CN101160411A - Methods and nucleic acids for analyses of cellular proliferative disorders - Google Patents

Abstract

Aspects of the invention provide methods, nucleic acids and kits for detecting, or for detecting and distinguishing between or among liver cell proliferative disorders or for detecting, or for detecting and distinguishing between or among colorectal cell proliferative disorders. Particular aspects disclose and provide genomic sequences the methylation patterns of which have substantial utility for the improved detection of and differentiation between said class of disorders, thereby enabling the improved diagnosis and treatment of patients.

Description

The method of analyses of cellular proliferative disorders and nucleic acid

Invention field

The present invention relates in morbid state, show the genome sequence of the expression pattern of change with respect to standard state.Specific embodiment provides method, nucleic acid, nucleic acid array and the test kit etc. of detection or detection and discriminate between cells proliferative disorders.Preferably, the method, nucleic acid, nucleic acid array and the test kit that are used to detect with the diagnosis cell proliferative disorders can be used for diagnosing cancer, especially colorectum and/or liver cancer.

The reference of related application

The application requires the U.S. Provisional Patent Application 60/672,242 submitted on April 15th, 2005; Submitted on May 2nd, 2005 60/676,997; Submitted on July 8th, 2005 60/697,521; Submitted on August 1st, 2005 60/704,860; Submitted on August 17th, 2005 60/709,318; Submitted on October 4th, 2005 60/723,602; And on March 30th, 2,006 60/787,402 the right of priority submitted, all incorporate their integral body into this paper in the reference mode.

Sequence table

The sequence table that requires according to 37 C.F.R. § 1.52 (e) (5) is providing with CD () as the 1.82MB text, and title is " 47675-187 Sequence Listing.txt ", incorporates its integral body into this paper by the reference mode.

Background

The sickness rate of cancer and diagnosis.Cancer is deputy underlying cause of death in the U.S..If current screening method is in patient's conformability, susceptibility and be easy to improve to some extent aspect the screening, then mortality ratio can have clear improvement.It generally is expensive that existing suggestion is used for the method for diagnosing cancer, and is unsuitable for as the extensive filler test of crowd.

Hepatocellular carcinoma (HCC) is the 4th a common cancer in the world, its incidence from 2.1 of per 100,000 philtrums of North America to 80 of per 100,000 philtrums of China.In the U.S., had 17,550 new diagnosed SARS cases and 15,420 people according to estimates in 2005 therefore dead.The diagnostic assessment that liver is ultrasonic, α alpha-fetoprotein level and conventional CT scan are generally used for HCC (liver cell or primary hepatic carcinoma) can not be used for detecting multifocal little damage and be used to make treatment plan but they are too insensitive usually.

In the U.S., the annual morbidity of colorectal carcinoma is approximately 150,000, has every year 56,600 individualities to die from colorectal carcinoma.The lifelong risk (lifetimerisk) of colorectal carcinoma is about 5 to 6% in ordinary group.Although having many effort aspect screening and the early detection colorectal carcinoma recent years, a lot of so far cases are still in the late period with part or distant metastasis and are diagnosed.Although treatment selects to comprise operation and auxiliary or the chemotherapy of appeasing property, a lot of patients still die from the progress of their cancers in some months.Identify that the developing molecule variation of colorectal carcinoma can help to develop new monitoring, screening, diagnosis and treatment means, they can improve the total poor prognosis of these patients.

According to American Cancer Society, the existing guidance that is used for colorectum screening is to use one of five kinds of means of different to screen at 50 years old or bigger age average risk individuality.These means comprise 1) annual fecal occult blood test (FOBT), 2) carried out the flexibility sigmoidoscopy in per 5 years, 3) Mei Nian FPBT adds per 5 years flexibility sigmoidoscopy, 4) per 5 years DCBE or 5) per 10 years colonoscopy.Although these test procedures are accepted extensively by medical circle, implement the extensive screening of colorectal carcinoma is not also realized.Because relevant with these operations is uncomfortable or inconvenient, patient's compliance is the principal element that restriction is used.Although the FOBT test is the Noninvasive operation, need preceding 3-5 days diet of test and other restriction.The sensitivity levels of these tests is also very low for colorectum gland cancer, depend on the test and have than great fluctuation process.Because it is most of adenomas are not hemorrhage, then poorer for the susceptibility that detects adenoma is measured.On the contrary, because observe directly the inner chamber of colon, the susceptibility of more invasive operation such as sigmoidoscopy and colonoscopy is then quite high.The validity of these technology has been assessed in nonrandom test, removes the reduction that adenomatous polyp will cause CRC sickness rate 76-90% but be to use the data of case control study and shown from the data of national polyp research (National Polyp Study) (U.S.).The limitation of sigmoidoscopy is only to observe the left side of colon, and the damage of right side colon is not detected.Two kinds of microscopy operations all are expensive, require to use the cathartic preparation, and have the M ﹠ M risk of increase.Obviously, the general extensive screening of colorectal carcinoma become common before, need have increase susceptibility, specificity, be easy to use and the retrofit testing of the expense that reduces.

Early stage colorectum detects and is based on the fecal occult blood test (FOBT) that carry out every year on the asymptomatic individuality usually.Current suggestion by the several medical organization reorganizations that comprise American Cancer Society requires the fecal occult blood test in ages 50 beginning, and annual the repetition no longer can be benefited from examination until the patient.Positive FOBT causes the colonoscopy to intestines; This is expensive and invasive operation, has in per 5,000 inspections 1 severe complication sickness rate.Have only 12% patient when colonoscopy, to be diagnosed as cancer or big polyp with the positive stool of protoheme.The many FOBT of studies show that examinations do not improve cancer relevant mortality ratio or overall survival.Compliance to fecal occult blood test is very poor, and being less than 20% colony provides or finish FOBT by suggestion.If FOBT finishes rightly, then the patient collects the excrement sample from the bowel movement of three orders.When the patient defers to diet guide and avoid the known medicine that causes hidden gastrointestinal hemorrhage, obtain sample.In fact, the doctor does not usually instruct the patient rightly, and the patient usually carries out not according to test plan, and some patients to find to collect the task of stool sample very difficult or unhappy, thereby the compliance relevant with the fecal occult blood test is very poor.If can then can reduce the frequency of test with respect to current method improvement test susceptibility and specificity, eliminate and collect sample continuously, eliminate diet and medicine planned change and improve patient's compliance.That follows the compliance problem also has, and the susceptibility and the specificity of FOBT detection colorectal carcinoma are very poor.The specificity of difference causes unnecessary colonoscopy, makes colon cancer screening increase suitable expense.

The specificity of FOBT has been calculated as at the most 96%, and susceptibility is 43% (adenoma) and 50% (colorectal carcinoma).Adopting immunoassay FOBT can improve susceptibility, is " InSure as trade mark ^TM" product, have improved susceptibility 77% (adenoma) and 88.9% (colorectal carcinoma).

The molecule disease marker.The molecule disease marker has several advantages than the mark of other type, even an advantage is that the sample that very little sample of sample size and/or weave construction are not kept also can be analyzed quite effectively.In nearest 10 years, a lot of genes have been presented at differential expression between normal and the colorectal carcinoma.But not having the combination of unique identification thing or mark to be proved is enough to diagnosing colon cancer.Being proved recently based on the method for large size mRNA (High-dimensional mRNA) to provide better means to distinguish different tumor types and optimum and malignant change.But, application in clinical setting is hindered by following reason as the routine diagnosis instrument for it: the extreme instability of mRNA, some trigger the expression that occurs fast under thing effect change (for example sample collection) and, more importantly, analyzing needs a large amount of mRNA (Lipshutz, R.J. wait the people, Nature Genetics 21:20-24,1999; Bowtell, D.D.L Naturegenetics suppl.21:25-32,1999), it can not obtain from conventional biopsy usually.

Advised using biomarker further to improve susceptibility and the specificity of FOBT, the example of this class testing comprises can be from the PreGen-Plus of EXACT Sciences acquisition ^TMThe stool analytical test, it has the susceptibility of 20% (gland cancer) and 52% (colorectal carcinoma), and specificity is 95% under two kinds of situations.The existence of 23 kinds of dna mutations that this measurements determination is relevant with the generation of colon knurl.Is known with dna methylation as the colorectal carcinoma mark.For example, people such as Sabbioni (Molecular Diagnosis 7:201-207,2003) detect the supermethylation of one group of gene being made up of TPEF, HIC1, DAPK and MGMT in 98% colorectal carcinoma patient peripheral blood.But this unpromising commercial test that can the marketization provide suitable basis, because also enough height of the specificity of this test.

The progressively progress of tending to adenoma is given birth in the PI haircut of colorectal carcinoma, and it comprises the generation of anormogenesis and final invasive cancer sign.The molecule that takes place with this adenoma-carcinoma sequence changes heredity and the epigenetic variation that comprises tumor suppressor gene (APC, p53, DCC), and activation of oncogene (K-ras) and dna mismatch are repaired the inactivation of gene.Recently, other molecule variation and hereditary defect have been disclosed again.Thereby the activation of Wnt signal path not only comprises the sudden change of apc gene, also can be caused by beta-catenin white (catenin) sudden change.In addition, the generation with colorectal carcinoma is relevant together with the change of its signal transducer SMAD4 and SMAD2 for TGF-signal path.

Although the progress aspect the pathology of understanding adenoma of colon and cancer and their heredity and molecule variation is arranged, understand aspect heredity in shift taking place and the epigenetic variation not enough.Yet, widely acceptedly be, the proteolysis of invasion procedure and extracellular matrix and infiltration basement membrane of blood vessel relate to for example member of integrin receptor family of attachment proteins, cadherins, immunoglobulin superfamily, layer sticking connection protein-binding protein and CD44 acceptor.Except adhering to, shift the process that forms also comprise induce and regulate blood vessel take place (VEGF, bFGF), inducing cell propagation (EGF, HGF, IGF) and activated protein lytic enzyme (MMPs, TIMPs, uPAR) and suppress apoptosis (Bcl-2, Bcl-X).Recently, other research group will shift heredity in the damage and molecule change with the primary colorectal carcinoma in the variation found compare.Like this, people such as Kleeff has reported at former and has shifted the disappearance of candidate's tumor suppressor gene DOC-2 in the colorectal carcinoma.In addition, people such as Zauber are reported in their a series of 42 colorectal carcinomas, and Ki-ras sudden change is identical in whole 42 pairs former and transitivitys simultaneously damage in the primary carcinoma disease.Similarly, the loss of heterozygosity in APC site is identical in 39 pairs of cancers and the metastasis of while.These authors reach a conclusion, and for Ki-ras and apc gene, are identical in the heredity variation in metastasis and the primary colorectal carcinoma.But other group finds that heredity and the molecule in the transitivity colorectal carcinoma changes, but they are not present in the primary carcinoma.Reported the appearance of the LOH of karyomit(e) 3p in the colorectum metastasis like this.In addition, use comparative genome hybridization, find several variations in the hepatic metastases kitchen range be shift damage exclusive (9q ,-11q and-17q).

