CN111560431A

CN111560431A - Composition of healthy epigenomics and application thereof

Info

Publication number: CN111560431A
Application number: CN201910999215.1A
Authority: CN
Inventors: 韩晓亮; 王建铭; 周光朋; 吴振
Original assignee: Biochain Beijing Science and Technology Inc
Current assignee: Biochain Beijing Science and Technology Inc
Priority date: 2019-02-14
Filing date: 2019-10-21
Publication date: 2020-08-21
Anticipated expiration: 2039-10-21
Also published as: CN116064815A; CN115786517A; CN111560431B

Abstract

The invention relates to a kit for detecting epigenetic variation, namely Septin9 gene methylation, which comprises PCR reaction liquid and polymerase, wherein the PCR reaction liquid consists of dNTP, primers, probes and a solvent, the invention also provides an application for detecting methylation in Septin9 gene.

Description

Composition of healthy epigenomics and application thereof

Technical Field

The invention relates to the technical field of biomedicine, in particular to a kit for detecting epigenetic variation, namely Septin9 gene methylation, a detection method thereof and application thereof in screening of cancer risk of a digestive tract, precancerous lesion of the digestive tract and precancerous disease of the digestive tract.

Background

Esophageal cancer is malignant tumor originated from esophageal mucosal epithelium, is one of the clinically common malignant tumors, and has 8 th-grade incidence and 6 th-grade mortality in malignant tumor worldwide. China is one of the countries with the highest incidence of esophageal cancer, more than 22 ten thousand new cases of esophageal cancer occur every year, and about 20 ten thousand deaths occur. Improving the diagnosis and treatment level of esophageal cancer in China is a difficult and urgent medical research problem. At present, over 90% of patients with esophageal cancer have progressed to the middle and late stages when diagnosed, the quality of life is low, and the overall 5-year survival rate is less than 20%. The early esophageal cancer only affecting the mucosa layer and the superficial layer under the mucosa can be radically cured by endoscopic minimally invasive treatment, the curative effect equivalent to that of a surgical operation is achieved, the advantages of small wound, less pain and quick recovery are achieved, and the 5-year survival rate of a patient can exceed 95%. Outline of Chinese cancer prevention and control planning (2004-2010) clearly indicates that early detection, early diagnosis and early treatment of cancer are the main strategies to reduce mortality and increase survival. The endoscopic early treatment is carried out on the basis of improving the detection rate and the diagnosis rate of early lesions, and the method is an effective way for improving the prognosis of esophageal cancer patients, saving national medical resources and lightening family and social burdens. In the consensus of experts in early esophageal cancer screening and endoscopic diagnosis and treatment in china (2014, beijing), chronic esophagitis, Barrett's esophagus, esophageal leukoplakia, esophageal diverticulum, cardiac achalasia, reflux esophagitis, benign stricture of esophagus caused by various reasons and the like are benign diseases related to esophageal cancer and having a certain cancer rate, and are collectively called precancerous diseases (precancerous diseases). There is therefore a need for early detection and intervention of the above mentioned precancerous conditions in addition to early detection of esophageal cancer.

Gastric cancer (Gastric Carcinoma) refers to a malignant tumor of epithelial origin that originates in the stomach. The incidence of gastric cancer is second to that of lung cancer in China, and the mortality rate is third. About 120 million new cases of stomach cancer occur every year in the world, and China accounts for about 40 percent of the cases. The early gastric cancer accounts for a very low percentage of only about 20 percent in China, most of the gastric cancers are developed, and the overall 5-year survival rate is less than 50 percent. Early stage gastric cancer patients often have no specific symptoms, and symptoms like gastritis and ulcer can appear along with the progress of the disease, and mainly comprise: 1) epigastric fullness with discomfort or dull pain, which is heavy after meals; 2) anorexia, belching, acid regurgitation, nausea, vomiting, dark stool, etc. In addition to the above symptoms, advanced gastric cancer often occurs: 1) weight loss, anemia, weakness; 2) gastric pain, if the pain continues to worsen and radiate to the back and back of the waist, suggests the possible presence of an invasion of the pancreatic and celiac plexus, and once the stomach cancer is perforated, gastric perforation symptoms of severe abdominal pain can occur; 3) nausea and vomiting are often caused by obstruction caused by tumors or gastric dysfunction, cardia cancer can have progressively aggravated dysphagia and reflux symptoms, and antral carcinoma can vomit food when pyloric obstruction is caused; 4) bleeding and black stool, tumor invasion on blood vessels can cause gastrointestinal hemorrhage, stool occult blood positive in small amount of bleeding, and hematemesis and black stool can be shown in large amount of bleeding; 5) other symptoms such as diarrhea (caused by achlorhydria and accelerated gastric emptying in patients), symptoms of metastases, etc. Advanced patients may develop severe wasting, anemia, edema, fever, jaundice, and cachexia. Although the symptoms of gastric cancer are very similar to other stomach diseases, the occurrence process of gastric cancer is generally considered to be subjected to superficial gastritis, atrophic gastritis, intestinal metaplasia, low-grade intratumoral lesion, high-grade intratumoral lesion and gastric cancer in 6 stages clinically, so that early discovery and intervention of precancerous diseases (such as atrophic gastritis and intestinal metaplasia) are particularly important for preventing gastric cancer. At present, the commonly used effective detection method for stomach diseases almost completely depends on gastroscopy, but the compliance of the gastroscopy is low, and China is a stomach cancer country, and the number of gastroscopy resources and clinical technicians cannot meet the requirement, so an effective screening method is still needed.

Colorectal cancer is a common malignancy, occurring in about 90 million people worldwide each year, and one of the most common digestive tract malignancies. Large intestinal malignancies originate in the mucosal epithelium or submucosal mesenchymal tissue. Among them, malignant tumors that occur from the large intestine mucosal epithelium under the action of various carcinogenic factors such as environment and heredity are collectively called large intestine cancer. The colon cancer is a general name of colon cancer and rectal cancer, namely colon cancer and colorectal cancer. The colorectal cancer is a malignant tumor seriously threatening the life health of human beings, and epidemiological survey data in the world indicate that the incidence rate of the colorectal cancer in various malignant tumors is 3 rd, the colorectal cancer is a common digestive tract malignant tumor and accounts for 2 nd of gastrointestinal tract tumors. The incidence of colorectal cancer is second only to gastric and esophageal cancer. Early colorectal cancer may have no obvious symptoms, and the following symptoms may appear after the condition develops to a certain extent: altered bowel habits, altered stool characteristics (e.g., thinning, bloody stools, mucous stools, etc.), abdominal pain or discomfort, abdominal mass, symptoms associated with ileus, anemia, and general symptoms (e.g., wasting, debilitation, low grade fever, etc.). Colorectal cancer onset may be associated with the following diseases: ulcerative colitis, large intestine polyposis, large intestine adenoma, Crohn's disease, schistosomiasis, etc., the patient should be asked for their history of the relevant disease in detail. Therefore, in addition to improving the early diagnosis rate of early colorectal cancer, the early detection of other intestinal diseases, especially polyps and adenomas, plays an important role in the prevention of colorectal cancer. The data show that the risk of intestinal cancer can be reduced by 30% within 17 years by one-time enteroscope, and although polyp, adenoma and colorectal cancer can be found in early stage by the enteroscope, the clinical compliance is relatively low because of the invasiveness of the enteroscope, so that the enteroscope cannot be widely popularized in clinic at present and can be used for screening colorectal cancer and precancerous diseases. Therefore, a simple, highly sensitive and highly compliant kit for early detection of colorectal precancerous diseases is urgently needed in the market.

Primary liver cancer is one of the three major tumor causes of death worldwide, and about 54.86 thousands of people die of liver cancer in 2000. The prognosis of primary liver cancer is poor, and the average survival time is less than 6 months from diagnosis. Thus, mortality and incidence were similar. China is a high-incidence country of liver cancer and accounts for more than 50% of liver cancer all over the world. Since the 90 s of the 20 th century, liver cancer is the second highest in our national tumor mortality, and currently about 80% of our country's liver cancer is associated with chronic infection with Hepatitis B Virus (HBV). In areas with high incidence of liver cancer, most HBV infected patients begin at perinatal or childhood stage. The safe and effective hepatitis B vaccine appears and is inoculated in newborns regularly, and the liver cancer onset caused by HBV can be obviously reduced after thirty-four years. In recent years, the relationship between Hepatitis C Virus (HCV) infection and liver cancer has been widely regarded, and effective measures for controlling HCV infection and preventing liver cancer are not available. And the secondary prevention of the liver cancer, namely the liver cancer, can be expected to reduce the mortality of the liver cancer through screening, early detection, early diagnosis and early treatment of the liver cancer. The primary liver cancer diagnosis and treatment standard (2017), which indicates screening of high risk group of liver cancer, is helpful for early detection, early diagnosis and early treatment, and is the key to improve the curative effect of liver cancer. In China, the high risk group of liver cancer mainly comprises: people with Hepatitis B Virus (HBV) and/or Hepatitis C Virus (HCV) infection, long-term alcohol abuse, nonalcoholic steatohepatitis, food contaminated with aflatoxin, cirrhosis of the liver due to various causes, a family history of liver cancer, and the like, particularly men over the age of 40, are at greater risk. Therefore, if a simpler method is available for detecting liver cirrhosis in addition to B-ultrasound, it is more helpful for early prevention of liver cancer.

