGGGTCTTAAGAGAAGGTTAAGATTCCTCTTGTGCCTGCGGCGAGACCGCGCACGGTCCACAGGTGTTGGCCCTACCGGTGTGAATAAGGGCCCGACGTCAGGCTCGTCGTTAAACCGAGCCCGTTACCCACCTGGGCAAACGACGCCCACGTACGGTCCACGTCGCCCTTCAATGTCTCTCTTGACCAATAGGCTTAGCCGGCGAGTTGACAAGGACCAGTGGGGGCCGGGGGCTATGGAGATGGACTCCAAGTCCTGCCCTTCCCGGTGGGGCGGGAAATGCATGGGGCCACCCAGCTCCGCGGCGGCCTGCAGCCGGGGTAGCCCAAGAACCCTTCGGGTGAGGGCGGGTGGCATTTTTCTTTTCTATACCATCATGGCAGTCCTTCTGCTC

<210> 18

<211> 465

<212> DNA

<213> Artificial sequence

<400> 18

CAAAATTACCCTATAGTGCAGAACCTCCAGGGGCAAATGGTACATCAGGCCATATCACCTAGAACTTTAAATGCATGGGTAAAAGTAGTAGAAGAGAAGGCCTTCAGCCCAGAAGTAATACCCATGTTTTCAGCATTATCAGAAGGAGCCACCCCACAAGATTTAAACACCATGCTAAACACAGTGGGGGGACATCAAGCAGCCATGCAAATGTTAAAAGAGACCATCAATGAGGAAGCTGCAGAATGGGATAGATTGCATCCAGTGCATGCAGGGCCTATTGCACCAGGCCAGATGAGAGAACCAAGGGGAAGTGACATAGCAGGAACTACTAGTACCCTTCAGGAACAAATAGGATGGATGACAAATAATCCACCTATCCCAGTAGGAGAAATCTATAAAAGATGGATAATCCTGGGATTAAATAAAATAGTAAGAATGTATAGCCCTACCAGCATTCTGGAC

<210> 19

<211> 252

<212> DNA

<213> Artificial sequence

<400> 19

AAAACCTGGGAGGCTGCAACCCATGGAAGCTGTACGCATGGGGTAGCAGACTAGTGGTTAGAGGAGACCCCTCCCGAAACACAACGCAGCAGCGGGGCCCAACACCAGGGGAAGCTGTACCCTGGTGGTAAGGACTAGAGGTTAGAGGAGACCCCCCGCATAACAATAAACAGCATATTGACGCTGGGAGAGACCAGAGATCCTGCTGTCTCTACAGCATCATTCCAGGCACAGAACGCCAGAAAATGGAAT

<210> 20

<211>495

<212> DNA

<213> Artificial sequence

<400> 20

GTCGTCGACAACGGCTCCGGCATGTGCAAGGCCGGCTTCGCGGGCGACGATGCCCCCCGGGCCGTCTTCCCCTCCATCGTGGGGCGCCCCAGGCACCAGGGCGTGATGGTGGGCATGGGTCAGAAGGATTCCTATGTGGGCGACGAGGCCCAGAGCAAGAGAGGCATCCTCACCCTGAAGTACCCCATCGAGCACGGCATCGTCACCAACTGGGACGACATGGAGAAAATCTGGCACCACACCTTCTACAATGAGCTGCGTGTGGCTCCCGAGGAGCACCCCGTGCTGCTGACCGAGGCCCCCCTGAACCCCAAGGCCAACCGCGAGAAGATGACCCAGATCATGTTTGAGACCTTCAACACCCCAGCCATGTACGTTGCTATCCAGGCTGTGCTATCCCTGTACGCCTCTGGCCGTACCACTGGCATCGTGATGGACTCCGGTGACGGGGTCACCCACACTGTGCCCATCTACGAGGGGTATGCCCTCCCCCAT