The CpG island methylates.Except sudden change, the abnormal methylation on CpG island has been proved and has caused with the pathology of multiple cancer relevant gene transcription silence taking place before some.The CpG island is the short sequence that is rich in the CpG dinucleotides, usually is found in 5 ' zone of whole Human genomes of about 50%.Methylating of cytosine(Cyt) causes genetic expression forfeiture in these islands, and in the inactivation of X chromosome and genomic imprinting report arranged.

Recently, several research groups have also analyzed several genes methylating in colorectal carcinoma, and report is by promoter methylation Transcriptional Silencing p16INK4, p14ARF, p15INK4b, MGMT, hMLH1, GSTP1, DAPK, CDH1, TIMP-3, APC or the like.Therefore, except some gene of sudden change inactivation, the hyper-methylation of these genes has also significantly promoted the pathology of these diseases to take place.

In the last few years, methylated several genes were differentiated by MS-APPCR in colorectal carcinoma.Except other, also comprise TPEF/HPP1 in these genes, it is usually methylated in colorectal carcinoma, and identified by two different groups' employing MS-APPCR methods (referring to, Young J for example, Biden KG, Simms LA, Huggard P, Karamatic R, Eyre HJ, Sutherland GR, Herath N, Barker M, Anderson GJ, Fitzpatrick DR, RammGA, Jass JR, Leggett BA.HPP1:a transmembrane protein-encoding genecommonly methylated in colorectal polyps and cancers (the transmembrane protein encoding gene is methylated usually in colorectal polyp and cancer) .Proc Natl Acad Sci USA98:265-270,2001).

The multiplefactor approach.Traditionally, cancer diagnosis depends on and detects single molecular marker (for example transgenation, the PSA level of rising).Regrettably, cancer is so a kind of morbid state, and wherein the unique identification thing can not detect or distinguish the disease of various ways usually.Therefore, the mensuration of only discerning single mark has been proved the predictive value that only has limit.Main aspect of the present invention is, uses by the selection of multiple mark, monitors this class disease based on methylated cancer diagnostics and examination, diagnosis and therapeutic and can provide obvious improvement with respect to the prior art of using the analysis of unique identification thing.This multi-way analysis approach is particularly suitable for cancer diagnosis, because cancer is not simple disease, this polyfactorial " group's group (panel) " approach is at cytology and heterogeneous consistent with cancer all clinically.

Successfully this group of methods is used for being to design and develop the mark group group of the optimization that can characterize and distinguish morbid state based on the key of methylated diagnostic test.The invention describes multiple especially effective and unique gene cluster group, the methylation analysis of the one or more members combination of this group's group is made and can detect the colon cell proliferative disorders with extra high susceptibility, specificity and/or predictive value.

The exploitation of medical science test.Two critical appreciable measurements of any medical screening or diagnostic test are its susceptibility and specificity, its weigh this test omit ground accurately detect all affected individuals and will not have the individuality of target disease to be included mistakenly (predictive value) carry out have how good.In history, any diagnostic detection is in the dock all is because relatively poor susceptibility and specificity.

True positives (TP) result is the situation that test is positive and this morbid state exists.False positive (FP) result tests positive but the non-existent situation of this morbid state.True negative (TN) result is the negative and non-existent situation of this morbid state of test.False negative (FN) result tests negative but the non-existent situation of this morbid state.In this: susceptibility=TP/ (TP+FN); Specificity=TN/ (FP+TN) and predictive value=TP/ (TP+FP).

Susceptibility is to the correct measurement that detects the power of test of target disease of test in the individuality of being tested.Test with relatively poor susceptibility produces a high proportion of false negative, and promptly individuality has this disease, but by wrong not this specified disease that is accredited as.False-negative potentially dangerous is that this diseased individuals still remains and can not diagnose and do not treat for some time, may advance to late period in this disease during this period of time, even at this moment methods of treatment is arranged, effect also may be not too effective.Example with test of Wheat Protein is based on proteic HIV blood testing.Such test demonstrates relatively poor susceptibility, because it is established and virus can not detect existing of virus before with a great deal of intrusion blood flow fully in disease.On the contrary, the example with test of hypersensitivity detects for the virus load that adopts polymerase chain reaction (PCR).Because such test can detect very small amount of virus, so obtain high susceptibility.When the consequence of missed diagnosis was great, hypersensitivity just was even more important.

On the other hand, specificity is to testing the not measurement of the ability of this morbid state of accurate discriminating patient.Have relatively poor specific test and produce a high proportion of false positive, promptly individual being diagnosed as mistakenly has this disease.False-positive defective is that they force the patient to accept unnecessary medical procedures treatment, and together with their property followed risk, spirit and economic pressures, and it can bring detrimentally affect to patient health.The disease that causes being difficult to develop the diagnostic test with high specific is characterised in that this disease mechanisms (especially in the cancer) is usually directed to several genes and albumen.In addition, some albumen can be because of incoherent former thereby raise with morbid state.Example with test of high specific is the test based on gene that can detect the p53 sudden change.When with further diagnostic operation or further medical science get involved relevant expense or risk when very high, specificity is just very important.

Clear and definite demand of the prior art.Be recognized that and need examination and the early detection of improving cancer in the prior art badly.For example,, the problem of the false positive test results that causes unnecessary colonoscopy be will reduce, the saving of cost and the security of improvement produced if can increase the colon cancer screening specificity.In view of the overall sickness rate of cancer, especially, be sought after the early detection cancer in the prior art with existing colorectum and the relevant shortcoming of hepatocyte growth venereal disease disease screening method, the method for colorectal carcinoma especially is to replenish or to substitute existing test.

Genetic background of the present invention.Human Septin 9 genes (being also referred to as MLL septin sample fusion rotein, MLL septin sample fusion rotein MSF-A, Slpa, Eseptin, Msf, septin sample albumen ovary/mammary gland septin (Ov/Br septin) and Septin D1) are positioned at karyomit(e) 17q25 and are positioned at contig AC068594.15.1.168501In, be the member of Septin gene family.Fig. 1 provides the Ensembl of Septin 9 genes to explain, and has shown 4 transcript variants, Septin9 variant and Q9HC74 variant (it is the clipped form of Septin 9 transcripts).SEQ ID NO:1 provides the sequence of described gene, comprises the zone and the promoter region of Septin 9 and Q9HC74 transcript.SEQ ID NO:2 and SEQ ID NO:3 are its territory, subprovince, provide Septin 9 and Q9HC74 transcript to be rich in the sequence of the promoter region of CpG respectively.

By inference, the member of Septin gene family is relevant with the various kinds of cell function that is transported to division of cytoplasm from the film bubble.The effect that destroys Septin 9 will cause incomplete cell fission, referring to Surka, and M.C, Tsang, CW, and Trimble, W.S.Mol Biol Cell, 13:3532-45 (2002).Septin 9 and other albumen have been shown as the fusion partner molecule (fusion partner) of proto-oncogene MLL, and this has shown the effect in tumour takes place, referring to Osaka, M, Rowley, J.D. and Zeleznik-Le, N.J.PNAS, 96:6428-6433 (1999).People such as Burrows have reported the further investigation to the multiple subtype expression of 9 genes of Septin in the ovarian cancer, have shown the tissue specificity of multiple transcript, referring to Burrows, J.F., people such as Chanduloy, S.E.H.Journal of Pathology, 201:581-588 (2003).

Express show that above 7000 researchs (prior art of delivering behind the priority date) normal and tumor tissues Septin 9 hypotypes are crossed all the time in several tumor tissues in the recent period, referring to Scott, M., Hyland, P.L. wait the people, Oncogene, 24:4688-4700 (2005).These authors consider that this gene is likely II type oncogene, and wherein the adjusting of different protein products has been controlled in the variation of this processing of rna transcription, and the level of the protein subunit of these changes can furnish an answer for the effect of gene in the malignant tumour.

Also participated in carcinogenesis (referring to WO99/31233) from MSF (migration stimulating factor) albumen of FN1 genetic transcription, but it should be noted that this albumen is not the application's theme, unknown at present it is relevant with Septin 9/MSF gene and transcription product thereof.

From reference cited above as can be seen, connect described gene and tumorigenic biomechanism is still unclear.In WO 200407441, claim that the copy number of the increase of this gene is a cancer markers with crossing expression, and further provide the means of diagnosing and treating this cancer according to this observations.Correspondingly, WO 200407441 is immediate prior aries, because itself and method of the present invention and nucleic acid have the common trait of maximum numbers, and it relates to same area (cancer diagnosis).The key distinction of the present invention and WO 200407441 be the present invention show first gene Septin 9 owe express (under-expression) relevant with cancer.More specifically, this illustrates by methylation analysis.The dependency of expression and dna methylation, and be used for determining that the method for dna methylation is known (referring to WO99/28498) in the prior art.But this owes to express generation with cancer relevant is not apparent for those skilled in the art, especially WO 200407441 described described expression is adjusted to low-level as potential treatment to cancer.

SEQ ID NO:28 provide be positioned on the karyomit(e) 17q at Vitronectin (VTN, OMIM 193190, accession number NM_000638) and the sequence that is rich in CpG in the overlapping promoter region of SARM gene (Steril Alpha AndHeat/Armadillo Motifs-Containing Protein, OMIM 607732).

The glycoprotein of VTN genes encoding 75-kD (being also referred to as serum spreading factor or complement S albumen), this glycoprotein promotes zooblast in external adhesion and expansion, suppress cytolysis, and in the blood aggegation, regulate Antithrombin III-thrombin action by complement C5b-9 mixture.In colon cancer cell, observe higher Vitronectin and express (Exp Cell Res.1994Sep; 214 (1): 303-12.).In addition, this expression of gene is relevant with the progress and the invasive of cancer cells.Show that VTN is activated in tumour, vitronectin can reduce tumour size (Bloemendal HJ by the specific peptide blocking-up, de Boer HC, Koop EA, van Dongen AJ, Goldschmeding R, Landman WJ, Logtenberg T, Gebbink MF, Voest EE.Cancer Immunol Immunother.2004 Sep; 53 (9): 799-808.; Haier J, Goldmann U, Hotz B, Runkel N, Keilholz U.Clin Exp Metastasis.2002; 19 (8): 665-72.).