Pancreatic cancer is a malignant tumor of the digestive tract that is highly malignant and difficult to detect and treat. The incidence rate of pancreatic cancer in China is 7.28 cases/10⁵Human, mortality was 6.61 cases/10⁵A human. The five-year survival rate of pancreatic cancer patients is only 5%, which can be referred to as "absolute" in cancer. In addition, new cases of pancreatic cancer increase year by year: new cases of pancreatic cancer in China are increased by more than 30% during the period of 2003-2009. An important factor that leads to high mortality and low cure rate of pancreatic cancer is that the diagnosis rate of early pancreatic cancer is significantly lower than that of other cancers. The vast majority of patients do lack distinct, specific symptoms due to early pancreatic cancerWhen the cancer comes into the advanced stage at the time of diagnosis, most of the focus is transferred, and the treatment cannot be carried out by adopting a curative method. Recent clinical studies have shown that opportunities for curing pancreatic cancer still exist: since the process from the beginning of the pancreatic cancer lesion to the clinical symptoms of the patient is required to be 2-3 years on average, an effective window period is provided for the discovery of early pancreatic cancer and the improvement of the diagnosis rate of early pancreatic cancer; the window period is fully utilized, the treatment effect of pancreatic cancer is expected to be improved, and the death rate of pancreatic cancer is reduced. The high risk factors of pancreatic cancer include smoking, obesity, alcoholism, chronic pancreatitis and the like, and the risk of suffering from pancreatic cancer is obviously increased when patients are exposed to the naphthylamine and benzene compounds. Diabetes is one of the risk factors of pancreatic cancer, especially in the elderly, patients with low body mass index and no family history of diabetes, and when new type II diabetes is developed, follow-up and vigilance should be taken to the possibility of pancreatic cancer. Meanwhile, pancreatic cancer has genetic susceptibility, about 10 percent of pancreatic cancer patients have genetic background, and the risk of pancreatic cancer is obviously increased for patients suffering from hereditary pancreatitis, Peutz-Jeghers syndrome, familial malignant melanoma and other hereditary tumor diseases. Therefore, prevention of pancreatic cancer should also achieve early detection and intervention of the above-mentioned diseases at an early stage.

In summary, although imaging and endoscopy are one of the effective methods for screening cancer and precancerous lesions and precancerous diseases, they are still not suitable for national screening because of low compliance and limited domestic resources and professional technicians. Therefore, compared with imaging and endoscopy, the detection method with higher compliance and high sensitivity is an effective method for solving the problems of advanced prevention and early intervention of the precancerous lesion and precancerous disease of the digestive tract at present.

DNA methylation is an important research content in epigenetics, plays an important role in maintaining normal cell function, genetic imprinting, embryonic development and human tumorigenesis, and is one of the current new research hotspots. Changes in DNA methylation status are an important factor in tumorigenesis, and include a decrease in global genomic methylation levels and an abnormally increased local methylation levels of CpG islands, resulting in genomic instability and thus the induction of cellular carcinogenesis. The nature of DNA methylation is: when an abnormal event occurs in the cell, the expression of DNA methyltransferase increases, so that the hydrogen atom attached to the fifth carbon atom of cytosine in DNA is replaced with a methyl group (as shown in FIG. 2). After the conformation of the DNA is changed, RNA polymerase cannot pass through the methylated DNA region, resulting in the failure to express genes downstream of methylation, finally causing the disorder of cell function and the development of tumor. It was found that DNA methylation occurs in the precancerous stage of the disease, and with the increasing level of methylation, the disease progresses and finally becomes cancer (as shown in FIG. 3).

Variations occur more frequently at the epigenetic level than genetic mutations, and thus the use of epigenetic variations to diagnose precancerous disease has greater sensitivity and better specificity than detection at the level of genetic mutations.

The Septin9 gene as biomarker is based on the methylation state of a specific DNA sequence in the promoter region of Septin9 gene. Septin9 is a member of Septin gene family, which has at least 13 genes, and encodes conserved guanosine triphosphatase (GTPase) structure domain, and can be combined with cytoskeleton related proteins, and the proteins are related to tumorigenesis. The main functions of the Septin gene family protein are cytokinesis, membrane vesicle transport, membrane fusion, extracellular secretion and apoptosis.

Until now, the research reports of Septin9 are limited to the detection of esophageal cancer, gastric cancer, colorectal cancer, liver cancer and pancreatic cancer, and no report is available for the detection of cancer risk, precancerous lesion and precancerous disease of esophageal cancer, gastric cancer, colorectal cancer, liver cancer and pancreatic cancer.

Disclosure of Invention

The present invention relates to a genetic composition for detecting the risk of cancer of the digestive tract, precancerous lesions of the digestive tract and precancerous diseases in an individual by detecting the degree of DNA methylation, a kit and use thereof, and a method for performing detection based on the kit.

Specifically, the present invention relates to the following:

1. a composition for screening the digestive tract for risk of cancer, digestive tract precancerous lesions, and digestive tract precancerous conditions, the composition comprising a nucleic acid sequence for detecting the degree of methylation within at least one target region of the Septin9 gene;

wherein the target regions are selected from SEQ ID No.: 13 or SEQ ID No.: 14, the length of the fragment is more than 60bp, preferably 60-90 bp;

the nucleic acid sequence is identical, complementary or hybridised to the target region; preferably, the nucleic acid sequence hybridizes to the target region under moderately stringent or stringent conditions.

2. The composition of claim 1, wherein the nucleic acid sequences are primers and probes, wherein the primers and probes have the following characteristics: the target region that is methylated can be amplified, while the target region that is unmethylated cannot be amplified.

3. The composition according to item 2, characterized in that,

the length of the primer is more than 15bp, preferably 18-24 bp; and

the length of the probe is more than 15bp, preferably 18-30 bp.

4. The composition according to

item

2 or 3, wherein the primer and probe for detecting Septin9 gene are any one or more of

compositions

1, 2, 3 and 4;

composition 1:

forward primer SEQ ID No. 1: 5'-TGTTTGTTAGTCGCGTGCG-3'

Reverse primer SEQ ID No. 2: 5'-AAATTCTCTATCACCGCCGC-3'

Probe SEQ ID No. 3: 5'-CGCGCGCTCTACGCCTACAA-3', respectively;

composition 2:

forward primer SEQ ID No. 4: 5'-GTCGCGTTTTTCGTCGTT-3'

Reverse primer SEQ ID No. 5: 5'-CTAAACACACGACCGAAACG-3'

Probe SEQ ID No. 6: 5'-CCCGCCTAACCCGCGCCC-3', respectively;

composition 3:

forward primer SEQ ID No. 7: 5'-CGGGCGGAGTAGTTAGTGC-3'

Reverse primer SEQ ID No. 8: 5'-CTCCCGAACGAATCAAATTCC-3'

Probe SEQ ID No. 9: 5'-CGCACCCGCACCGACCTCC-3', respectively; and

composition 4:

forward primer SEQ ID No. 10: 5'-TTCGTTGAGAGCGTCGCG-3'

Reverse primer SEQ ID No. 11: 5'-GCGCAAAATCTACGCGAATAC-3'

Probe SEQ ID No. 12: 5'-CCCACGTAAACGACGCGAACACG-3' are provided.

5. A kit for screening the digestive tract for risk of cancer, digestive tract precancerous lesions, and digestive tract precancerous conditions, comprising the composition of any one of claims 1 to 4.

6. The kit according to claim 5, wherein the precancerous lesions and precancerous diseases of the digestive tract are one or more of precancerous lesions and precancerous diseases of esophageal cancer, gastric cancer, intestinal cancer, liver cancer and pancreatic cancer.

7. The kit of claim 6, wherein the esophageal precancerous lesions and precancerous conditions include: chronic esophagitis, Barrett's esophagus, leukoplakia of the esophagus, diverticulum of the esophagus, achalasia of the cardia, reflux esophagitis.

8. The kit of item 6, wherein the gastric cancer precancerous lesions and precancerous diseases include: atrophic gastritis, polyp, gastric ulcer, xanthoma, intestinal metaplasia.

9. The kit according to item 6, wherein the precancerous lesions and precancerous diseases of the intestinal cancer include: ulcerative colitis, large intestine polyposis, large intestine adenoma, Crohn's disease.

10. The kit of claim 6, wherein the liver precancerous lesions and precancerous conditions include: cirrhosis of the liver.

11. The kit of item 6, wherein the pancreatic cancer precancerous lesions and precancerous diseases comprise: myxomatous cystadenoma, pancreatitis, pseudocyst, insulinoma.

12. A method for detecting a kit according to any one of items 5 to 11, comprising the steps of:

a) collecting a human source sample;

b) extracting free DNA from the human sample;

c) converting the DNA with bisulfite;

d) carrying out PCR reaction;

f) and (3) carrying out result interpretation on the products of the PCR reaction.

13. The method of claim 12, wherein the human sample is selected from one or more of a cell line, a tissue section, a biopsy, a paraffin-embedded tissue, a bodily fluid, stool, colonic exudate, urine, plasma, serum, whole blood, isolated blood cells, cells isolated from blood.

14. The method of claim 12, wherein the human sample is venous blood and plasma drawn from a vein.

15. Use of a composition according to any one of claims 1 to 4 in the preparation of a kit for screening the digestive tract for risk of cancer, digestive tract precancerous lesions and digestive tract precancerous conditions.

16. The use of claim 15, wherein the precancerous lesions and precancerous diseases are one or more of esophageal cancer, gastric cancer, intestinal cancer, liver cancer and pancreatic cancer.

17. Use according to item 16, wherein the esophageal precancerous lesions and precancerous conditions include: chronic esophagitis, Barrett's esophagus, leukoplakia of the esophagus, diverticulum of the esophagus, achalasia of the cardia, reflux esophagitis.

18. The use according to item 16, wherein the gastric cancer precancerous lesions and precancerous diseases include: atrophic gastritis, polyp, gastric ulcer, xanthoma, intestinal metaplasia.

19. The use according to claim 16, wherein the precancerous lesions and precancerous diseases of the intestinal cancer include: ulcerative colitis, large intestine polyposis, large intestine adenoma, Crohn's disease.

20. The use according to item 16, wherein said liver precancerous lesions and precancerous conditions include: cirrhosis of the liver.

21. The use according to item 16, wherein the pancreatic cancer precancerous lesions and precancerous diseases comprise: myxomatous cystadenoma, pancreatitis, pseudocyst, insulinoma.

It is to be understood that within the scope of the present invention, the above-described technical features of the present invention and those described in detail below may be combined with each other to constitute new or preferred technical solutions.

Effects of the invention

Although imaging and endoscopy are one of the effective methods for screening the digestive tract precancerous diseases at present, the compliance is low, and the number of domestic medical resources and professional technicians is limited, so that the method cannot meet the requirement of large-scale population at present. The traditional tumor marker is a cancer screening method which is used mostly except for imaging and endoscope at present, but the detection rate of early cancer is about 10-20% generally, and the detection rate of precancerous lesion and precancerous disease is lower. Therefore, there is a need to develop a highly efficient, sensitive, simple and highly compliant detection method for early screening of the risk of cancer in the digestive tract, precancerous lesions in the digestive tract and precancerous conditions in the digestive tract, relative to imaging, endoscopy and conventional tumor markers.