<210> 21

<211> 20

<212> DNA

<213> Artificial sequence

<400> 21

CACAAGAGGTAGGCTACGGG

<210> 22

<211> 20

<212> DNA

<213> Artificial sequence

<400> 22

TGTATTCCCATCCCATCATC

<210> 23

<211> 21

<212> DNA

<213> Artificial sequence

<400> 23

CCCTATCAGGCAGTACCACAA

<210> 24

<211> 21

<212> DNA

<213> Artificial sequence

<400> 24

CGTTCCATCCTTTCTTACCTG

<210> 25

<211> 17

<212> DNA

<213> Artificial sequence

<400> 25

GCTGGGACTGGTCACGC

<210> 26

<211> 18

<212> DNA

<213> Artificial sequence

<400> 26

GGTGGTGGATGGGTGATG

<210> 27

<211> 18

<212> DNA

<213> Artificial sequence

<400> 27

AGAAGGAGCCACCCCACA

<210> 28

<211> 23

<212> DNA

<213> Artificial sequence

<400> 28

CCTGACAGACAATCCACTTAATG

<210> 29

<211> 18

<212> DNA

<213> Artificial sequence

<400> 29

TGTTGCTGTACAAAACCT

<210> 30

<211> 17

<212> DNA

<213> Artificial sequence

<400> 30

TCAGCAAACACTTGGCA

<210> 31

<211> 19

<212> DNA

<213> Artificial sequence

<400> 31

CCCARAAGMCCCACAATTC

<210> 32

<211> 21

<212> DNA

<213> Artificial sequence

<400> 32

GGCGACACTCCACCATAGATC

<210> 33

<211> 21

<212> DNA

<213> Artificial sequence

<400> 33

GGCGACACTCCACCATGAATC

<210> 34

<211> 19

<212> DNA

<213> Artificial sequence

<400> 34

CGTCCTTCTTTCCTCTTCG

<210> 35

<211> 18

<212> DNA

<213> Artificial sequence

<400> 35

CGGTGGTTTCTGGGGTGA

<210> 36

<211> 18

<212> DNA

<213> Artificial sequence

<400> 36

CGGTTTAACGACGAGCCT

<210> 37

<211> 20

<212> DNA

<213> Artificial sequence

<400> 37

TGTCACTTCCCCTTGGTTCT

<210> 38

<211> 19

<212> DNA

<213> Artificial sequence

<400> 38

GGCGTTCTGTGCCTGGAAT

<210> 39

<211> 21

<212> DNA

<213> Artificial sequence

<400> 39

GCATATTGACGCTGGGAGAGA

<210> 40

<211> 20

<212> DNA

<213> Artificial sequence

<400> 40

GGCATCCTCACCCTGAAGTA

<210> 41

<211> 20

<212> DNA

<213> Artificial sequence

<400> 41

GGGGTGTTGAAGGTCTCAAA

Claims (7)

1. A blood-borne infectious pathogen nucleic acid labeling kit, characterized in that said nucleic acid labeling kit comprises primer pairs for labeling HAV: HAV-FP-2-CY3, HAV-RP-2 and probes: TTTTTTTTTTTTTTTAACAACTCACCAATATCCGCCGCTGTTACC, respectively;

primer pairs for labeling HBV: HBV endo-FP-CY 3-R, HBV exo-FP-R, HBV exo-RP-R, HBV endo-FP-R with probes: TTTTTTTTTTTTTTTCGAACCACTGAACAAATGG, respectively;

primer pairs for labeling HCV: HCV-RP-2-CY3, HCV-FP-1-2(1), HCV-FP-1-2(2), and probes: TTTTTTTTTTTTTTTGCCATAGTGGTCTGCGGAACCGGTGAGT, respectively;

primer pairs for labeling HDV: HDV-FP-1.3-CY3, HDV-RP-3 and Probe: TTTTTTTTTTTTTTTTAGAGAGATTTGTGGGTCCCATTCGCCATTA, respectively;

primer pair for labeling HEV: HEV-RP-2.3-CY3, HEV-FP-3 and probes: TTTTTTTTTTTTTTTTCCCCTATATTCATCCAACCAACCCCTTTG, respectively;

primer pair for labeling HGV: HGV-FP-3-CY3, HGV-RP-3 and probes: TTTTTTTTTTTTTTTCGCAGGCACAAGAGGAATCTTAACCTTCTC, respectively;

primer pairs for labeling HIV: HIV-FP-1.2.3-CY3, HIV-RP-3 and probes: TTTTTTTTTTTTTTTCTTCCTCATTGATGGTCTCTTTTAACATTTGC, respectively;

primer pairs for labeling DV: DV-RP-CY3, DV-FP and Probe: TTTTTTTTTTCAGAGATCCTGCTGTCTCTACAGCAT, respectively;

primer pair for positive control: IC-FP-1-CY3, IC-RP-1 and Probe: TTTTTTTTTTTTTTTGCTCATTGTAGAAGGTGTGGTGCCAGA, respectively;

hybridization control probe: TTTTTTTTTTTTTTTTTACTTCAGGGTGAGGATGCC, respectively;

negative control probe: TTTTTTTTTTTTTTT, respectively;

the name and the sequence (5 '-3') of the primer are as follows:

HAV-FP-2-CY3：CACAAGAGGTAGGCTACGGG

HBV endo-FP-CY 3-R: TGTATTCCCATCCCATCATC

HCV-RP-2-CY3：CCCTATCAGGCAGTACCACAA

HDV-FP-1.3-CY3：CGTTCCATCCTTTCTTACCTG

HEV-RP-2.3-CY3：GCTGGGACTGGTCACGC

HGV-FP-3-CY3：GGTGGTGGATGGGTGATG

HIV-FP-1.2.3-CY3：AGAAGGAGCCACCCCACA

HAV-RP-2：CCTGACAGACAATCCACTTAATG

HBV exo-FP-R: TGTTGCTGTACAAAACCT

HBV exo-RP-R: TCAGCAAACACTTGGCA

HBV endo-FP-R: CCCARAAGMCCCACAATTC

HCV-FP-1-2(1)：GGCGACACTCCACCATAGATC

HCV-FP-1-2(2)：GGCGACACTCCACCATGAATC

HDV-RP-3：CGTCCTTCTTTCCTCTTCG

HEV-FP-3：CGGTGGTTTCTGGGGTGA

HGV-RP-3：CGGTTTAACGACGAGCCT

HIV-RP-3：TGTCACTTCCCCTTGGTTCT

DV-RP-CY3：GGCGTTCTGTGCCTGGAAT

DV-FP：GCATATTGACGCTGGGAGAGA

IC-FP-1-CY3：GGCATCCTCACCCTGAAGTA

IC-RP-1：GGGGTGTTGAAGGTCTCAAA。

2. The blood borne infectious pathogen nucleic acid labeling kit of claim 1, wherein the nucleic acid labeling kit PCR extension reaction system: clinical template or negative and positive quality control template 4.0 u L, RT-PCR amplification reagent mixture 12.5 u L, RT-PCR amplification primer mixture 7.5 u L, RT-PCR enzyme mixture 1 u L, total volume 25.0 u L.

3. The kit for labeling the nucleic acid of a blood-borne infectious pathogen according to claim 1, wherein the PCR reaction parameters of the kit for labeling the nucleic acid are as follows: 20min × 1cycle at 50 deg.C; 5min × 1cycle at 95 ℃; (94 ℃ 20s, 55 ℃ 30s, 65 ℃ 30s) x 35 cycles; 3min × 1cycle at 72 deg.C; storing at 12 deg.C.

4. The kit for labeling the nucleic acid of a blood-borne infectious pathogen according to claim 1, wherein the kit for labeling the nucleic acid comprises a gene chip, wherein the gene chip is rectangular and is provided with four repeats from top to bottom; the 1 st column and the last 1 st column are hybridization control sites, the 2 nd column is a positive control site, the 2 nd last column is a negative control site, and the rest sites are set as pre-marked sample sites to be detected.

5. The blood borne infectious pathogen nucleic acid labeling kit of claim 1, wherein said nucleic acid labeling kit comprises eluent I and eluent II; the eluent I is prepared in a chip elution container according to the proportion of distilled water or purified water to 20 XSSC to 10 percent SDS =100 to 5 to 1; the eluent II is prepared in a chip elution container according to the proportion of distilled water or purified water to 20 XSSC to 10 percent SDS =400 to 1 to 4; the eluent is used after hybridization of the gene chip, specifically, eluent I is used firstly, and shaking elution is carried out for 1 min; then using eluent II, shaking and eluting for 1 min; and after the elution is finished, naturally drying the chip or spin-drying the chip at a low speed.

6. The method of using the nucleic acid labeling kit of any of claims 1-5 for non-diagnostic purposes, comprising the steps of:

(1) preparing instruments and consumables: preparing a constant-temperature heating table, a water bath constant-temperature oscillator, a glass slide rack and a glass slide elution container;

(2) preparing an eluent I and an eluent II;

(3) obtaining a nucleic acid sample or a suspected nucleic acid sample;

(4) PCR amplification and marking;

(5) and (3) hybridization:

(5.1) heating the constant-temperature heating table to 42 ℃, and fixing the chip by using a hybridization module preheated at 42 ℃;

(5.2) adding 75 mu L of hybridization buffer solution into an amplification reaction tube, fully and uniformly mixing with an amplification product, dropwise adding all the mixture into a corresponding microarray reaction chamber from a sample adding hole, and hybridizing for 30 min; in the operation process, the microarray area is prevented from being touched, so that mixed liquid drops are prevented from falling on the surface of the hybridization module;

(6) and (3) elution: preheating the eluent at 37 ℃ before elution, carefully taking the chip out of the hybridization module, and immediately putting the chip into an elution container to finish the elution process; eluting the eluent I for 1min by shaking; eluting the eluent II for 1min by shaking; after the elution is finished, the chip is naturally dried or spin-dried at low speed, and then scanning can be carried out;

(7) scanning: placing the dried chip in a laser scanner to complete laser scanning and obtain scanning data and a map; completing the nucleic acid labeling.

7. The method according to claim 6, characterized in that the method step (7) laser scanning is embodied as: laser scanning was accomplished using a 532nm wavelength, 700 volt PMT voltage.

Images