SARM albumen is formed and is contained the sterile α of 65 amino acid (SAM) structural domain that is surrounded by short HEAT/armadillo tumor-necrosis factor glycoproteins by 690 amino acid.The level that Northern engram analysis demonstration SARM sense-rna can raise in cancerous cell line is detected, with tissue origin or metastatic potential irrelevant (Mink, M.; Fogelgren, B.; Olszewski, K.; Maroy, P.; Csiszar, K.Genomics 74:234-244,2001.).Described research further confirms, the SARM transcript of proteins encoded only studied those in a prostate cancer cell line in express.

SEQ ID NO:24 provide be positioned at that karyomit(e) 3q23 goes up gene jaw transcription factor L2 (OMIM 605597 for FOXL2, the pituitary gland jaw factor) downstream be rich in the CpG sequence.Up to now, also the cancer with any kind of is not relevant for SEQ ID NO:1.The FOXL2 coding region is high conservative in Mammals, and the immunohistochemistry evidence shows that FOXL2 is the nucleoprotein of expressing specifically in eyelid and fetus and adult's ovary follicle cell.This show FOXL2 may ovary somatocyte differentiation and further folliculus grow and/or keep in work (J.Med.Genet.39:916-922,2002.).

In addition, the sudden change in the FOXL2 gene is relevant with blepharophimosis/ptosis/epicanthus/swinging to property epicanthus syndrome (BPES), and this syndrome has influence on eyelid and ovary (Am.J.Hum.Genet.72:478-487,2003.; Hum.Mutat.24:189-193,2004).Therefore, up to the present, FOXL2 is not relevant with cancer, but other FOX family member has participated in the cancer generation.The FOXA1 gene is amplified and crosses expression in oesophagus and lung cancer, the FOXM1 gene raises in carcinoma of the pancreas and rodent cancer, and this is owing to pass through the transcriptional regulatory of SonicHedgehog (SHH) approach.

SEQ ID NO:27 represents the part of Six6 (homeobox Protein S IX6) gene, be positioned on the karyomit(e) 14q, another name comprises homeodomain protein OPTX2, eyesight homeobox 2, OPTX2, the special-shaped box homologue 6 of Sine eye homology, the special-shaped box homologue of sine eye homology 6 (fruit bats), Six9, SIX9.The Six6 gene is relevant with development pathway, and its unconventionality expression takes place relevant with the acute lymphocytoblast leukemia of T cell cancer.

SEQ ID NO:25 is positioned on the karyomit(e) 17q21.31, and (trk C is also referred to as p75, part OMIM162010) to comprise the promoter region of NGFR gene and NGFR gene self.NGFR separately or with other acceptor combination after be attached to neurotrophic factor and the outside growth inhibiting factor of spinous process.Confirmed that NGFR is at apoptosis, peripheroneural myelinization and suppress work in the regeneration of axoneure behind the axonal injury (Dobrowsky, R.T.; Werner, M.H.; Castellino, A.M.; Chao, M.V.; Hannun, Y.A.Science 265:1596-1599,1994; Cosgaya, J.M.; Chan, J.R.; Shooter, E.M.Science 298:1245-1248,2002; Wang, K.C; Kim, J.A.; Sivasankaran, R.; Segal, R.; He, Z.Nature 420:74-78,2002.).Before the methylating of NGFR gene with the generation relevant (PCT/US04/020336) of colorectal carcinoma.

SEQ ID NO:26 is positioned on the karyomit(e) 1,7q2 1.31, comprises the promoter region of gene TMEFF2.The Cancer Res.2000 Sep1 that is associated with colorectal carcinoma that methylates of TMEFF2; 60 (17): 4907-12.

Summary of the invention

The invention provides the method for cell proliferative disorders in detection and/or the classification individuality, comprise and determine to separate at least a Septin of being selected from 9 (comprising the transcript variant that they are all), FOXL2, SARM1, VTN, PRDM6, NR2E1, FAT and the gene of SEQ ID NOS:160 to SEQ ID NO:165 or the expression level of genome sequence in the biological sample of described individuality, wherein owe to express (underexpression) and/or CpG and methylate and show that described illness exists or its kind.Many aspects of the present invention provide effective and unique genetic marker, and the expression analysis to described mark makes and can detect cell proliferative disorders with extra high susceptibility, specificity and/or predictive value thus.In addition, described mark makes and can distinguish cancerous cells proliferative disorders (comprising the preceding situation of cancer) and benign cell proliferative disorders.Mark of the present invention is particularly suitable for detecting colorectal carcinoma and hepatocellular carcinoma.Aspect colorectal carcinoma, testing method of the present invention is particularly useful for the examination of risk population.Method of the present invention is better than the method (FOBT that comprises standard in the industry) of prior art, because the susceptibility of its improvement, specificity and possible patient's compliance.

Method of the present invention and nucleic acid most preferably are used to detect liver cancer or itself and other hepatocyte growth venereal disease disease are distinguished, and perhaps are used to detect the preceding colorectal cell proliferative disorders of colorectal carcinoma or cancer.

In one embodiment, the invention provides the method for cell proliferative disorders in detection and/or the classification individuality, comprise and determine to separate at least a Septin of being selected from 9 (comprising the transcript variant that they are all), FOXL2, SARM1, VTN, PRDM6, NR2E1, FAT and the gene of SEQ ID NO:160 to SEQ ID NO:165 or the expression level of genome sequence in the biological sample of described individuality, wherein owe to express and/or CpG to methylate be that described illness exists or the indication of its kind.In one embodiment, described expression level is transcribed from the mRNA of described gene by detection and whether is existed or level is determined.In another embodiment, the existence of the polypeptide of described expression level by detecting described gene or its sequence encoding whether or level determine.

In another embodiment preferred, described expression methylates and whether exists to determine by detecting in the described gene CpG, and wherein existing methylates shows and have cell proliferative disorders.Said method comprising the steps of: i) make from the biological sample that derives from described individuality and (preferably be selected from blood plasma, serum, whole blood, isolating hemocyte, the cell that separates autoblood) isolating genomic dna contacts with at least a reagent or one-tenth group reagent in, described at least a reagent or in groups reagent area divide and methylate at least one target region of described genomic dna and methylated CpG dinucleotides not, the nucleotide sequence of wherein said target region comprises at least a Septin of being selected from 9 (comprising the transcript variant that they are all), FOXL2, SARM1, VTN, PRDM6, NR2E1, the gene of FAT and SEQ ID NOS:160 to SEQ ID NO:165 or at least one CpG dinucleotides sequence of genome sequence; And ii) detect at least in part and/or the cell proliferative disorders of classifying.Preferably, described target region comprises or the sequence of 16 continuous nucleotides of the sequence of the hybridization at least a SEQ of being selected from ID NO:1 to SEQ ID NO3, SEQ ID NO:24, SEQ ID NO:28, SEQ ID NO:159 to SEQ ID NO:167 under stringent condition at least.

Preferably, the susceptibility of described detection is about 75% to about 96%, or about 80% to about 90%, or about 80% to about 85%.Preferably, described specificity is about 75% to about 96%, or about 80% to about 90%, or about 80% to about 85%.

Described method is novel, because there is not method to detect cancer by analysing body fluid at present, and has sufficiently high susceptibility and specificity to be used in viable commercial and mensuration administration's permission.For example, existingly be used to detect and the method for diagnosis of colorectal cancer comprises colonoscopy, sigmoidoscopy and fecal occult blood colorectal carcinoma.Compare with these technology, disclosed invention is littler than the invasive of colonoscopy, and as the specificity of (if not being higher than) sigmoidoscopy and FOBT.The PDT R﹠D Representative of humoral determination than existing method well known in the prior art tangible technical superiority is arranged, it is at least for the colorectum cancer screening, and the patient can be higher than three stool that are used for FOBT of being recommended at present to the compliance of single test based on body fluid and analyze.

As further instruction, be used to detect the cytology examination that comprises PET and MRI imaging and aspirate or biopsy with the existing method of diagnosing liver cancer.The radiology screening method does not detect cancer usually in early days, and implements expensive and consuming time.The relevant risk of cytology examination existence and biopsy (internal hemorrhage) and suction (needle tracking disseminates and hemorrhage, choleperitonitis and pneumothorax).Thereby stage detection cancer is still impossible at present in early days, and because early detection is improved patient's prognosis greatly, so need such examination test in the prior art badly.

In specific embodiment, described method comprise the gene that uses at least a Septin of being selected from 9 (comprising the transcript variant that they are all), FOXL2, SARM1, VTN, PRDM6, NR2E1, FAT and SEQ ID NO:160 to SEQ ID NO:165 or genome sequence as a token of thing detect and distinguish cell proliferative disorders.The present invention is particularly suitable for detecting cancerous cells proliferative disorders (being included in the cancer last stage).In addition, method of the present invention and nucleic acid make and can distinguish malignant cell proliferative disorders and benign cell proliferative disorders.Method of the present invention and nucleic acid are especially effective in detecting colorectum or liver cancer venereal disease disease and precancerosis disease.In addition, they distinguish carcinous and benign cell proliferative colorectum and liver cell illness in useful.

The purposes of described gene can be by to any analysis of genetic expression, realize by mRNA expression analysis or protein expression analysis.But, in most of preferred embodiment of the invention, be that the methylation state of gene by analyzing at least a Septin of being selected from 9 (comprising the transcript variant that they are all), FOXL2, SARM1, VTN, PRDM6, NR2E1, FAT and SEQ ID NO:160 to SEQ ID NO:165 or genome sequence and promotor or regulatory element is realized distinguishing and discriminating colorectal rectum or hepatocyte growth venereal disease disease.

The invention provides the method for the analysis of biological samples feature relevant, methylate with the reagent of methylated CpG dinucleotides in described method feature is to make the nucleic acid of at least a SEQ of being selected from ID NO:1 to SEQ IDNO:3, SEQ ID NO:24, SEQ ID NO:28, SEQ ID NO:159 to SEQ IDNO:167 or its fragment and can distinguishes described genome sequence or aim sequence or become group reagent not contact with the generation of cell proliferative disorders.

The invention provides the method for the epigenetic parameter relevant of determining genomic dna with knurl sexual cell proliferative disorders (for example cancer).Described method is being improved diagnosis, is being treated and monitor and practicality is arranged aspect the described disease.

Preferably, the source of specimen is selected from cell or clone, Histological section, biopsy, paraffin-embedded tissue, body fluid, seminal fluid, ight soil, urine, blood and combination thereof.More preferably, described source is selected from ight soil, blood plasma, serum, whole blood, isolating hemocyte, isolated cells from the blood that derives from described individuality.