The invention utilizes the characteristics that the detection of the digestive tract cancer risk, the digestive tract precancerous lesion and the digestive tract precancerous disease at the epigenetic variation level has higher sensitivity and better specificity than the detection at the gene mutation level to develop a method for detecting the digestive tract cancer risk, the digestive tract precancerous lesion and the digestive tract precancerous disease by detecting Septin9 gene methylation, and a corresponding composition, a kit and a nucleic acid sequence, thereby diagnosing and detecting the risk of the cancer of the digestive tract, the precancerous lesion of the digestive tract and the precancerous disease of the digestive tract in a non-invasive way, efficiently and sensitively at an early stage, greatly improving the detection rate of the risk of the cancer of the digestive tract, the precancerous lesion of the digestive tract and the precancerous disease of the digestive tract, the auxiliary detection method is a very effective supplementary auxiliary detection means for people who exclude endoscope and imaging examination or cannot perform endoscope and imaging examination due to special reasons.

Drawings

FIG. 1 shows the detection of Septin9 using methylated DNA and unmethylated as templates, the effect of amplification.

FIG. 2 shows methylation of CpG islands.

FIG. 3 shows the state change of Septin9 methylation during intestinal cancer development.

Detailed Description

Unless defined otherwise, technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art. Although many methods and materials similar or equivalent to those described herein can be used in experimental or practical applications, the materials and methods are described below. In case of conflict, the present specification, including definitions, will control, and examples will control.

Additional features and advantages of the invention will be described in detail below.

Definition of

The digestive tract refers to a long muscular tube extending from the oral cavity to the pharynx, esophagus, stomach, small intestine, large intestine and finally anus, and comprises the oral cavity, the pharynx, the esophagus, the stomach, the small intestine (duodenum, jejunum and ileum), the large intestine (cecum, colon and rectum) and the like. The digestive glands include small digestive glands and large digestive glands. The small digestive glands are scattered in the wall of each part of the digestive tract, and the large digestive glands have three pairs of salivary glands, liver and pancreas, which are all drained into the digestive tract by means of ducts.

Precancerous lesions refer to certain lesions that have the potential to become cancerous as the cancer continues to develop at a stage in the process of development. Under the long-term action of different carcinogenic factors, normal cells of the body are firstly shown to increase the number of cells, but the cell morphology is not changed, and the change is pathologically called as 'simple hyperplasia'. In the future, the difference in cell morphology from the original tissue (also referred to as "atopy") gradually increases with an increase in the number of cells, but the cells have not yet developed into cancer, and this stage belongs to a precursor stage of cancer and is called "precancerous lesion". In the case of precancerous lesions, the proliferating cells tend to be transformed into cancer cells, but they have not become typical cancerous lesions. Moreover, not all premalignant lesions develop into carcinoma, where the majority of premalignant lesions regress. Only a relatively small fraction of precancerous lesions continue to develop and eventually become cancerous.

Precancerous conditions certain diseases, although not malignant in themselves, have the potential to develop into malignant tumors, with an increased risk of the patient developing the corresponding malignant tumor. These diseases are referred to as precancerous conditions. Precancerous disease is a clinical concept that is a group of diseases including etiology and pathology, clinical symptoms, signs and abnormal changes in auxiliary examinations, and actually the process of cellular carcinogenesis is a staged and gradual progression from the attack of carcinogenic factors on normal tissue cells to the generation of cancer. It generally takes more than 10 years or even longer, and of course progresses rapidly, in the long course of which precancerous disease progresses to cancer through pre-cancerous twitching.

The Septin9 gene is a member of Septin gene family, the gene family is composed of at least 13 genes, and the genes code a conserved guanosine triphosphatase (GTPase) structural domain which can be combined with cytoskeleton related proteins, and the proteins are related to tumorigenesis. Members of the Septin gene family are associated with a variety of cellular functions from membrane vesicle trafficking to cytokinesis, such as cytokinesis, membrane transport, membrane fusion, extracellular secretion, apoptosis. Disruption of the effects of Septin9 resulted in incomplete cell division, and Septin9 and other proteins have been shown to be fusion partner molecules (fusion partner) of the proto-oncogene MLL, suggesting a role in tumorigenesis.

The target region refers to a target region of a gene, also called a target gene, i.e., a target gene. In molecular inheritance, it should not only have the function of recognizing binding, but also have the function of expressing the corresponding function required after binding to a site.

Methylation refers to DNA methylation, a form of chemical modification of DNA that alters genetic expression without altering DNA sequence. DNA methylation refers to the covalent bonding of a methyl group to the cytosine 5' carbon of a genomic CpG dinucleotide under the action of DNA methyltransferase. DNA methylation can cause changes in chromatin structure, DNA conformation, DNA stability, and the way DNA interacts with proteins, thereby controlling gene expression.

Nucleic acid refers to a biological macromolecular compound synthesized by polymerizing many nucleotides, which is one of the most basic substances of life. Nucleic acid is widely present in all animal and plant cells and microorganisms, and nucleic acid in organisms is often combined with protein to form nucleoprotein. Different nucleic acids differ in their chemical composition, nucleotide arrangement order, and the like. Nucleic acids are classified into ribonucleic acids (abbreviated as RNA) and deoxyribonucleic acids (abbreviated as DNA) according to their chemical compositions. DNA is the primary material basis for storing, replicating, and transmitting genetic information. RNA plays an important role in protein synthesis

Oligonucleotides are a generic term for short-chain nucleotides with only 20 bases or less (including nucleotides in deoxyribonucleic acid DNA or ribonucleic acid RNA), and can be easily linked with complementary pairs of the oligonucleotides, so that the oligonucleotides are often used as probes for determining the structure of DNA or RNA and are often used in gene chip, electrophoresis, fluorescence in situ hybridization and other processes.

A primer refers to a molecule having a specific nucleotide sequence, which stimulates the synthesis of a macromolecule having the specific nucleotide sequence at the start of nucleotide polymerization, and which is covalently linked to a reactant, and such a molecule is called a primer. The primers are typically two oligonucleotide sequences synthesized by man, one complementary to one of the DNA template strands at one end of the target region and the other complementary to the other DNA template strand at the other end of the target region, and function as a starting point for nucleotide polymerization, from which 3' end the nucleic acid polymerase can begin synthesizing a new nucleic acid strand. Primers designed artificially in vitro are widely used for polymerase chain reaction, sequencing, probe synthesis, and the like.

The probe is single-stranded or double-stranded DNA with the length of dozens to hundreds or even thousands of base pairs, and is marked by a special tracer (such as an isotope, an enzyme or a colored group); under proper pH value, temperature and ionic strength, the DNA probe can be combined (hybridized) with complementary non-labeled single-stranded DNA or RNA in a sample to be detected by hydrogen bond to form a double-stranded complex (hybrid) by utilizing the denaturation and renaturation of molecules and the high accuracy of base complementary pairing. After washing off the probe which is not coupled, the result of hybridization reaction can be detected by a detection system such as autoradiography or enzyme-linked reaction.

The forward primer is a primer located upstream of the double strand of DNA and extends continuously along the negative strand. The negative strand, i.e., the nonsense strand, is also called the noncoding strand, is complementary to the positive strand, and the primer that binds to this strand is the forward primer.

The reverse primer refers to a primer located downstream of the double strand of DNA and extending continuously along the positive strand. The plus strand, i.e., the sense strand, also known as the coding strand, is generally located at the upper end of the double-stranded DNA in a direction from left to right 5 'to 3'.

Free DNA (cfdna) refers to circulating free DNA or cell free DNA, which is a degraded DNA fragment released into plasma. The cfDNA from the tumor can find tumor-related mutation, heterozygote deletion (LOH), gene amplification, cancer virus DNA and hypermethylation of a cancer suppressor gene promoter region, so that the research on the tumor DNA can be realized under a non-invasive condition.

The invention relates to the technical field of biological medicines, in particular to a composition for screening the risk of cancer in a digestive tract, precancerous lesions in the digestive tract and precancerous diseases in the digestive tract. In the invention, the composition is used for detecting the methylation degree of the Septin9 gene to detect the cancer risk of the digestive tract, the precancerous lesion of the digestive tract and the precancerous disease of the digestive tract, thereby early preventing and intervening the precancerous disease of the digestive tract.

In a specific embodiment of the invention, a composition comprises a nucleic acid sequence for detecting the degree of methylation within at least one target region of the Septin9 gene; wherein the target regions are selected from SEQ ID No.: 13 or SEQ ID No.: 14, the length of the fragment is more than 60bp, preferably 60-90 bp; the nucleic acid sequence is identical, complementary or hybridised to the target region; preferably, the nucleic acid sequence hybridizes to the target region under moderately stringent or stringent conditions.

In a specific embodiment of the invention, a composition comprises a nucleic acid sequence for detecting the degree of methylation within at least one target region of the Septin9 gene; wherein the target regions are selected from SEQ ID No.: 13 or SEQ ID No.: 14, the length of the fragment is more than 60bp, preferably 60-90 bp; the nucleic acid sequence is identical, complementary or hybridised to the target region; preferably, the nucleic acid sequence hybridizes to the target region under moderately stringent or stringent conditions. The nucleic acid sequences are primers and probes, wherein the primers and probes have the following characteristics: the target region that is methylated can be amplified, while the target region that is unmethylated cannot be amplified.

In a specific embodiment of the invention, a composition comprises a nucleic acid sequence for detecting the degree of methylation within at least one target region of the Septin9 gene; wherein the target regions are selected from SEQ ID No.: 13 or SEQ ID No.: 14, the length of the fragment is more than 60bp, preferably 60-90 bp; the nucleic acid sequence is identical, complementary or hybridised to the target region; preferably, the nucleic acid sequence hybridizes to the target region under moderately stringent or stringent conditions. The nucleic acid sequences are primers and probes, wherein the primers and probes have the following characteristics: the target region that is methylated can be amplified, while the target region that is unmethylated cannot be amplified. The length of the primer is more than 15bp, preferably 18-24 bp; and the length of the probe is more than 15bp, preferably 18-30 bp.