Particularly, the invention provides and be used to detect the knurl sexual cell proliferative disorders that comprises the early cancer last stage (preferred colorectum and/or liver cell) and be used to distinguish carcinous and the method benign cell proliferative disorders, comprising: the biological sample that obtains to comprise genomic nucleic acids; Described nucleic acid or its fragment are contacted with a kind of reagent or plurality of reagents, described a kind of reagent or plurality of reagents are enough to distinguish interior the methylating and unmethylated CpG dinucleotides sequence of at least a target sequence of described individual nucleic acid, the sequence that wherein said target sequence comprises or hybridization comprises at least 16 continuous nucleotides of particular sequence under stringent condition, this particular sequence is selected from SEQ ID NO:1 to SEQ ID NO3, SEQ ID NO:24, SEQ ID NO:28, SEQ ID NO.159 to SEQ ID NO:167 comprises the described continuous nucleotide of at least one CpG dinucleotides sequence; And, determine the methylation state of at least one target CpG dinucleotides sequence, or reflect the average or the value of the average methylation state of a plurality of target CpG dinucleotides sequences at least in part based on described differentiation.

Preferably, to methylate in the target sequence and not the differentiation of methylated CpG dinucleotides sequence comprise that making at least one this class CpG dinucleotides sequence methylation state rely on ground changes or do not change into dinucleotides sequence corresponding transformation or that do not change, described at least one this class CpG dinucleotides sequence is positioned at and is selected from SEQ ID NO:10 to SEQ ID NO:15, SEQ IDNOS:28 to SEQ ID NO:33, SEQ ID NO:30 to SEQ ID NO:31, SEQ IDNO:42 to SEQ ID NO:43, SEQ ID NO:38 to SEQ ID NO:39, SEQ IDNO:50 to SEQ ID NO:51 is in the sequence of SEQ ID NO:168 to SEQ ID NO:203 and its successive zone corresponding to this target sequence.

Other embodiment provides the method for detection cancerous cells proliferative disorders (or distinguish they and benign cell proliferative disorders), especially colorectum or hepatocellular cancerous cells proliferative disorders comprise: the biological sample that obtains to have genes of individuals group DNA; Extract this genomic dna; With one or more agent treated genomic dnas or its fragment, 5 unmethylated cytosine(Cyt) base is converted into uridylic or other can be different from the base of cytosine(Cyt) in nature with detecting in hybridization; Treated genomic dna or its treated fragment are contacted with at least two kinds of primers with the amplification enzyme, described primer all comprise in all cases be complementary to or under medium tight or stringent condition hybridization be selected from SEQ ID NO:10 to SEQ IDNO:15, SEQ ID NO.28 to SEQ ID NO:33, SEQ ID NO:30 to SEQ IDNO:31, SEQ ID NO:42 to SEQ ID NO:43, SEQ ID NO:38 to SEQ IDNO:39, SEQ ID NO:50 to SEQ ID NO:51, the long continuous sequence of at least 9 Nucleotide of SEQ ID NO:168 to SEQ IDNO:203 sequence and complementary sequence thereof, wherein treated DNA or its fragment are amplified to produce amplified production or not to be amplified; And whether or character based on the existence of described amplified production, determine to be selected from SEQ ID NO:1 to SEQ ID NO:3, SEQID NO:24, SEQ ID NO:28, SEQ ID NO:159 to SEQ ID NO:167 sequence at least one, the more preferably methylation state or the average of a plurality of CpG dinucleotides, or reflect the value of the average of its methylation level.

Preferably, determine to comprise at least a following method of using: I) make at least a making nucleic acid molecular hybridization that comprises the continuous sequence of at least 9 length of nucleotides, this continuous sequence be complementary to or under medium tight or stringent condition hybridization be selected from SEQ ID NO:10 to SEQ ID NO:15, SEQID NO:28 to SEQ ID NO:33, SEQ ID NO:30 to SEQ ID NO:31, SEQ IDNO:42 to SEQ ID NO:43, SEQ ID NO:38 to SEQ ID NO:39, SEQ IDNO:50 to SEQ ID NO:51, the sequence of SEQ ID NO:168 to SEQ ID NO:203 and complementary sequence thereof; Ii) make at least a making nucleic acid molecular hybridization that is attached to solid phase, this nucleic acid molecule comprises at least 9 length of nucleotides continuous sequences, the sequence that it is complementary to or hybridization is selected from SEQ ID NO:10 to SEQ ID NO:15, SEQ ID NO:28 to SEQ IDNO:33, SEQ ID NO:30 to SEQ ID NO:31, SEQ ID NO:42 to SEQ IDNO:43, SEQ ID NO:38 to SEQ ID NO:39, SEQ ID NO:50 to SEQ IDNO:51, SEQ ID NO:168 to SEQ ID NO:203 under medium tight or stringent condition; Iii) make at least a making nucleic acid molecular hybridization, this nucleic acid molecule comprise be complementary to or under medium tight or stringent condition hybridization be selected from SEQ ID NOS:10 to SEQ ID NO:15, SEQ ID NOS:28 to SEQ IDNO:33, SEQ ID NOS:30 to SEQ ID NO:31, SEQ ID NOS:42 to SEQ IDNO:43, SEQ ID NOS:38 to SEQ ID NO:39, SEQ ID NOS:50 to SEQ IDNO:51, at least 9 length of nucleotides continuous sequences of the sequence of SEQ ID NOS:168 to SEQ ID NO:203 and complementary sequence thereof, and extend at least one Nucleotide of nucleic acid molecule of at least a this hybridization; And iv) amplified production is checked order.

Other embodiment provides the method for analysis (for example detect and/or classify) cell proliferative disorders, comprising: the biological sample that obtains to have genes of individuals group DNA; Extract this genomic dna; Make to comprise one or more and be selected from the sequence of SEQ ID NO:1 to SEQ ID NO:3, SEQID NO:24, SEQ ID NO:28, SEQ ID NO:159 to SEQ ID NO:167 or under stringent condition, contact with one or more responsive restriction enzymes that methylate with this genomic dna or its fragment of the sequence of its hybridization, wherein this genomic dna digested with produce digestion fragment or not so and digested; And whether or its character based at least a so segmental existence, determine the methylation state of at least one CpG dinucleotides sequence of the genome sequence of at least a SEQ of being selected from ID NO:1 to SEQ ID NO:3, SEQ IDNO:24, SEQ ID NO:28, SEQ ID NO:159 to SEQ ID NO:167, perhaps reflect the average or the value of the average methylation state of its a plurality of CpG dinucleotides sequences.Preferably, described determine before amplification genomic dna that digested or that do not digested.

Other embodiment provides the new genome and nucleotide sequence and the oligonucleotide and/or the PNA oligomer of chemically modified, is used to analyze cytosine methylation patterns having in the sequence that is selected from SEQ ID NO:1 to SEQ IDNO:3, SEQ ID NO:24, SEQ ID NO:28, SEQ ID NO:159 to SEQ IDNO:167.

Brief Description Of Drawings

Fig. 1 has shown the Ensembl people's gene group note of Septin 9 and Q9HC74 gene transcripts.The relative position that has also shown SEQ ID NO:2 and SEQ ID NO:3.

Fig. 2 provides three figure.Two figure on the left side have shown the susceptibility of measuring SEQ ID NO:1 (measuring 2) among the embodiment 2 in the colorectal carcinoma and blood sample.The ROC that the figure on the right provides colorectal carcinoma to detect.

Fig. 3 has shown the methylation level of measuring in other cancer of embodiment 4.

Fig. 4 shows the methylation level of measuring in other non-Cancerous disease of embodiment 4.

Fig. 5 to Figure 29 provides the matrix of the bisul-phite sequencing data of embodiment 5.Every row of this matrix are represented the repetition sequencing data of a sample, and all of each sample repeat to be in the piece.Every row of matrix is represented the single CpG site in the fragment.The CpG digital display of amplified production is shown in the left side of matrix.The methylated amount of each CpG position measurement by from light grey (0% methylates), to ash (50% methylates), represent to grey black (100% methylates).Successfully do not checked order in some amplified productions, sample or CpG position, they are shown as white.

Fig. 5 to Figure 12 provided before 4 quantitatively (to be analyzed by HeavyMethyl) to have in 10% to the 20% methylated sample, transforms the order-checking overview of amplified production according to the bisul-phite of the genome sequence of table 21.

Figure 13 to Figure 20 provided before 2 and quantitatively (has been passed through HeavyMethyl ^TMAnalyze) have and be higher than in the 20% methylated sample, transform the order-checking overview of amplified production according to the bisul-phite of the genome sequence of table 21.

Figure 21 to Figure 22 provides in 3 healthy individual blood samples the order-checking overview that transforms amplified production according to the bisul-phite of the genome sequence of table 21.

Figure 23 to Figure 29 provided before 6 quantitatively (to be analyzed by HeavyMethyl) to have and has been lower than 10% and methylates in the sample of (but being higher than 0%), transformed the order-checking overview of amplified production according to the bisul-phite of the genome sequence of table 21.

Each provides 3 figure Figure 30 to Figure 37.Two figure in left side have shown among the embodiment 2 in the colorectal carcinoma and blood sample the susceptibility according to the mensuration of table 12.The figure of top has shown the bivariate distribution of two kinds of samples, and the figure of below provides the multiclass distribution.The Y-axis of described figure shows the ratio that has greater than the sample by analysis of the methylation level that is presented at the quantitative values on the X-axis.

Detailed description of the invention

Definition:

Term " observation/expection ratio " (" O/E ratio ") refers to the frequency of CpG dinucleotides in specific DNA sequence, corresponding to the belt length (band length) of [CpG number of sites/(the C base is counted x G base number)]/each fragment.

Term " CpG island " refers to satisfy the continuum of the genomic DNA of following standard: (1) is corresponding to the CpG dinucleotide frequency of " observation/expection than "＞0.6, and (2) " GC content "＞0.5. The length on CpG island usually but be not always about 0.2 to about 1KB, or between 2 kb.

Term " methylation state " or " methylation status " refer to that there is or does not exist 5-methylcytosine (" 5-mCyt ") in one or more CpG dinucleotides place in the dna sequence dna. One or more specific CpG methylation state that site (every place has two CpG dinucleotides sequences) locates that methylates comprises " unmethylated ", " permethylated " and " hemimethylated " in the DNA sequence.

Term " half-methylate " or " hemimethylation " refer to the methylation state of double-stranded DNA, wherein only have a chain to be methylated.

When being used in this paper, term " AUC " is the abbreviation of area under a curve (TG-AUC). Particularly, it refers to experimenter's operating characteristic (ROC) area under a curve. The ROC curve is the curve of the relative false positive rate of True Positive Rate, is used for the different possibility critical values of diagnostic test. Sensitiveness and the compromise between the specificity (any raising of sensitiveness all can be attended by specific decline) of selected critical value depended in its demonstration. ROC area under a curve (AUC) is that (area is the bigger the better, and optimum value is 1, and the ROC curve of random test is positioned at diagonal, and area is 0.5 for measurement to the diagnostic test accuracy; Referring to J.P.Egan.Signal Detection Theory and ROC Analysis (signal detection theory and ROC analyze), Academic Press, New York, 1975).

Term " supermethylation " refers to the amount with respect to the 5-mCyt of corresponding CpG dinucleotides place discovery in the normal control DNA sample, the average methylation state that the occurrence rate of one or more CpG dinucleotides 5-mCyt of place increases in the dna sequence dna corresponding to the test dna sample.

Term " hypomethylation " refers to the amount with respect to the 5-mCyt of corresponding CpG dinucleotides place discovery in the normal control DNA sample, the average methylation state that the occurrence rate of one or more CpG dinucleotides 5-mCyt of place reduces in the dna sequence dna corresponding to the test dna sample.

Term " microarray " is accepted ground such as this area in a broad sense, refers to " dna microarray " and " DNA chip ", comprises the solid support that all have been approved, and comprises for nucleic acid molecules is thereon attached or all methods of nucleic acid thereon.

" genetic parameter " is sudden change and the polymorphism of gene and sequence, for their adjusting further required. The especially insertion, deletion, point mutation, inversion and the polymorphism that are considered to suddenly change, and especially preferred SNP (SNP).

" epigenetic parameter (epigenetic parameter) " refers in particular to cytosine methylation. Other epigenetic parameter for example comprises the acetylation of histone, but it can not adopt described method Direct Analysis, but it is relevant with dna methylation.

Term " bisulfites reagent " refers to comprise bisulfites (bisulfite), disulfite, acid sulphite (hydrogen sulfite) or its combination, as disclosed herein, be used for distinguishing methylated and unmethylated CpG dinucleotides sequence.

Term " methylation assay " refers to determine any mensuration of the methylation state of one or more CpG dinucleotides sequences in the dna sequence dna.

Term " MS.AP-PCR " (responsive arbitrarily primed polymerase chain reaction methylates) refers to adopt the primer that is rich in CG to scan genome in order to can concentrate on the technology known in the art that most probable contains the zone of CpG dinucleotides comprehensively, such as people such as Gonzalgo, Cancer Research 57:594-599,1997 is described.

Term " MethyLight^TM" refer to known in the art by people such as Eads, Cancer Res. 59:2302-2306,1999 real time pcrs based on fluorescence of describing.

In its embodiment used herein, term " HeavyMethyl^TM" determination method refers to such mensuration, wherein cover between amplimer or be amplified the blocking-up probe (this paper is also referred to as blocking agent) of methylation specific of the CpG position that primer covers so that the selective amplification nucleic acid samples of methylation specific becomes possibility.

In its embodiment used herein, term " HeavyMethyl^TM MethyLight ^TM" determination method refers to HeavyMethyl^TM MethyLight ^TMMeasure, it is MethyLight^TMThe variant of measuring, wherein MethyLight^TMMeasure and cover the methylation specific blocking-up probe associating of CpG position between the amplimer.

Term " Ms-SNuPE " (methylate responsive mononucleotide primer extend) refers to known to Gonzalgo﹠Jones, Nucleic Acids Res.25:2529-2531,1997 mensuration of describing.

Term " MSP " (methylation specific PCR) refers to known by people such as Herman, Proc.Natl.Acad.Sci.USA 93:9821-9826,1996 and by United States Patent (USP) 5,786,146 methylation assays of describing.

Term " COBRA " (the hydrosulphite restriction analysis of associating) refers to known by Xiong﹠amp; Laird, Nucleic Acids Res.25:2532-2534,1997 methylation assays of describing.

Term " MCA " (amplification of methylated CpG island) refers to by people such as Toyota, Cancer Res.59:2307-12,1999 and WO 00/26401A1 in the methylation assay described.

Term " hybridization " should be understood that oligonucleotide and complementary sequence along the bonding of Watson-Crick base pairing line in the sample DNA, form the duplex structure.

Ding Yi " tight hybridization conditions " is included under 68 ℃ and hybridizes in 5x SSC/5xDenhardt solution/1.0%SDS herein, and at room temperature in 0.2x SSC/0.1%SDS, wash, (for example such condition: hybridization is being carried out in the 2.5xSSC damping fluid under 60 ℃ perhaps to comprise its known condition of equivalent, be at the several washing steps under low-buffer concentration under 37 ℃ subsequently, and keep stable).Ding Yi medium stringent condition is included under 42 ℃ and is washing in 3xSSC herein, or its known condition of equivalent.Can change salt concn and temperature parameter to obtain the identity of optimum level between probe and the target nucleic acid.Can obtain guidance in the prior art to these conditions, people such as Sambrook for example, 1989, Molecular Cloning, ALaboratory Manual (molecular cloning experiment guide), Cold Spring Harbor Press, people such as N.Y. and Ausubel, Current Protocols in Molecular Biology (up-to-date molecular biology experiment), (John Wiley ﹠amp; Sons, N.Y.) unit 2.10.

Term " methylation specific restriction enzyme " or " responsive restriction enzyme methylates " should be understood that according to the methylation state of its recognition site and the enzyme of selectivity digesting nucleic acid.For not methylated when recognition site or the restriction enzyme of special shearing just during hemimethylation, when recognition site is methylated, can not shear, or shear with significantly reduced efficient.For the restriction enzyme of the special shearing of ability when recognition site is methylated, when recognition site is not methylated, can not shear, or shear with significantly reduced efficient.The restriction enzyme of methylation specific preferably, its recognition sequence contains CG dinucleotides (for example cgcg or cccggg).Concerning some embodiments, the further restriction enzyme of preferably when the C5 carbon atom is methylated, not cutting when the cytosine(Cyt) in this dinucleotides.

" restriction enzyme of non-methylation specific " or " the non-responsive restriction enzyme that methylates " is for haveing nothing to do with the restriction enzyme of essentially identical efficient cutting nucleotide sequence with methylation state.They are also referred to as " non-specific restriction enzyme methylates ".

Term " gene " should be considered to comprise its all transcript variant (for example, term " Septin 9 " should comprise the transcript Q9HC74 of for example its brachymemma) with and all promotor and regulatory elements.In addition, owing to known a plurality of SNP are arranged in described gene, so this term should be believed to comprise its all sequence variants.

Term " precancerous " or " knurl become before " or its are equal to term should be considered to make a comment or criticism any cell proliferation illness of the pernicious transformation of experience.With regard to the colorectal cell proliferative disorders, the example of this class situation comprises highly dysplastic cell proliferation disorders, comprises the adenoma of following classification:

Grade 1: pernicious body of gland infiltrates through the interior submucosa of polyp head (polyp head) from muscularis mucosae;

Grade 2: identical submucosa is invaded, but is present in the joint of head to stem;

Grade 3: invade stem; And

Class 4: the base portion (this grade is corresponding to the Dukes A phase) of invading stem in the junction that is connected to colon wall.

General introduction

The invention provides the method for cell proliferation disorders in detection and/or the classification individuality, comprise and determine to separate that at least one is selected from Septin 9 (comprising the transcript variant that they are all), FOXL2, SARM1, VTN, PRDM6, NR2E1, FAT and the gene of SEQ ID NOS:160 to SEQ ID NO:165 or the expression level of genome sequence in the biological sample of described individuality, wherein owe to express and/or existence or classification that CpG methylates and shows described illness.Described mark can be used to diagnose knurl sexual cell proliferative disorders (cancer), comprises the early detection during canceration early stage of disease, and also is used to distinguish knurl and benign cell proliferative disorders.The open method of the present invention, wherein knurl sexual cell proliferative disease and benign cell proliferative disease are distinguished, described method is characterised in that to owe to express and/or exist CpG to methylate to show and has an illness before knurl sexual cell hyperplasia or the knurl, and it does not exist and then shows and have the benign cell proliferative disease.

Mark of the present invention is especially effective aspect detection or differentiation hepatocyte growth venereal disease disease or detection or discriminating colorectal rectum cell proliferative disorders, and the means of the improvement of early detection, classification and the described illness of treatment are provided thus.

At least one is selected from Septin 9 (comprising the transcript variant that they are all) except above analysis, FOXL2, SARM1, VTN, PRDM6, NR2E1, outside the gene of FAT and SEQ ID NOS:160 to SEQ ID NO:165 or the methylated embodiment of genome sequence, the present invention also provide have new application be used to detect the especially gene in groups of liver cancer and/or colorectal carcinoma of cancer, comprise that being selected from least one is selected from Septin 9 (comprising the transcript variant that they are all), FOXL2, SARM1, VTN, PRDM6, NR2E1, gene or the genome sequence of FAT and SEQ ID NOS:160 to SEQ ID NO:165.

In first other embodiment, the present invention is based on the analysis that at least one is selected from the CpG methylation state of the gene of Septin 9 (comprising the transcript variant that they are all), FOXL2, SARM1, VTN, PRDM6, NR2E1, FAT and SEQ ID NOS:160 to SEQ ID NO:165 or genome sequence.Further the sequence of preferred described gene is as shown in table 1.

The bisulphite modified of DNA is the known instrument that is used to assess the CpG methylation state.In eukaryotic DNA, 5-methylcytosine is modal covalency base modification.It is for example transcribed in adjusting, genetic imprinting and tumour work in taking place.Therefore confirm that 5-methylcytosine has sizable meaning as the genetic information component.But 5-methylcytosine can not be identified by checking order, because 5-methylcytosine has identical base pairing behavior with cytosine(Cyt).In addition, for example in the pcr amplification process, the epigenetic information that 5-methylcytosine carries is then lost fully.

The method that is most commonly used to 5-methylcytosine existence in the analyzing DNA is based on the specific reaction of hydrosulphite and cytosine(Cyt), and after alkaline hydrolysis subsequently, cytosine(Cyt) is changed into the uridylic of corresponding thymus pyrimidine in the pairing behavior thus.But importantly, 5-methylcytosine keeps not modified under these conditions.As a result, primary DNA is changed in this way, makes that can not can be used as only surplus cytosine(Cyt) originally in its hybridization behavior with the methylcystein that cytosine(Cyt) distinguishes is now detected by the known molecular biology techniques of routine, for example by amplification and hybridization.All these technology all based on different base pairing characteristics, can be fully utilized now.