In a specific embodiment of the invention, a composition comprises a nucleic acid sequence for detecting the degree of methylation within at least one target region of the Septin9 gene; wherein the target regions are selected from SEQ ID No.: 13 or SEQ ID No.: 14, the length of the fragment is more than 60bp, preferably 60-90 bp; the nucleic acid sequence is identical, complementary or hybridised to the target region; preferably, the nucleic acid sequence hybridizes to the target region under moderately stringent or stringent conditions. The nucleic acid sequences are primers and probes, wherein the primers and probes have the following characteristics: the target region that is methylated can be amplified, while the target region that is unmethylated cannot be amplified. The primers and probes are any one or more of

compositions

1, 2, 3 and 4:

composition 1:

forward primer SEQ ID No. 1: 5'-TGTTTGTTAGTCGCGTGCG-3'

Reverse primer SEQ ID No. 2: 5'-AAATTCTCTATCACCGCCGC-3'

Probe SEQ ID No. 3: 5'-CGCGCGCTCTACGCCTACAA-3', respectively;

composition 2:

forward primer SEQ ID No. 4: 5'-GTCGCGTTTTTCGTCGTT-3'

Reverse primer SEQ ID No. 5: 5'-CTAAACACACGACCGAAACG-3'

Probe SEQ ID No. 6: 5'-CCCGCCTAACCCGCGCCC-3', respectively;

composition 3:

forward primer SEQ ID No. 7: 5'-CGGGCGGAGTAGTTAGTGC-3'

Reverse primer SEQ ID No. 8: 5'-CTCCCGAACGAATCAAATTCC-3'

Probe SEQ ID No. 9: 5'-CGCACCCGCACCGACCTCC-3', respectively; and

composition 4:

forward primer SEQ ID No. 10: 5'-TTCGTTGAGAGCGTCGCG-3'

Reverse primer SEQ ID No. 11: 5'-GCGCAAAATCTACGCGAATAC-3'

Probe SEQ ID No. 12: 5'-CCCACGTAAACGACGCGAACACG-3' are provided.

In a specific embodiment of the invention, a composition comprises a nucleic acid sequence for detecting the degree of methylation within at least one target region of the Septin9 gene; wherein the target regions are selected from SEQ ID No.: 13 or SEQ ID No.: 14, the length of the fragment is more than 60bp, preferably 60-90 bp; the nucleic acid sequence is identical, complementary or hybridised to the target region; preferably, the nucleic acid sequence hybridizes to the target region under moderately stringent or stringent conditions. The nucleic acid sequences are primers and probes, wherein the primers and probes have the following characteristics: the target region that is methylated can be amplified, while the target region that is unmethylated cannot be amplified. The length of the primer is more than 15bp, preferably 18-24 bp; and the length of the probe is more than 15bp, preferably 18-30 bp. The primers and probes are any one or more of

compositions

1, 2, 3 and 4:

composition 1:

forward primer SEQ ID No. 1: 5'-TGTTTGTTAGTCGCGTGCG-3'

Reverse primer SEQ ID No. 2: 5'-AAATTCTCTATCACCGCCGC-3'

Probe SEQ ID No. 3: 5'-CGCGCGCTCTACGCCTACAA-3', respectively;

composition 2:

forward primer SEQ ID No. 4: 5'-GTCGCGTTTTTCGTCGTT-3'

Reverse primer SEQ ID No. 5: 5'-CTAAACACACGACCGAAACG-3'

Probe SEQ ID No. 6: 5'-CCCGCCTAACCCGCGCCC-3', respectively;

composition 3:

forward primer SEQ ID No. 7: 5'-CGGGCGGAGTAGTTAGTGC-3'

Reverse primer SEQ ID No. 8: 5'-CTCCCGAACGAATCAAATTCC-3'

Probe SEQ ID No. 9: 5'-CGCACCCGCACCGACCTCC-3', respectively; and

composition 4:

forward primer SEQ ID No. 10: 5'-TTCGTTGAGAGCGTCGCG-3'

Reverse primer SEQ ID No. 11: 5'-GCGCAAAATCTACGCGAATAC-3'

Probe SEQ ID No. 12: 5'-CCCACGTAAACGACGCGAACACG-3' are provided.

In the present invention, the nucleic acid comprises a long fragment of at least 15 oligonucleotides of Septin9, wherein the oligonucleotides comprise at least one CpG dinucleotide sequence. Preferably, the oligonucleotide long fragment of Septin9 comprises a sequence identical to, complementary to, or hybridizing under moderate stringency or stringency conditions to a sequence selected from SEQ ID No.: 13 or SEQ ID No.: 14 or a variant thereof and the complement thereof. More preferably, the oligonucleotide long fragment of Septin9 comprises a sequence identical to, complementary to, or hybridizing under moderate stringency or stringency conditions to a sequence selected from SEQ ID No.: 1 to SEQ ID No.: 12 and the complement thereof. The nucleic acid sequence for detecting whether methylation exists in at least one target region in the Septin9 gene and oligonucleotide long fragment thereof comprises: is identical to or complementary to or hybridizes under moderate stringency or stringency conditions to a nucleic acid sequence selected from the group consisting of SEQ ID No.: 13 or SEQ ID No.: 14 and variants thereof, and fragments of at least 9 bases of the contiguous sequence thereof.

SEQ ID No.: 13 sequence as follows:

GAGGCGTCGCCCGTCCCTGGCTTCTCTGACAGCCGTGTTCCATCCCCGCCCTGTGCCCCTTCTCCCGGACAGTGCCTTCTCCAGGGCTCACCCAGGAGGGTGCAGCGGTGGCCCCCGGGGCGGTGGTCGTGGTGGGGGTGTTAGCTGCAGGGGTGCCCTCGGTGGGTGGGAGTTGGTGGCCTCTCGCTGGTGCCATGGGACTCGCATGTTCGCCCTGCGCCCCTCGGCTCTTGAGCCCACAGGCCGGGATCCTGCCTGCCAGCCGCGTGCGCTGCCGTTTAACCCTTGCAGGCGCAGAGCGCGCGGCGGCGGTGACAGAGAACTTTGTTTGGCTGCCCAAATACAGCCTCCTGCAGAAGGACCCTGCGCCCGGGGAAGGGGAGGAATCTCTTCCCCTCTGGGCGCCCGCCCTCCTCGCCATGGCCCGGCCTCCACATCCGCCCACATCTGGCCGCAGCGGGGCGCCCGGGGGGAGGGGCTGAGGCCGCGTCTCTCGCCGTCCCCTGGGCGCGGGCCAGGCGGGGAGGAGGGGGGCGCTCCGGTCGTGTGCCCAGGACTGTCCCCCAGCGGCCACTCGGGCCCCAGCCCCCCAGGCCTGGCCTTGACAGGCGGGCGGAGCAGCCAGTGCGAGACAGGGAGGCCGGTGCGGGTGCGGGAACCTGATCCGCCCGGGAGGCGGGGGCGGGGCGGGGGCGCAGCGCGCGGGGAGGGGCCGGCGCCCGCCTTCCTCCCCCATTCATTCAGCTGAGCCAGGGGGCCTAGGGGCTCCTCCGGCGGCTAGCTCTGCACTGCAGGAGCGCGGGCGCGGCGCCCCAGCCAGCGCGCAGGGCCCGGGCCCCGCCGGGGGCGCTTCCTCGCCGCTGCCCTCCGCGCGACCCGCTGCCCACCAGCCATCATGTCGGACCCCGCGGTCAACGCGCAGCTGGATGGGATCATTTCGGACTTCGAAGGTGGGTGCTGGGCTGGCTGCTGCGGCCGCGGACGTGCTGGAGAGGACCCTGCGGGTGGGCCTGGCGCGGGACGGGGGTGCGCTGAGGGGAGACGGGAGTGCGCTGAGGGGAGACGGGACCCCTAATCCAGGCGCCCTCCCGCTGAGAGCGCCGCGCGCCCCCGGCCCCGTGCCCGCGCCGCCTACGTGGGGGACCCTGTTAGGGGCACCCGCGTAGACCCTGCGCGCCCTCACAGGACCCTGTGCTCGTTCTGCGCACTGCCGCCTGGGTTTCCTTCCTTTTATTGTTGTTTGTGTTTGCCAAGCGACAGCGACCTCCTCGAGGGCTCGCGAGGCTGCCTCGGAACTCTCCAGGACGCACAGTTTCACTCTGGGAAATCCATCGGTCCCCTCCCTTTGGCTCTCCCCGGCGGCTCTCGGGCCCCGCTTGGACCCGGCAACGGGATAGGGAGGTCGTTCCTCACCTCCGACTGAGTGGACAGCCGCGTCCTGCTCGGGTGGACAGCCCTCCCCTCCCCCACGCCAGTTTCGGGGCCGCCAAGTTGTGCAGCCCGTGGGCCGGGAGCACCGAACGGACACAGCCCAGGTCGT

further preferred SEQ ID No.: the 14 sequences are shown below:

CGCCCTGCGCCCCTCGGCTCTTGAGCCCACAGGCCGGGATCCTGCCTGCCAGCCGCGTGCGCTGCCGTTTAACCCTTGCAGGCGCAGAGCGCGCGGCGGCGGTGACAGAGAACTTTGTTTGGCTGCCCAAATACAGCCTCCTGCAGAAGGACCCTGCGCCCGGGGAAGGGGAGGAATCTCTTCCCCTCTGGGCGCCCGCCCTCCTCGCCATGGCCCGGCCTCCACATCCGCCCACATCTGGCCGCAGCGGGGCGCCCGGGGGGAGGGGCTGAGGCCGCGTCTCTCGCCGTCCCCTGGGCGCGGGCCAGGCGGGGAGGAGGGGGGCGCTCCGGTCGTGTGCCCAGGACTGTCCCCCAGCGGCCACTCGGGCCCCAGCCCCCCAGGCCTGGCCTTGACAGGCGGGCGGAGCAGCCAGTGCGAGACAGGGAGGCCGGTGCGGGTGCGGGAACCTGATCCGCCCGGGAGGCGGGGGCGGGGCGGGGGCGCAGCGCGCGGGGAGGGGCCGGCGCCCGCCTTCCTCCCCCATTCATTCAGCTGAGCCAGGGGGCCTAGGGGCTCCTCCGGCGGCTAGCTCTGCACTGCAGGAGCGCGGGCGCGGCGCCCCAGCCAGCGCGCAGGGCCCGGGCCCCGCCGGGGGCGCTTCCTCGCCGCTGCCCTCCGCGCGACCCGCTGCCCACCAGCCATCATGTCGGACCCCGCGGTCAACGCGCAGCTGGATGGGATCATTTCGGACTTCGAAGGTGGGTGCTGGGCTGGCTGCTGCGGCCGCGGACGTGCTGGAGAGGACCCTGCGGGTGGGCCTGGCGCGGGACGGGGGTGCGCTGAGGGGAGACGGGAGTGCGCTGAGGGGAGACGGGACCCCTAATCCAGGCGCCCTCCCGCTGAGAGCGCCGCGCGCCCCCGGCCCCGTGCCCGCGCCGCCTACGTGGGGGACCCTGTTAGGGGCACCCGCGTAGACCCTGCGCGCCCTCACAGGACCCTGTGCTCGTTCTGCGCACTGCCG

in the invention, the composition can specifically detect the methylation degree in at least one target region of the Septin9 gene, and has the advantages of higher detection rate on digestive tract cancer, higher detection rate on precancerous lesion and precancerous disease, and false positive of people without digestive tract lesion can be controlled within 5%.