With regard to susceptibility, prior art is determined by method, this method comprises DNA to be analyzed is encapsulated in the agarose matrix, prevent DNA diffusion and renaturation (hydrosulphite only reacts with single stranded DNA) thus, and substitute all precipitations and purification step (people such as OlekA with quick dialysis, A modified and improved method for bisulfite based cytosinemethylation analysis (method that is used for the changes and improvements analyzed based on the cytosine(Cyt) of hydrosulphite), Nucleic Acids Res.24:5064-6,1996)).Thereby might analyze the methylation state of individual cells, the practicality and the susceptibility of this method is described.Rein, people such as T, NucleicAcids Res., 26:2255,1998 provide the summary to the currently known methods that detects 5-methylcytosine.

Except extremely indivedual examples (for example, people such as Zeschnigk M, Eur J Hum Genet.5:94-98,1997), this sulphite technology only is used for research at present.In all cases, the specific fragment of the weak point of amplification known after bisulf iotate-treated, and or (the Olek ﹠amp that checks order fully; Walter, Nat Genet.1997 17:275-6,1997), perhaps carry out one or more primer extension reactions (Gonzalgo ﹠amp; Jones, Nucleic Acids Res., 25:2529-31,1997; WO 95/00669; United States Patent (USP) 6,251,594) to analyze each cytosine(Cyt) position, perhaps by collagenase treatment (Xiong ﹠amp; Laird, Nucleic Acids Res., 25:2532-4,1997).Detection by hybridization also have in the prior art description (people such as Olek, WO99/28498).In addition, methylate detection (the Grigg ﹠amp of use hydrosulphite technology at individual gene also described; Clark, Bioessays, 16:431-6,1994; People such as Zeschnigk M, Hum Mol Genet., 6:387-95,1997; People such as Feil R, Nucleic Acids Res., 22:695-, 1994; People such as Martin V, Gene, 157:261-4,1995; WO 9746705 and WO 9515373).

The present invention also provides the use of uniting of this hydrosulphite technology and one or more methylation assays, is used for determining the methylation state of the CpG dinucleotides sequence in the sequence of at least a SEQ of being selected from ID NOS:1 to SEQ ID NO:3, SEQ IDNO:24, SEQ ID NO:28, SEQ ID NOS:159 to SEQ ID NO:167.Genome CpG dinucleotides can be methylated or do not methylated (perhaps being called upper and lower methylating (up-and down-methylated)).But method of the present invention is suitable for analyzing heterogeneous biological sample, for example the lower concentration tumour cell in blood or the ight soil.Therefore, in analyzing this sample during the methylation state of CpG position, those skilled in the art can use quantitative determination process to determine the methylation level of specific CpG position (for example per-cent, umber, ratio, ratio or degree), rather than methylation state.Correspondingly, term methylation status or methylation state also should be considered to be meant the methylate value of degree of reflection CpG position.Unless offer some clarification on, term " supermethylation " or " on methylate " should be considered to refer to methylate the specific threshold value of horizontal exceeding, wherein said threshold value can be the value of the average or intermediate value methylation level of the given colony of representative, or is preferably the critical level of optimization." critical " also can refer to " threshold value " in this article.In the context of the present invention, for (for example in promotor or regulatory region) in gene that is selected from following sequence or genome sequence or relevant with it all CpG positions, term " methylated ", " supermethylation " or " going up methylated " should be considered to comprise that methylation level is higher than threshold value zero (0) % (or its value of being equal to) and methylates, and described sequence is Septin 9 (comprising the transcript variant that they are all), FOXL2, SARM1, VTN, PRDM6, NR2E1, FAT and SEQ ID NOS:160 to SEQ ID NO:165.

According to the present invention, determine SEQ ID NOS:1 to SEQ ID NO:3, SEQ ID NO:24, SEQ ID NO:28, the methylation state of CpG dinucleotides sequence is all useful aspect diagnosis and characterize cells proliferative disease in SEQ ID NOS:159 to the SEQ ID NO:167.The methylation assay method.Multiple methylation assay method known in the state of the art, and can unite use with the present invention.These mensuration make it possible to determine the methylation state of one or more CpG dinucleotides (for example CpG island) in the dna sequence dna.Wherein, this class is measured dna sequencing, PCR (being used for the sequence-specific amplification), the Southern engram analysis that comprises through the DNA of bisulf iotate-treated, restriction enzyme and other technology of using the sensitivity that methylates.

For example, by using bisulf iotate-treated, gene order-checking is simplified and is used for distribution people such as (, Proc.Natl.Acad.Sci.USA 89:1827-1831,1992) Frommer of analyzing DNA methylation patterns and 5-methylcytosine.In addition, use restriction enzyme to digest from the PCR product of the DNA cloning that changes through hydrosulphite, for example Sadri ﹠amp; Hornsby (Nucl.Acids Res.24:5058-5059,1996), or COBRA (Combined BisulfiteRestriction Analysis (the hydrosulphite analysis of associating)) (Xiong ﹠amp; Laird, NucleicAcids Res.25:2532-2534,1997) described method.

COBRA.COBRA ^TMBe quantitative methylation assay (the Xiong ﹠amp that can be used for determining the dna methylation level at specific gene seat place in a small amount of genomic dna; Laird, Nucleic AcidsRes.25:2532-2534,1997).In brief, restriction enzyme digestion is used for disclose the sequence difference that the PCR product of the DNA that handles through sodium bisulfite methylates and relies on.The sequence difference introducing genomic dna that the method for describing according to people such as Frommer (Proc.Natl.Acad.Sci.USA 89:1827-1831,1992) at first will methylate and rely on by the standard bisulf iotate-treated.Adopt the pcr amplification that the special primer in purpose CpG island is carried out the DNA that changes through hydrosulphite subsequently, then be digestion with restriction enzyme, gel electrophoresis and adopt the special hybridization probe that is labeled to detect.Methylation level in the original DNA sample is by being represented by that digest and relative quantity PCR product that do not digested, and it is linear quantitative in dna methylation horizontal extent on a large scale.In addition, this technology can be used for reliably from the DNA of the paraffin-embedded tissue sample acquisition of micro-dissection.

Be used for COBRA ^TMThe typical agents of analyzing (for example, can be typically based on COBRA ^TMTest kit in find) can include, but are not limited to: the PCR primer that is used for the specific gene dna sequence dna or the CpG island of bisulf iotate-treated (or through); Restriction Enzyme and the damping fluid that is fit to; The gene recombination oligonucleotide; The contrast hybridization oligonucleotide; The kinases labelling kit that is used for oligonucleotide probe; And the Nucleotide of mark.In addition, hydrosulphite transformation reagent can comprise: DNA sex change damping fluid; The sulfonation damping fluid; DNA reclaims reagent or test kit (for example, precipitation, ultrafiltration, affinity column); The desulfonation damping fluid; And DNA reclaims component.

Preferably, such as " MethyLight ^TM" (based on the real time pcr of fluorescence) (people such as Eads, Cancer Res.59:2302-2306,1999), Ms-SNuPE ^TM(the responsive mononucleotide primer that methylates extends) reaction (Gonzalgo; Jones, Nucleic Acids Res.25:2529-2531,1997), methylation status of PTEN promoter (" MSP "; People such as Herman, Proc.Natl.Acad.Sci.USA 93:9821-9826,1996; United States Patent (USP) 5,786,146) and methylated CpG island amplification (" MCA "; People such as Toyota, Cancer Res.59:2307-12,1999) mensuration united use separately or with other method in these methods.

" HeavyMethyl ^TM" determination techniques is the quantivative approach that is used to assess methylation differential, it is based on to the methylation specific amplification through the DNA of bisulf iotate-treated.Covering between amplimer or the methylation specific blocking-up probe (being also referred to as blocker in this article) that is amplified the CpG position that primer covers make methylation specific selective amplification nucleic acid samples be called possibility.In its embodiment that this paper uses, term " HeavyMethyl ^TMMethyLight ^TM" measure and to refer to HeavyMethyl ^TMMethyLight ^TMMeasure, wherein MethyLight ^TMMeasure and cover the methylation specific blocking-up probe associating of CpG position between the amplimer.HeavyMethyl ^TMMeasure and also can unite use with the amplimer of methylation specific.

Be generally used for HeavyMethyl ^TMThe typical agents of analyzing (for example, can be typically based on MethyLight ^TMTest kit in find) can include, but are not limited to: the PCR primer that is used for the specific gene dna sequence dna or the CpG island of bisulf iotate-treated (or through); The blocking-up oligonucleotide; PCR damping fluid and the deoxynucleotide optimized; And Taq polysaccharase.

The feasible methylation state that can assess any basically CpG site group in the CpG island of MSP.MSP (PCR of methylation specific), and with the irrelevant (people such as Herman of the use of the responsive restriction enzyme that methylates, Proc.Natl.Acad.Sci.USA 93:9821-9826,1996; United States Patent (USP) 5,786,146).In brief, use the sodium bisulfite modifying DNA, change all unmethylated rather than methylated cytosine(Cyt)s into uridylic, then use with respect to methylate DNA not and be specific to the primer amplification of methylate DNA.MSP only needs DNA in a small amount, to 0.1% the allelotrope sensitivity that methylates at position, given CpG island, and can carry out at the DNA that extracts from paraffin-embedded sample.(for example be used for typical agents that MSP analyzes, may in typical test kit, find based on MSP) include, but are not limited to: be used for the methylated and unmethylated PCR primer of the specific gene dna sequence dna or the CpG island of bisulf iotate-treated (or through), PCR damping fluid and the deoxynucleotide and the specific probe of optimization.

MethyLight ^TM.MethyLight ^TMBe determined as the high-throughput quantification methylation assay, PCR in real time (TaqMan_) technology that it uses based on fluorescence does not need further operation people such as (, Cancer Res.59:2302-2306,1999) Eads after the PCR step.In brief, MethyLight ^TMMethod begins with the biased sample of genomic dna, and this biased sample is changed into the mixing pit of the sequence difference of the dependence that methylates in the sodium bisulfite reaction according to standard operation (the hydrosulphite process is transformed into uridylic with unmethylated cytosine(Cyt) residue).In " (biased) of skew " reaction (adopting the PCR primer of overlapping known CpG dinucleotides), carry out PCR subsequently based on fluorescence.Can produce the sequence difference in the amplification procedure level and on fluoroscopic examination process level.

MethyLight ^TMMensuration can be as the quantitative test of methylation patterns in the genome DNA sample, and wherein the sequence area branch occurs on the probe hybridization level.In this quantitative manner, in the presence of overlapping specific inferring methylated the fluorescent probe in site, the PCR reaction provided the amplification of methylation specific.The nothing skew contrast that is used to import the DNA amount is provided by following reaction: wherein primer and probe do not cover any CpG dinucleotides.Perhaps, by with the control oligonucleotide (HeavyMethyl in " covering " known site that methylates not ^TMThe mode based on fluorescence with the MSP technology), the quantitative test to genomic methylation is realized in the PCR pond that perhaps is offset with the oligonucleotide detection that covers the potential site that methylates.

MethyLight ^TMMethod can be used with any suitable probe, as " TaqMan_ ", " Lightcycler_ " or the like.For example, handle double stranded genomic dna, and it is adopted one of two cover PCR reactions of TaqMan_ probe with sodium bisulfite; For example, adopt MSP primer and/or HeavyMethyl blocker oligonucleotide and TaqMan_ probe.This TaqMan_ probe is fluorescence " reporter " and " cancellation " molecule double-tagging, and is designed to be specific to relative high GC content district, to such an extent as to its in PCR circulation with than the high about 10 ℃ temperature fusion of primer forward or backwards.This makes the TaqMan_ probe keep fully hybridization in PCR annealing/extension step.When the Taq polysaccharase in PCR during the new chain of enzymic synthesis, it finally can run into annealed TaqMan_ probe.Taq polysaccharase 5 ' to 3 ' endonuclease activity will replace it by digestion TaqMan_ probe subsequently, and it is present not by the signal of cancellation thereby release fluorescence reporter molecule is used to adopt real-time fluorescence detection system detection by quantitative.

Be used for MethyLight ^TMThe typical agents of analyzing (for example, can be based on MethyLight ^TMTest kit in find) can include, but are not limited to: the PCR primer that is used for specific gene (or the dna sequence dna of bisulf iotate-treated or CpG island); TaqMan_ or Lightcycler_ probe; PCR damping fluid and the deoxynucleotide optimized; And Taq polysaccharase.

QM ^TM(quantitatively methylating) is determined as the another kind of quantitative test of methylation patterns in the genome DNA sample, and wherein the sequence area branch appears on the probe hybridization level.In this quantitative manner, PCR is reflected at the amplification of not having skew is provided under the existence of fluorescent probe, wherein the overlapping specific site that methylates of inferring of this fluorescent probe.Provide the contrast of the nothing skew of input DNA amount by such reaction: i.e. not overlapping any CpG dinucleotides of primer or probe wherein.Perhaps, by with the control oligonucleotide (HeavyMethyl in " covering " known site that methylates not ^TMThe mode based on fluorescence with the MSP technology), the quantitative test to genomic methylation is realized in the PCR pond that perhaps is offset with the oligonucleotide detection that covers the potential site that methylates.

QM ^TMMethod can be used with any suitable probe in amplification procedure, as " TaqMan_ ", Lightcycler_ or the like.For example, handle double stranded genomic dna, and it is used primer and the TaqMan_ probe that does not have skew with sodium bisulfite.This TaqMan_ probe is fluorescence " reporter " and " cancellation " molecule double-tagging, and is designed to be specific to relative high GC content district, to such an extent as to its in PCR circulation with than the high about 10 ℃ temperature fusion of primer forward or backwards.This makes the TaqMan_ probe keep fully hybridization in PCR annealing/extension step.When the Taq polysaccharase in PCR during the new chain of enzymic synthesis, it finally can run into annealed TaqMan_ probe.Taq polysaccharase 5 ' to 3 ' endonuclease activity will replace it by digestion TaqMan_ probe subsequently, and it is present not by the signal of cancellation thereby release fluorescence reporter molecule is used to adopt real-time fluorescence detection system detection by quantitative.Be used for QM ^TMThe typical agents of analyzing (for example, can be based on QM ^TMTest kit in find) can include, but are not limited to: the PCR primer that is used for specific gene (or the dna sequence dna of bisulf iotate-treated or CpG island); TaqMan_ or Lightcycler_ probe; PCR damping fluid and the deoxynucleotide optimized; And Taq polysaccharase.

Ms-SNuPE.Ms-SNuPE ^TMTechnology is the quantivative approach that is used to assess the methylation differential in specific CpG site, and it then is that the mononucleotide primer extends (Gonzalgo based on bisulf iotate-treated DNA; Jones, Nucleic Acids Res.25:2529-2531,1997).In brief, make the reaction of genomic dna and sodium bisulfite changing unmethylated cytosine(Cyt) into uridylic, and keep 5-methylcytosine constant.Adopt the required target sequence of PCR primer amplification that is specific to the DNA that changes through hydrosulphite subsequently, the product of resulting separation also is used as the methylated template of analysis purposes CpG site.Can analyze DNA (for example pathological section of micro-dissection) in a small amount, it has avoided using restriction enzyme to determine the methylation state of CpG site.

Be used for Ms-SNuPE ^TMThe typical agents of analyzing (for example, can be typically based on COBRA ^TMTest kit in find) can include, but are not limited to: the PCR primer that is used for the specific gene dna sequence dna or the CpG island of bisulf iotate-treated (or through); PCR damping fluid and the deoxynucleotide optimized; Gel extraction kit, positive control primer; The Ms-SNuPE that is used for specific gene ^TMPrimer; Reaction buffer (being used for the Ms-SNuPE reaction); And the Nucleotide of mark.In addition, hydrosulphite transformation reagent can comprise: DNA sex change damping fluid; The sulfonation damping fluid; DNA reclaims reagent or test kit (for example, precipitation, ultrafiltration, affinity column); The desulfonation damping fluid; And DNA reclaims component.

SEQ ID NOS:1 to SEQ ID NO:3, SEQ ID NO:24, SEQ ID NO:28, The genome sequence of SEQ ID NOS:159 to SEQ ID NO:167, with and non-natural send out Treated variant SEQ ID NOS:10 to SEQ ID NO:15, the SEQ ID NOS:28 that give birth to To SEQ ID NO:33, SEQ ID NOS:30 to SEQ ID NO:31, SEQ ID NOS:42 To SEQ ID NO:43, SEQ ID NOS:38 to SEQ ID NO:39, SEQ ID NOS:50 Be defined in cell to SEQ ID NO:51, SEQ ID NOS:168 to SEQ ID NO:203 Proliferative disorders is early detection, the classification of colorectum and/or hepatocyte growth venereal disease disease especially And/or the treatment aspect has new application.

In one embodiment, method of the present invention may further comprise the steps: the genomic dna (preferably isolating from body fluid) that obtains from individuality is contacted with an at least a reagent or a group reagent, and described reagent is distinguished gene or interior the methylating and unmethylated CpG dinucleotides of genome sequence of at least a Septin of being selected from 9 (comprising the transcript variant that they are all), FOXL2, SARM1, VTN, PRDM6, NR2E1, FAT and SEQ ID NOS:160 to SEQ ID NO:165 (comprising its promotor and regulation domain); And ii) with more than or equal to 80% susceptibility with more than or equal to 80% specific detection or detect and discriminating colorectal or hepatocyte growth venereal disease disease.

Preferably, described susceptibility is about 75% to about 96% or about 80% to about 90% or about 80% to about 85%.Preferably, described specificity is about 75% to about 96% or about 80% to about 90% or about 80% to about 85%.

Can comprise and use commercially available test kit by any standard method isolation of genomic DNA of the prior art.In brief, when target DNA was wrapped in the cytolemma in biological sample, this biological sample must be broken and be cleaved by enzyme, chemistry or mechanical means.For example remove albumen and other pollutent subsequently by the digestion of protein kinase K.Then from solution, reclaim genomic dna.This can realize by the whole bag of tricks, comprise saltout, organic extraction or DNA is attached to solid support.Selection to method can be subjected to influence of various factors, comprises the amount of time, expense and required DNA.All clinical sample kinds, comprise the preceding material of knurl material or knurl, all be suitable for use in the inventive method, preferably clone, Histological section, biopsy, paraffin-embedded tissue, body fluid, ight soil, colon effluent, urine, blood plasma, serum, whole blood, isolating hemocyte, from blood isolated cells, or its combination.Body fluid is preferred DNA source; Especially preferred is blood plasma, serum, whole blood, isolating hemocyte and from the cell of blood separation.

Subsequently, methylate at least one target region of genomic dna and not methylated CpG dinucleotides at least a or agent treated genome DNA sample in groups with distinguishing, wherein said target region comprise or under stringent condition hybridization to the length of at least one sequence sequence at least 16 continuous nucleotides, described at least one sequence is selected from and is selected from SEQ ID NOS:1 to SEQ ID NO:3 respectively, SEQ ID NO:24, SEQ ID NO:28, SEQ ID NOS:159 to SEQ ID NO:167, wherein said continuous nucleotide comprises at least one CpG dinucleotides sequence.

Especially preferredly be, described reagent will be not 5 ' methylated cytosine(Cyt) base change into uridylic, thymus pyrimidine or other in the hybridization behavior, be different from cytosine(Cyt) another base.But in another embodiment, described reagent can be the responsive restriction enzyme that methylates.

When genomic dna is handled by this mode, so that make 5 ' unmethylated cytosine(Cyt) base change into uridylic, thymus pyrimidine or other in the hybridization behavior, be different from cytosine(Cyt) other base the time, preferred this processing is carried out (bisul-phite, hydrosulphite (disulfite)) and alkaline hydrolysis subsequently with hydrosulphite.This processing causes SEQ ID NOS:1 to SEQ ID NO:3, SEQ ID NO:24, SEQ ID NO:28, SEQ ID NOS:159 to SEQ ID NO:167 (difference) is changed into SEQ ID NOs:10 to SEQ ID NO:15, SEQID NOS:30 to SEQ ID NO:31, SEQ ID NOS:38 to SEQ ID NO:39, SEQID NOS:168 to SEQ ID NO:185, wherein said CpG dinucleotides is methylated, or SEQ ID NOS:28 to SEQ ID NO:33, SEQ ID NOs:42 to SEQ IDNO:43, SEQ ID NOS:50 to SEQ ID NO:51, SEQ ID NOS:186 to SEQ IDNO:203, wherein said CpG dinucleotides is unmethylated.

The DNA that subsequent analysis is treated is so that determine the methylation state of target-gene sequence (at least one gene or genome sequence are selected from Septin 9 (comprising the transcript variant that they are all), FOXL2, SARM1, VTN, PRDM6, NR2E1, FAT and SEQ ID NOS:160 to SEQID NO:165 before handling).Especially preferredly be, this target region comprises or hybridization is at least 16 continuous nucleotides of at least one gene or genome sequence under stringent condition, and described at least one gene or genome sequence are selected from Septin 9 (comprising the transcript variant that they are all), FOXL2, SARM1, VTN, PRDM6, NR2E1, FAT and SEQ ID NOS:160 to SEQ ID NO:165.The preferred gene order of analyzing SEQ ID NOS:1 to SEQ ID NO:3, SEQ IDNO:24, SEQ ID NO:28, SEQ ID NOS:159 to SEQ ID NO:167.Described analytical procedure can be selected from well known in the prior art those, comprise that those are listed in herein.Especially preferred is MethyLight ^TM, MSP and use blocking-up oligonucleotide (HeavyMethyl described herein ^TM).Further preferably, any oligonucleotide that is used in this analysis (comprises primer, blocking-up oligonucleotide and detection probes) should reverse complemental in, be equal to or hybridization SEQ ID NOS:10 to SEQ IDNO:15 under tight or height stringent condition, SEQ ID NOS:28 to SEQ ID NO:33, SEQ ID NOS:30 to SEQ IDNO:31, SEQ ID NOS:42 to SEQ ID NO:43, SEQ ID NOS:38 to SEQ IDNO:39, SEQ ID NOS:50 to SEQ ID NO:51, the long fragment of at least 16 base pairs of one or more base sequences in SEQ ID NOS:168 to SEQ IDNO:203 and the complementary sequence thereof.