The invention also relates to a kit for screening the risk of the cancer of the digestive tract, the precancerous lesion of the digestive tract and the precancerous disease of the digestive tract. The risk of cancer refers to the possibility that a group of non-cancerous or pre-cancerous diseases or cancers for which abnormal methylation of the gene has been detected by the detection system of the present application will subsequently suffer from a pre-cancerous disease or further from cancer.

In a particular embodiment of the invention, the kit comprises a composition according to any one of the above embodiments.

In a specific embodiment of the invention, the kit screens the precancerous lesions and precancerous diseases of the digestive tract to one or more of precancerous lesions and precancerous diseases of esophageal cancer, gastric cancer, intestinal cancer, liver cancer and pancreatic cancer.

In a specific embodiment of the invention, the kit screens the precancerous lesions and precancerous diseases of the digestive tract to one or more of precancerous lesions and precancerous diseases of esophageal cancer, gastric cancer, intestinal cancer, liver cancer and pancreatic cancer. The esophageal precancerous lesions and precancerous diseases comprise: chronic esophagitis, Barrett's esophagus, leukoplakia of the esophagus, diverticulum of the esophagus, achalasia of the cardia, reflux esophagitis.

In a specific embodiment of the invention, the kit screens the precancerous lesions and precancerous diseases of the digestive tract to one or more of precancerous lesions and precancerous diseases of esophageal cancer, gastric cancer, intestinal cancer, liver cancer and pancreatic cancer. The gastric cancer precancerous lesions and precancerous diseases include: atrophic gastritis, polyp, gastric ulcer, xanthoma, intestinal metaplasia.

In a specific embodiment of the invention, the kit screens the precancerous lesions and precancerous diseases of the digestive tract to one or more of precancerous lesions and precancerous diseases of esophageal cancer, gastric cancer, intestinal cancer, liver cancer and pancreatic cancer. The precancerous lesion and precancerous disease of intestinal cancer include: ulcerative colitis, large intestine polyposis, large intestine adenoma, Crohn's disease.

In a specific embodiment of the invention, the kit screens the precancerous lesions and precancerous diseases of the digestive tract to one or more of precancerous lesions and precancerous diseases of esophageal cancer, gastric cancer, intestinal cancer, liver cancer and pancreatic cancer. The liver cancer precancerous lesions and precancerous diseases include: cirrhosis of the liver.

In a specific embodiment of the invention, the kit screens the precancerous lesions and precancerous diseases of the digestive tract to one or more of precancerous lesions and precancerous diseases of esophageal cancer, gastric cancer, intestinal cancer, liver cancer and pancreatic cancer. The pancreatic cancer precancerous lesions and precancerous diseases include: myxomatous cystadenoma, pancreatitis, pseudocyst, insulinoma.

In the present invention, the pre-cancerous lesions and diseases of the digestive tract include, but are not limited to, chronic esophagitis, atypical hyperplasia of the squamous epithelium of the esophagus, Barrett's esophagus, atrophic gastritis, gastric ulcer, gastric polyp, intestinal adenoma, cirrhosis, pancreatitis, and the like.

According to the screening and endoscopic diagnosis and treatment guidelines (2014. Beijing) in the early stage of colorectal cancer, one of the risk factors of colorectal cancer is inflammatory bowel disease. The disease is a clear risk factor for colorectal cancer. There are studies that suggest that about 20% of patients with inflammatory bowel disease can develop colorectal cancer within 10 years of onset, 2-4 times the risk of the normal population. Another Meta analysis showed that the average normalized morbidity rate for ulcerative colitis patients was 2.4 after 14 years of follow-up. In addition, the guidelines clearly indicate that low grade intraepithelial neoplasia corresponds to the primary mild and moderate dysplasia and is a precancerous lesion, while high grade intraepithelial neoplasia includes severe dysplasia, carcinoma in situ, infiltratable carcinoma in situ and submucosal carcinoma, and is a clear colorectal carcinoma. Colorectal adenomas can be classified into tubular adenomas, tubular villous adenomas and villous adenomas, with the highest rate of malignancy and the lowest rate of tubular adenomas. Most colorectal cancers develop via the adenoma-adenocarcinoma pathway. The guidelines recommend colorectal cancer screening subjects including, but not limited to, the following populations: (1) the patients suffered from precancerous diseases such as colorectal adenomatous polyp, ulcerative colitis, Crohn's disease, etc.

The process of occurrence of gastric cancer is generally the following: normal gastric mucosa → superficial gastritis → atrophic gastritis → enteromorphosis → dysplasia → gastric cancer, American digestive endoscopy Association ASGE treatment of gastric cancer and precancerous lesion under endoscope in middle aged years indicates that precancerous diseases include gastric polyp, enteromorphosis and dysplasia. Chinese early gastric cancer screening and endoscope diagnosis and treatment consensus suggestion (2014, Changsha) confirms that pre-cancer disease people with the age of more than or equal to 40 years old and the stomach suffering from chronic atrophic gastritis, gastric ulcer, gastric polyp, postoperative residual stomach, hypertrophic gastritis, pernicious anemia and the like are high risk people for screening gastric cancer.

In the consensus of experts in early esophageal cancer screening and endoscopic diagnosis and treatment in china (2014, beijing), pre-esophageal-cancer diseases refer to benign diseases associated with esophageal cancer and having a certain cancer rate, including chronic esophagitis, Barrett's esophagus, leukoplakia of esophagus, diverticulum of esophagus, achalasia of cardia, reflux esophagitis, benign stricture of esophagus due to various reasons, and the like. Precancerous lesion refers to pathological changes which are proved to be closely related to esophageal carcinogenesis, esophageal squamous epithelial dysplasia is closely related to squamous carcinogenesis and belongs to precancerous lesion, and Barrett esophagus-related dysplasia is the precancerous lesion of adenocarcinoma. In the guidelines it is indicated that persons over the age of 40 and suffering from pre-esophageal cancer or precancerous lesions are at high risk of esophageal cancer.

The main high-risk factors of liver cancer in China are as follows: hepatitis B/C or alcoholic cirrhosis, history of aflatoxin contact and drinking water pollution are high risk groups of liver cancer. NCCN Clinical Practice Guidelines in Oncology (2017) indicate that the liver cirrhosis population is the population at risk of liver cancer and should be examined regularly by ultrasound or AFP.

Attention is paid to understanding and treatment of precancerous lesions of pancreatic cancer (2009, 14 th volume, 5 th volume in surgical theory and practice) and diagnosis and treatment of precancerous lesions of pancreatic cancer (2008, 9 th volume, 28 th volume, 9 th volume in Chinese J.digestions), and it is pointed out that pancreatic cancer is a common malignant tumor of digestive system, the survival rate in 5 years is only 3%, and the survival time is less than 6 months. Pancreatic cancer is insidious, with atypical and rapid progression of early symptoms, and is advanced by the time most patients are hospitalized. Early diagnosis and comprehensive treatment become the key points for improving the treatment effect of pancreatic cancer. Precancerous lesions are the initial stage of malignant tumor development and are the best opportunity for initiating therapy and blocking malignant changes. The precancerous lesion of pancreatic cancer comprises intraepithelial neoplasia of pancreas, chronic pancreatitis, intraductal papillary mucinous tumors, mucinous cystic tumors and the like.

In the invention, the kit has higher sensitivity and better specificity, can diagnose and detect the risk of the cancer of the digestive tract, the precancerous lesion of the digestive tract and the precancerous disease of the digestive tract efficiently and sensitively at an early stage in a non-invasive mode, and greatly improves the detection rate of the risk of the cancer of the digestive tract, the precancerous lesion of the digestive tract and the precancerous disease of the digestive tract. The auxiliary detection method is a very effective supplementary auxiliary detection means for people who exclude endoscope and imaging examination or cannot perform endoscope and imaging examination due to special reasons.

The invention also relates to a detection method of the kit in the embodiment.

In a particular embodiment of the invention, the method comprises the steps of: a) collecting a human source sample; b) extracting free DNA from the human sample; c) converting the DNA with bisulfite; d) carrying out PCR reaction; e) and (3) carrying out result interpretation on the products of the PCR reaction.

In a particular embodiment of the invention, the method comprises the steps of: : a) collecting a human source sample; b) extracting free DNA from the human sample; c) converting the DNA with bisulfite; d) carrying out PCR reaction; e) and (3) carrying out result interpretation on the products of the PCR reaction. The human sample is selected from one or more of a cell line, a tissue section, a biopsy, a paraffin-embedded tissue, a body fluid, a stool, a colonic exudate, urine, plasma, serum, whole blood, isolated blood cells, cells isolated from blood.

In a particular embodiment of the invention, the method comprises the steps of: : a) collecting a human source sample; b) extracting free DNA from the human sample; c) converting the DNA with bisulfite; d) carrying out PCR reaction; e) and (3) carrying out result interpretation on the products of the PCR reaction. The human samples are venous blood and plasma drawn from veins.

In the present invention, the method further comprises determining the methylation degree of at least one target region of the Septin9 gene and its fragments in a biological sample isolated from the individual, and detecting the pre-cancerous disease of the digestive tract in the individual by methylation detection of Septin 9. The method further includes the use of a reagent (e.g., bisulfite) to convert unmethylated cytosine bases at the 5-position of the DNA to uracil or other bases that are detectably different from cytosine in hybridization properties; contacting the reagent-treated Septin9 or fragment thereof with an amplification enzyme and primers such that the treated gene or fragment is amplified to produce an amplification product or is not amplified; detecting the amplification product with a probe; and determining the degree of methylation of at least one CpG dinucleotide of the DNA sequence of the gene of Septin9 based on the presence or absence of the amplification product. The methylation state of at least one CpG dinucleotide in the DNA sequence of the Septin9 gene is determined by the cycle threshold Ct value of polymerase chain reaction.

In the invention, the method for detecting the cancer risk of the digestive tract, the precancerous lesion of the digestive tract and the precancerous disease of the digestive tract in an individual by using the kit has the characteristics of high sensitivity and good specificity. The method is a non-invasive method, and particularly can be used for screening and detecting the high risk group of digestive tract cancer who has rejection to endoscopy or imaging or can not carry out endoscopy or imaging examination due to special reasons.

The present invention also relates to the use of a composition according to the above embodiments for the preparation of a kit for screening the risk of cancer, precancerous lesions of the digestive tract and precancerous conditions of the digestive tract.

In a particular embodiment of the invention, the precancerous lesions and precancerous diseases are one or more of esophageal cancer, gastric cancer, intestinal cancer, liver cancer and pancreatic cancer.

In a particular embodiment of the invention, the precancerous lesions and precancerous diseases are one or more of esophageal cancer, gastric cancer, intestinal cancer, liver cancer and pancreatic cancer. The esophageal precancerous lesions and precancerous diseases comprise: chronic esophagitis, Barrett's esophagus, leukoplakia of the esophagus, diverticulum of the esophagus, achalasia of the cardia, reflux esophagitis.

In a particular embodiment of the invention, the precancerous lesions and precancerous diseases are one or more of esophageal cancer, gastric cancer, intestinal cancer, liver cancer and pancreatic cancer. The gastric cancer precancerous lesions and precancerous diseases include: atrophic gastritis, polyp, gastric ulcer, xanthoma, intestinal metaplasia.

In a particular embodiment of the invention, the precancerous lesions and precancerous diseases are one or more of esophageal cancer, gastric cancer, intestinal cancer, liver cancer and pancreatic cancer. The precancerous lesion and precancerous disease of intestinal cancer include: ulcerative colitis, large intestine polyposis, large intestine adenoma, Crohn's disease.

In a particular embodiment of the invention, the precancerous lesions and precancerous diseases are one or more of esophageal cancer, gastric cancer, intestinal cancer, liver cancer and pancreatic cancer. The liver cancer precancerous lesions and precancerous diseases include: cirrhosis of the liver.

In a particular embodiment of the invention, the precancerous lesions and precancerous diseases are one or more of esophageal cancer, gastric cancer, intestinal cancer, liver cancer and pancreatic cancer. The pancreatic cancer precancerous lesions and precancerous diseases include: myxomatous cystadenoma, pancreatitis, pseudocyst, insulinoma.

The following are examples of the compositions, kits, nucleic acid sequences, and methods of detection of the present application. It is to be understood that various other embodiments may be implemented in view of the general description provided above.

The present invention is further illustrated by the following examples, which are intended to be purely exemplary of the invention and are not intended to be limiting.

The experimental procedures used in the following examples are, unless otherwise specified, conventional procedures such as Sambrook et al, molecular cloning: a method described in a Laboratory Manual (New York: Cold Spring Harbor Laboratory Press, 1989).

Materials, reagents and the like used in the following examples are commercially available unless otherwise specified.

Examples

Example 1: septin9 gene methylation detection method

The PCR amplification conditions adopted in this experimental example were: in Life TechnolReal-time PCR was performed on a gies instrument (7500 Fast). The PCR reaction mixture was composed of bisulfite converted DNA template 25. mu.l and 450nM primers (using composition 1: forward primer SEQ ID No.1 and reverse primer SEQ ID No.2), 225nM probe (using composition 1: probe SEQ ID No.3), 1UTaq polymerase, 200. mu.m of each dNTP, 4.5mM MgCl₂And 2 XPCR buffer to a final volume of 50. mu.l. The samples were pre-cycled at 94 ℃ for 20 minutes, followed by 5 seconds of 45 cycles of annealing at 62 ℃, 35 seconds at 55.5 ℃ and 30 seconds of denaturation at 93 ℃.

PCR detection was performed using an artificial methylated oligonucleotide template and an artificial unmethylated oligonucleotide template, as shown in FIG. 1, with amplification of the artificial methylated oligonucleotide template and no amplification of the artificial unmethylated oligonucleotide template, indicating that the primers and probes are correct and can be used for detection of methylated Septin 9.

Example 2: detection of esophageal precancerous lesions and precancerous conditions

The discovery of the precancerous lesion and precancerous disease of the esophagus cancer still mainly depends on an esophagoscope at present, however, the compliance of the esophagoscope is generally low everywhere, and the early screening of high risk groups of the esophagus cancer is limited.

The detection of Septin9 was completed in total for 1150 asymptomatic groups, all of which had varying degrees of emotional conflict to endoscopy or imaging via questionnaire survey. Wherein the detection sample is blood plasma (1.2-3.5 mL), and free DNA in each sample is extracted. The extraction of the DNA can be performed by any standard means in the prior art, and specifically, in the present embodiment, all the sample DNAs are extracted by using a nucleic acid extraction reagent of Boerchi (Beijing) science and technology Co., Ltd.

The DNA sample is then pre-treated so that the 5' unmethylated cytosine base is converted to uracil, thymine or another base that is different in hybridization behavior from cytosine. In this example, the pretreatment is achieved by bisulfite reagent treatment. Modification of bisulfite DNA was performed by using nucleic acid extraction reagents from Boerchi (Beijing) science and technology, Inc.

Then, the detection system of example 1 was added to the pretreated DNA samples of 1150 asymptomatic persons to detect Septin9 gene. Real-time PCR was performed on bisulfite converted DNA.

The PCR amplification conditions adopted in this experimental example were: real-time PCR was performed on a Life Technologies instrument (7500 Fast). The PCR reaction mixture was composed of bisulfite converted DNA template 25. mu.l and 450nM primers (using composition 2: forward primer SEQ ID No.4 and reverse primer SEQ ID No.5), 225nM probe (using composition 2: probe SEQ ID No.6), 1UTaq polymerase, 200. mu.m of each dNTP, 4.5mM MgCl₂And 2 XPCR buffer to a final volume of 50. mu.l. The samples were amplified with pre-cycling at 94 ℃ for 20 minutes, followed by 5 seconds of 45 cycles of annealing at 62 ℃, 35 seconds at 55.5 ℃ and 30 seconds of denaturation at 93 ℃.

Finally, 1150 asymptomatic persons were subjected to interpretation of results based on the Cutoff value of the kit (. ltoreq.41.0), wherein Septin9 was methylation positive for 52 cases, the positive rate was 4.35%, and the positive 52 cases were further treated by psychological counseling and medical science popularization, and 41 cases were further treated with endoscopy, wherein the endoscopy was positive for 40 cases, the overall positive rate was 97.60%, and wherein the number of samples with lesions in the esophageal region was 12 cases, the disease types were as shown in Table 1 below, and the gastroscopy and enteroscopy results are further described in examples 3 and 4.

Table 1.1150 patients with asymptomatic subjects Septin9 positive esophagoscopy results.

Through Septin9 screening of 1150 cases of asymptomatic people, Septin9 methylation detection provides a safe and noninvasive auxiliary diagnosis method for early screening of esophageal precancerous lesions and precancerous diseases for esophageal cancer high-risk people excluding endoscopy. 1150 asymptomatic people are detected by Septin9, and 12 examinees are intervened in advance, so that the risk of esophageal cancer canceration can be effectively reduced. Without this detection, there is no opportunity for pre-cancerous disease to be effectively intervened ahead of time in high risk groups that reject endoscopy.

Example 3: detection of gastric precancerous lesions and precancerous conditions

The discovery of gastric precancerous lesions and precancerous diseases still mainly depends on gastroscopy at present, but the compliance of the gastroscopy is generally low everywhere, and the early screening of high risk groups of the gastroscopy is limited.

The PCR amplification conditions adopted in this experimental example were: real-time PCR was performed on a Life Technologies instrument (7500 Fast). The PCR reaction mixture was composed of bisulfite converted DNA template 25. mu.l and 450nM primers (using composition 3: forward primer SEQ ID No.7 and reverse primer SEQ ID No.8), 225nM probe (using composition 3: probe SEQ ID No.9), 1UTaq polymerase, 200. mu.m of each dNTP, 4.5mM MgCl₂And 2 XPCR buffer to a final volume of 50. mu.l. The samples were amplified with pre-cycling at 94 ℃ for 20 minutes, followed by 5 seconds of 45 cycles of annealing at 62 ℃, 35 seconds at 55.5 ℃ and 30 seconds of denaturation at 93 ℃.

Finally, 1150 asymptomatic persons were subjected to interpretation of results based on the Cutoff value (. ltoreq.41.0) of the kit, wherein Septin9 was methylation-positive for 52 cases, the positive rate was 4.35%, and the positive 52 cases of subjects had further completed endoscopy by further psychological counseling and medical science popularization, with 41 cases of subjects having further completed endoscopy, wherein the endoscopy was positive for 40 cases, the overall positive rate was 97.60%, and wherein the number of samples with lesions in the stomach was 36, and the disease types were as shown in Table 2 below.

Table 2.1150 patients with asymptomatic subjects Septin9 positive gastroscopy results.

Through Septin9 screening of 1150 asymptomatic people, Septin9 methylation detection provides a safe and noninvasive auxiliary diagnosis method for early screening of gastric cancer precancerous lesion and precancerous disease for high-risk gastric cancer people excluding endoscopy. 1150 asymptomatic people are detected by Septin9, and 36 examinees are intervened in advance, so that the risk of canceration of the gastric cancer can be effectively reduced. Without this detection, there is no opportunity for advanced effective intervention in precancerous conditions in high risk groups of gastric cancer that exclude endoscopy.

Example 4: detection of precancerous lesions and precancerous diseases of colorectal cancer

The discovery of colorectal cancer precancerous lesion and precancerous disease still mainly depends on enteroscope at present, however, the compliance of the enteroscope is generally low everywhere, and the early screening of the colorectal cancer high risk population is limited.

The PCR amplification conditions adopted in this experimental example were: real-time PCR was performed on a Life Technologies instrument (7500 Fast). The PCR reaction mixture was composed of bisulfite converted DNA template 25. mu.l and 450nM primers (using composition 4: forward primer SEQ ID No.10 and reverse primer SEQ ID No.11), 225nM probe (using composition 4: probe SEQ ID No.12), 1UTaq polymerase, 200. mu.m of each dNTP, 4.5mM MgCl₂And 2 XPCR buffer to a final volume of 50. mu.l. The samples were amplified with pre-cycling at 94 ℃ for 20 minutes, followed by 5 seconds of 45 cycles of annealing at 62 ℃, 35 seconds at 55.5 ℃ and 30 seconds of denaturation at 93 ℃.

Finally, 1150 asymptomatic persons were subjected to result interpretation based on the Cutoff value (41.0. ltoreq.) of the kit, wherein Septin9 was methylation-positive for 52 cases, the positive rate was 4.35%, and the positive 52 cases of subjects had further completed endoscopy by further psychological counseling and medical science popularization, wherein the endoscopy result was positive for 40 cases, the overall positive rate was 97.60%, and wherein the number of samples with intestinal lesions was 19 cases, and the disease types were as shown in Table 3 below.

Table 3.1150 patients with asymptomatic subjects Septin9 positive enteroscopy results.

Through Septin9 screening of 1150 asymptomatic people, Septin9 methylation detection provides a safe and noninvasive auxiliary diagnosis method for early screening of colorectal cancer precancerous lesions and precancerous diseases for high-risk colorectal cancer people excluding endoscopy. 1150 asymptomatic populations were tested by Septin9, of which 19 subjects were able to effectively reduce the risk of colorectal cancer canceration by early intervention. Without this detection, there is no opportunity for the high risk group of colorectal cancer that excludes endoscopy to have effective intervention in advance of the precancerous condition.

Example 5: detection of precancerous lesions and precancerous conditions of the liver

The total test of Septin9 was completed in 1459 asymptomatic groups, all of which had varying degrees of emotional conflict to imaging or endoscopy via questionnaires. Wherein the detection sample is blood plasma (1.2-3.5 mL), and free DNA in each sample is extracted. The extraction of the DNA can be performed by any standard means in the prior art, and specifically, in the present embodiment, all the sample DNAs are extracted by using a nucleic acid extraction reagent of Boerchi (Beijing) science and technology Co., Ltd.

Then, the detection system of example 1 was added to the pretreated DNA samples of 1459 asymptomatic persons to detect the Septin9 gene. Real-time PCR was performed on bisulfite converted DNA.

Among them, the bookThe PCR amplification conditions adopted in the experimental examples were: real-time PCR was performed on a Life Technologies instrument (7500 Fast). The PCR reaction mixture was composed of bisulfite converted DNA template 25. mu.l and 450nM primers (using composition 1: forward primer SEQ ID No.1 and reverse primer SEQ ID No.2), 225nM probe (using composition 1: probe SEQ ID No.3), 1UTaq polymerase, 200. mu.m of each dNTP, 4.5mM MgCl₂And 2 XPCR buffer to a final volume of 50. mu.l. The samples were amplified with pre-cycling at 94 ℃ for 20 minutes, followed by 5 seconds of 45 cycles of annealing at 62 ℃, 35 seconds at 55.5 ℃ and 30 seconds of denaturation at 93 ℃.

Finally, according to the Cutoff value (41.0) of the kit, 1459 asymptomatic people were judged for results, wherein Septin9 showed methylation positive 68 cases with a positive rate of 4.66%, and 49 positive 68 subjects further completed the ultrasonic examination, wherein cirrhosis 39 cases with an overall positive rate of 79.59% and the disease types are shown in the following table 4.

Table 4.1459 positive ultrasound results for Septin9 in asymptomatic subjects.

By screening Septin9 of 1459 asymptomatic volunteers, Septin9 methylation detection provides a safe and noninvasive auxiliary diagnosis method for early screening of precancerous liver cancer and precancerous liver cancer for high-risk liver cancer people excluding imaging examination. 1459 cases of asymptomatic population are detected by Septin9, wherein 39 cases of examinees can effectively reduce the risk of canceration of liver cancer through early intervention. Without the detection, there is no opportunity for the high risk group of liver cancer who rejects the imaging examination to intervene effectively in advance on the precancerous disease.

Example 6: detection of pre-pancreatic cancer disease

The total complete Septin9 testing of 1247 asymptomatic groups, who were all challenged to imaging or endoscopy to varying degrees by questionnaire. Wherein the detection sample is blood plasma (1.2-3.5 mL), and free DNA in each sample is extracted. The extraction of the DNA can be performed by any standard means in the prior art, and specifically, in the present embodiment, all the sample DNAs are extracted by using a nucleic acid extraction reagent of Boerchi (Beijing) science and technology Co., Ltd.

Then, the detection system of example 1 was added to the pretreated DNA samples of 1247 asymptomatic persons to detect the Septin9 gene. Real-time PCR was performed on bisulfite converted DNA.

Finally, the results of 1247 asymptomatic persons were judged according to the Cutoff value (41.0 or less) of the kit, wherein Septin9 was methylation positive for 62 persons, the positive rate was 4.97%, 52 of the positive 62 persons were further subjected to ultrasonic examination, the pancreatic lesion was 34 persons, the overall positive rate was 79.59%, and the disease types are shown in the following Table 5.

Table 5.1247 positive imaging results for Septin9 in asymptomatic subjects.

By screening Septin9 of 1247 asymptomatic volunteers, Septin9 methylation detection provides a safe and noninvasive auxiliary diagnosis method for early screening of pancreatic cancer precancerous lesion and precancerous disease for a pancreatic cancer high-risk group excluding imaging examination. 1247 asymptomatic people are detected by Septin9, wherein 29 subjects can effectively reduce the canceration risk of pancreatic cancer through early intervention. Without this test, there is no opportunity for the high risk group of pancreatic cancer that excludes the imaging examination to have effective intervention in the precancerous condition ahead of time.

Example 7False positive

The Septin9 test was performed on a total of 100 normal human volunteers, all of which were examined by imaging or endoscopy to determine the absence of any digestive tract cancer, pre-cancerous disease and pre-cancerous lesions. The detection sample is plasma (1.2-3.5 mL), and free DNA in each sample is extracted. The extraction of the DNA can be performed by any standard means in the prior art, and specifically, in the present embodiment, all the sample DNAs are extracted by using a nucleic acid extraction reagent of Boerchi (Beijing) science and technology Co., Ltd.

Then, the detection system of example 1 was added to the DNA samples of 100 pretreated normal human volunteers to detect Septin9 gene. Real-time PCR was performed on bisulfite converted DNA.

The PCR amplification conditions adopted in this experimental example were: real-time PCR was performed on a Life Technologies instrument (7500 Fast). The PCR reaction mixture was composed of bisulfite converted DNA template 25. mu.l and 450nM primers (using composition 1: forward primer SEQ ID No.1 and reverse primer SEQ ID No.2), 225nM probe (using composition 1: probe SEQ ID No.3), 1UTaq polymerase, 200. mu.m of each dNTP, 4.5mM MgCl₂And 2 XPCR buffer to a final volume of 50. mu.l. The samples were amplified with pre-cycling at 94 ℃ for 20 minutes, followed by 5 seconds of 45 cycles of annealing at 62 ℃, 35 seconds at 55.5 ℃ and 30 seconds of denaturation at 93 ℃.

Finally, the results of 100 asymptomatic people are judged according to the Cutoff value (less than or equal to 41.0) of the kit, wherein Septin9 is methylated positive for 2, and the false positive rate is 2%.

TABLE 6.100 detection results of Septin9 of normal human volunteers

Comparative example

Comparative example 1

In order to compare that the primer and probe composition of the invention is significantly superior to other compositions, the comparative example will use composition 1 and composition 5(SEQ ID Nos.15-17) in other regions of Septin9 gene to test digestive tract disease samples in parallel, and compare the detection rates of the two compositions for digestive tract disease.

Composition 5:

forward primer SEQ ID No. 15: 5'-GTAGTAGTTAGTTTAGTATTTATTTT-3'

Reverse primer SEQ ID No. 16: 5'-CCCACCAACCATCATAT-3'

Probe SEQ ID No. 17: 5'-GAACCCCGCGATCAACGCG-3', respectively;

for 50 patients with digestive tract diseases and 50 normal human volunteers (all detected by imaging or endoscope to determine that there is no digestive tract cancer, precancerous disease or precancerous lesion), composition 1 and composition 5 were detected in parallel, respectively, and the detection sample was plasma (1.2-3.5 mL), and free DNA in each sample was extracted. The extraction of DNA can be carried out by any standard means in the prior art, and specifically, in the present comparative example, all the sample DNAs were obtained by using a nucleic acid extraction reagent of Boerchi (Beijing) science and technology Co., Ltd.

Then, the detection system of example 1 was added to the DNA samples of the above-mentioned 50 persons with digestive tract diseases and 50 normal human volunteers, and the Septin9 gene was detected using composition 1 and composition 5(SEQ ID Nos.15-17), respectively, to compare the difference in detection sensitivity and the difference in false positive between the two compositions.

The PCR amplification conditions adopted in this experimental example were: real-time PCR was performed on a Life Technologies instrument (7500 Fast). PCR reaction mixtures were performed with bisulfite converted DNA template 25. mu.l and 450nM primers, 225nM probe, 1UTaq polymerase, 200 μm dNTPs, 4.5mM MgCl₂And 2 XPCR buffer to a final volume of 50. mu.l. The samples were amplified with pre-cycling at 94 ℃ for 20 minutes, followed by 5 seconds of 45 cycles of annealing at 62 ℃, 35 seconds at 55.5 ℃ and 30 seconds of denaturation at 93 ℃.

Finally, 50 persons with digestive tract disorders were subjected to interpretation of results based on the Cutoff value of the kit (. ltoreq.41.0) (Table 7) with 30 methylation positive cases for composition 1 and 60.00 positive cases and 15 methylation positive cases for composition 5(SEQ ID Nos.15-17) and 30.00 positive cases. For the known population with digestive tract disorders, the detection rate of composition 1 was significantly better than the composition of other regions of the Septin9 gene, such as composition 5.

Results were read from 50 normal human volunteers (Table 8) based on the Cutoff value of the kit (. ltoreq.41.0), with 1 methylation positive composition 1, a false positive rate of 2.00%, and 4 methylation positive compositions 5(SEQ ID Nos.15-17), a positive rate of 8.00%. For the known normal population, the false positive of composition 1 was significantly better than the composition of other regions on the Septin9 gene, such as composition 5.

TABLE 7 comparison of the Effect of composition 1 on the test of the digestive tract diseases with the composition of the other region of Septin9 Gene

TABLE 8 comparison of the effects of composition 1 and other regions of Septin9 gene for testing normal population

Although the present invention has been described to a certain degree, it will be apparent that appropriate variations of the respective conditions (e.g., the Cutoff value may be adjusted for screening applications depending on the application) may be made without departing from the spirit and scope of the invention. It is to be understood that the invention is not limited to the described embodiments, but is to be accorded the scope consistent with the claims, including equivalents of each element described.

Sequence listing

<110> Boercheng (Beijing) science and technology Limited

<120> a composition of healthy epigenomics and uses thereof

<130>PB00215

<141>2019-10-21

<160>17

<170>SIPOSequenceListing 1.0

<210>1

<211>19

<212>DNA

<213>Artificial Sequence

<400>1

tgtttgttag tcgcgtgcg 19

<210>2

<211>19

<212>DNA

<213>Artificial Sequence

<400>2

aaattctcta tcaccgccgc 20

<210>3

<211>20

<212>DNA

<213>Artificial Sequence

<400>3

cgcgcgctct acgcctacaa 20

<210>4

<211>18

<212>DNA

<213>Artificial Sequence

<400>4

gtcgcgtttt tcgtcgtt 18

<210>5

<211>20

<212>DNA

<213>Artificial Sequence

<400>5

ctaaacacac gaccgaaacg 20

<210>6

<211>18

<212>DNA

<213>Artificial Sequence

<400>6

cccgcctaac ccgcgccc 18

<210>7

<211>19

<212>DNA

<213>Artificial Sequence

<400>7

cgggcggagt agttagtgc 19

<210>8

<211>21

<212>DNA

<213>Artificial Sequence

<400>8

ctcccgaacg aatcaaattc c 21

<210>9

<211>19

<212>DNA

<213>Artificial Sequence

<400>9

cgcacccgca ccgacctcc 19

<210>10

<211>18

<212>DNA

<213>Artificial Sequence

<400>10

ttcgttgaga gcgtcgcg 18

<210>11

<211>21

<212>DNA

<213>Artificial Sequence

<400>11

gcgcaaaatc tacgcgaata c 21

<210>12

<211>23

<212>DNA

<213>Artificial Sequence

<400>12

cccacgtaaa cgacgcgaac acg 23

<210>13

<211>1540

<212>DNA

<213>Artificial Sequence

<400>13

gaggcgtcgc ccgtccctgg cttctctgac agccgtgttc catccccgcc ctgtgcccct 60

tctcccggac agtgccttct ccagggctca cccaggaggg tgcagcggtg gcccccgggg 120

cggtggtcgt ggtgggggtg ttagctgcag gggtgccctc ggtgggtggg agttggtggc 180

ctctcgctgg tgccatggga ctcgcatgtt cgccctgcgc ccctcggctc ttgagcccac 240

aggccgggat cctgcctgcc agccgcgtgc gctgccgttt aacccttgca ggcgcagagc 300

gcgcggcggc ggtgacagag aactttgttt ggctgcccaa atacagcctc ctgcagaagg 360

accctgcgcc cggggaaggg gaggaatctc ttcccctctg ggcgcccgcc ctcctcgcca 420

tggcccggcc tccacatccg cccacatctg gccgcagcgg ggcgcccggg gggaggggct 480

gaggccgcgt ctctcgccgt cccctgggcg cgggccaggc ggggaggagg ggggcgctcc 540

ggtcgtgtgc ccaggactgt cccccagcgg ccactcgggc cccagccccc caggcctggc 600

cttgacaggc gggcggagca gccagtgcga gacagggagg ccggtgcggg tgcgggaacc 660

tgatccgccc gggaggcggg ggcggggcgg gggcgcagcg cgcggggagg ggccggcgcc 720

cgccttcctc ccccattcat tcagctgagc cagggggcct aggggctcct ccggcggcta 780

gctctgcact gcaggagcgc gggcgcggcg ccccagccag cgcgcagggc ccgggccccg 840

ccgggggcgc ttcctcgccg ctgccctccg cgcgacccgc tgcccaccag ccatcatgtc 900

ggaccccgcg gtcaacgcgc agctggatgg gatcatttcg gacttcgaag gtgggtgctg 960

ggctggctgc tgcggccgcg gacgtgctgg agaggaccct gcgggtgggc ctggcgcggg 1020

acgggggtgc gctgagggga gacgggagtg cgctgagggg agacgggacc cctaatccag 1080

gcgccctccc gctgagagcg ccgcgcgccc ccggccccgt gcccgcgccg cctacgtggg 1140

ggaccctgtt aggggcaccc gcgtagaccc tgcgcgccct cacaggaccc tgtgctcgtt 1200

ctgcgcactg ccgcctgggt ttccttcctt ttattgttgt ttgtgtttgc caagcgacag 1260

cgacctcctc gagggctcgc gaggctgcct cggaactctc caggacgcac agtttcactc 1320

tgggaaatcc atcggtcccc tccctttggc tctccccggc ggctctcggg ccccgcttgg 1380

acccggcaac gggataggga ggtcgttcct cacctccgac tgagtggaca gccgcgtcct 1440

gctcgggtgg acagccctcc cctcccccac gccagtttcg gggccgccaa gttgtgcagc 1500

ccgtgggccg ggagcaccga acggacacag cccaggtcgt 1540

<210>14

<211>1003

<212>DNA

<213>Artificial Sequence

<400>14

cgccctgcgc ccctcggctc ttgagcccac aggccgggat cctgcctgcc agccgcgtgc 60

gctgccgttt aacccttgca ggcgcagagc gcgcggcggc ggtgacagag aactttgttt 120

ggctgcccaa atacagcctc ctgcagaagg accctgcgcc cggggaaggg gaggaatctc 180

ttcccctctg ggcgcccgcc ctcctcgcca tggcccggcc tccacatccg cccacatctg 240

gccgcagcgg ggcgcccggg gggaggggct gaggccgcgt ctctcgccgt cccctgggcg 300

cgggccaggc ggggaggagg ggggcgctcc ggtcgtgtgc ccaggactgt cccccagcgg 360

ccactcgggc cccagccccc caggcctggc cttgacaggc gggcggagca gccagtgcga 420

gacagggagg ccggtgcggg tgcgggaacc tgatccgccc gggaggcggg ggcggggcgg 480

gggcgcagcg cgcggggagg ggccggcgcc cgccttcctc ccccattcat tcagctgagc 540

cagggggcct aggggctcct ccggcggcta gctctgcact gcaggagcgc gggcgcggcg 600

ccccagccag cgcgcagggc ccgggccccg ccgggggcgc ttcctcgccg ctgccctccg 660

cgcgacccgc tgcccaccag ccatcatgtc ggaccccgcg gtcaacgcgc agctggatgg 720

gatcatttcg gacttcgaag gtgggtgctg ggctggctgc tgcggccgcg gacgtgctgg 780

agaggaccct gcgggtgggc ctggcgcggg acgggggtgc gctgagggga gacgggagtg 840

cgctgagggg agacgggacc cctaatccag gcgccctccc gctgagagcg ccgcgcgccc 900

ccggccccgt gcccgcgccg cctacgtggg ggaccctgtt aggggcaccc gcgtagaccc 960

tgcgcgccct cacaggaccc tgtgctcgtt ctgcgcactg ccg 1003

<210>15

<211>26

<212>DNA

<213>Artificial Sequence

<400>15

gtagtagtta gtttagtatt tatttt 26

<210>16

<211>17

<212>DNA

<213>Artificial Sequence

<400>16

cccaccaacc atcatat 17

<210>17

<211>19

<212>DNA

<213>Artificial Sequence

<400>17

gaaccccgcg atcaacgcg 19

Claims

3. The composition of claim 2,

the length of the primer is more than 15bp, preferably 18-24 bp; and

the length of the probe is more than 15bp, preferably 18-30 bp.

4. The composition of claim 2 or 3, wherein the primers and probes are any one or more of compositions 1, 2, 3 and 4:

composition 1:

forward primer SEQ ID No. 1: 5'-TGTTTGTTAGTCGCGTGCG-3'

Reverse primer SEQ ID No. 2: 5'-AAATTCTCTATCACCGCCGC-3'

Probe SEQ ID No. 3: 5'-CGCGCGCTCTACGCCTACAA-3', respectively;

composition 2:

forward primer SEQ ID No. 4: 5'-GTCGCGTTTTTCGTCGTT-3'

Reverse primer SEQ ID No. 5: 5'-CTAAACACACGACCGAAACG-3'

Probe SEQ ID No. 6: 5'-CCCGCCTAACCCGCGCCC-3', respectively;

composition 3:

forward primer SEQ ID No. 7: 5'-CGGGCGGAGTAGTTAGTGC-3'

Reverse primer SEQ ID No. 8: 5'-CTCCCGAACGAATCAAATTCC-3'

Probe SEQ ID No. 9: 5'-CGCACCCGCACCGACCTCC-3', respectively; and

composition 4:

forward primer SEQ ID No. 10: 5'-TTCGTTGAGAGCGTCGCG-3'

Reverse primer SEQ ID No. 11: 5'-GCGCAAAATCTACGCGAATAC-3'

Probe SEQ ID No. 12: 5'-CCCACGTAAACGACGCGAACACG-3' are provided.

5. A kit for screening the digestive tract for risk of cancer, digestive tract precancerous lesions, and digestive tract precancerous conditions, the kit comprising the composition of any one of claims 1 to 4.

6. The kit of claim 5, wherein the pre-cancerous lesions and diseases of the digestive tract are one or more of pre-cancerous lesions and diseases of the oesophagus, stomach, intestine, liver and pancreas.

7. The kit of claim 6, wherein the esophageal precancerous lesions and precancerous conditions comprise: chronic esophagitis, Barrett's esophagus, leukoplakia of the esophagus, diverticulum of the esophagus, achalasia of the cardia, reflux esophagitis.

8. The kit of claim 6, wherein the gastric precancerous lesions and precancerous conditions include: atrophic gastritis, polyp, gastric ulcer, xanthoma, intestinal metaplasia.

9. The kit according to claim 6, wherein the precancerous and precancerous lesions of the intestinal cancer include: ulcerative colitis, large intestine polyposis, large intestine adenoma, Crohn's disease.