Abnormal methylation, the supermethylation that is selected from the gene of Septin 9 (comprising the transcript variant that they are all), FOXL2, SARM1, VTN, PRDM6, NR2E1, FAT and SEQ IDNOS:160 to SEQ ID NO:165 (promotor and/or the regulatory region that comprise them) or genome sequence more specifically is relevant with the existence of knurl sexual cell proliferative disorders, and is especially general in colorectum and hepatoma.Therefore, when biological sample showed methylating of any degree, described sample should be confirmed as knurl.

The analysis of one of the gene that is selected from Septin 9 (comprising the transcript variant that they are all), FOXL2, SARM1, VTN, PRDM6, NR2E1, FAT and SEQ ID NOS:160 to SEQ ID NO:165 or genome sequence is made it possible to first to be greater than or equal to 80% susceptibility and to be greater than or equal to 80% specific detection or to detect and discriminating colorectal or hepatocyte growth venereal disease disease.Being calculated as of susceptibility: (detected knurl/all knurls); For example (detected colon knurl/all colon knurls); Specific being calculated as (undetected feminine gender/total feminine gender).

Preferably, described susceptibility is about 75% to about 96% or about 80% to about 90% or about 80% to about 85%.Preferably, described specificity is about 75% to about 96% or about 80% to about 90% or about 80% to about 85%.

Knurl defined herein is all greater than 1cm malignant tumor of colon and adenoma, or its hypotype.Feminine gender can be defined as healthy individual.

In one embodiment, described method discloses the mark that at least one gene or the genome sequence that are selected from Septin 9 (comprising the transcript variant that they are all), FOXL2, SARM1, VTN, PRDM6, NR2E1, FAT and SEQ ID NOS:160 to SEQ ID NO:165 (or its promotor and/or regulatory region) are used as difference, detect and distinguish cell proliferative disorders (the especially colon of knurl or liver illness).

The expression of the RNA that described method can be transcribed from them by any analysis or realize from the polypeptide or the proteic expression of described RNA translation is preferably by mRNA expression analysis or expression of polypeptides analysis.Therefore, the present invention also provides diagnostic assay and method, detect quantitatively and qualitatively that at least one is selected from Septin 9 (comprising the transcript variant that they are all), FOXL2, SARM1, VTN, PRDM6, NR2E1, FAT and the gene of SEQ ID NOS:160 to SEQ ID NO:165 or the expression of genome sequence in the individuality, and determine in described individuality, whether there is cancer thus.

Unconventionality expression from gene that is selected from Septin 9 (comprising the transcript variant that they are all), FOXL2, SARM1, VTN, PRDM6, NR2E1, FAT and SEQ ID NOS:160 to SEQ ID NO:165 or the mRNA that genome sequence is transcribed is relevant with the existence of cancer in the individuality.According to the present invention, owe to express (and/or exist methylate) relevant with the existence of cancer, otherwise mistake expression (and/or do not exist methylate) with do not exist cancer relevant.Especially preferably, determine at least one expression of transcribing variant as disclosed gene Septin 9 among SEQ ID NOS:16 to the SEQ ID NO:19.

For the existence of the mRNA that detects encoding gene or genome sequence, from the patient go sample.This sample can be the sample of any suitable cellular material that comprises tumour.The sample type that is fit to comprises clone, Histological section, biopsy, paraffin-embedded tissue, body fluid, ight soil, colon effluent, urine, blood plasma, serum, whole blood, isolating hemocyte, from blood isolated cells, and all possible combination.Preferably, described sample type is ight soil or body fluid, is selected from colon effluent, urine, blood plasma, serum, whole blood, isolating hemocyte, isolated cells from blood.

Described sample can be processed to extract wherein contained RNA.Subsequent analysis is from the nucleic acid of this sample gained.The technology that much is used for the absolute and relative level of definite genetic expression known in the state of the art; be suitable for use in the technology that common technology among the present invention comprises that in situ hybridization (for example FISH), Northern analyze, the RNA enzyme protection is measured (RPA), microarray and PCR-based, for example quantitative PCR and difference show PCR or any other nucleic acid detection method.

Especially preferred reverse transcription/polymerization chain type the reaction technology (RT-PCR) that is to use.(for example, referring to above Watson and Fleming) that the RT-PCR method is known in the art.

The RT-PCR method can followingly be carried out.By the total RNA of guanidinium isothiocyanate method isolated cell of for example standard, and this total RNA of reverse transcription.This reverse transcription method comprises employing reversed transcriptive enzyme and 3 ' end oligonucleotide dT primer and/or random hexamer primer synthetic DNA on the RNA template.Consequent cDNA is subsequently by pcr amplification (people such as Belyavsky, Nucl AcidRes 17:2919-2932,1989; Krug and Berger, Methods in Enzymology (method in the zymetology), Academic Press, N.Y., Vol.152, pp.316-325,1987, by reference they are introduced)." in real time " variant of RT-PCR further preferably, wherein said PCR product is by hybridization probe (for example TaqMan, Lightcycler, MolecularBeacons ﹠amp; Scorpion) or SYBR is green detects.Then, reference standard curve or by relatively and will be quantitative from probe or the green detected signal of SYBR with the Ct value of Ct value and calibration criterion.To the analysis of house-keeping gene through being commonly used to the stdn result.

In the Northern engram analysis, on the sex change sepharose, separate total mRNA or poly (A)+mRNA, and in this exsiccant gel self or hybridize probe to mark on the film.The hit amount of RNA of the signal of gained and RNA group is proportional.

To the relative different that relatively discloses gene expression dose from the signal of two or more cell masses or tissue.Can compare by the typical curve that signal and the cell-free transcription folder corresponding to target RNA that adopts known quantity are produced and carry out absolute quantitation.To the analysis of house-keeping gene through being usually used in the stdn result, got rid of owing to be transferred to the different of RNA on the film or go up different caused any notable difference of the RNA of sample to the gel, described house-keeping gene is that expression level is expected the relative constant gene of maintenance with conditional independence.

The first step during Northern analyzes is separated pure, complete RNA from the purpose cell or tissue.Because the Northern trace is distinguished RNA by size, the integrity of sample influences the concentration degree of signal in the wall scroll band.The RNA sample of part degraded will cause signal ambiguity or be distributed in several bands, cause the reduction generally of susceptibility and may cause explanation of error to data.In the Northern engram analysis, can use DNA, RNA and oligonucleotide probe, these probes preferably are labeled (for example, radioactively labelled substance, mass spectrum marker (mass label) or fluorescent marker).Target RNA, rather than the big young pathbreaker of probe determines the size of detected band, so be applicable to probe analysis such as the method for the random primer labelling that produces the different lengths probe.The specific activity of probe will determine the level of susceptibility, so the preferred probe with high specific activity that uses.

In the RNA enzyme protection was measured, the RNA target was hybridized in solution with the rna probe with definite length.After the hybridization, digest RNA to remove any not the strand target RNA and the probe of hybridization with the RNA enzyme (RNase) that is specific to single-chain nucleic acid.Make the RNA enzyme deactivation, and for example come isolation of RNA by denaturing polyacrylamide gel electrophoresis.The amount of the amount of global RNA probe and the target RNA among the RNA group is proportional.RPA can be used for the relative and absolute quantitation of genetic expression, and also is used to draw the RNA structure, for example intron/exon border and transcription initiation site.The RNA enzyme protection is measured and is better than the Northern engram analysis, because it has lower detectability.

The antisense RNA probes that is used for RPA generates by the dna profiling that in-vitro transcription has clear and definite end points, usually in the scope of 50-600 Nucleotide.Use comprises extra does not make protected fragment and total length probe region separate with the rna probe of target RNA homologous sequence.Rna probe substitutes dna probe usually and uses, and this is because be easy to produce the single stranded RNA probe and with the circulation ratio of RNase digestion RNA:RNA duplex and reliability people such as (, 2003) Ausubel, especially preferred is the probe with high specific activity.

The especially preferred microarray that is to use.Microarray method can be divided into two major portions.First is that known gene order is fixed on slide glass or other solid support, is that fluorescently-labeled cDNA (comprising sequence to be studied) is fixed to the hybridization of the known on the slide glass (or other solid phase) with this subsequently.After the hybridization, adopt fluorescence microarray scanner scanning array.Provide measurement to the analysis of different genes relative intensity of fluorescence to gene expression difference.

Can by will be in advance the synthetic oligonucleotide slide glass or other solid surface that are fixed to preparation produce the DNA array.In this case, adopt the synthetic and purification process of standard oligonucleotide to process and prepare representational gene order.These synthetic gene orders be complementary to goal gene rna transcription this (in this case, gene or genome sequence are selected from Septin 9 (comprising the transcript variant that they are all), FOXL2, SARM1, VTN, PRDM6, NR2E1, FAT and SEQ ID NOS:160 to SEQ ID NO:165), and tend to the interior short sequence of 25-70 Nucleotide scope.In preferred embodiments, described oligonucleotide or polynucleotide comprise be selected from SEQ ID NOS:16 to SEQ ID NO:19 with and at least one sequence of complementary sequence is complementary or at least 9,18 or 25 bases of the sequence of hybridization.Perhaps, the fixed oligomer can synthesize by in-situ chemical on slide surface.The original position oligonucleotide is synthetic to be related to suitable Nucleotide is added into point on the microarray continuously; The point of not accepting Nucleotide adopts physics or actual covert to protect in each stage of this method.Preferably, described synthetic nucleic acid is the nucleic acid of locking.

In the microarray experiment of analyze expressing, the cell or tissue that used RNA template representative is studied transcribe spectrum.At first from cell mass to be compared or the tissue isolation of RNA.Then each RNA sample is produced fluorescently-labeled cDNA as template by reverse transcription reaction.The fluorescent mark of this cDNA can be realized by direct mark or indirect labelling method.In direct mark, Nucleotide (for example, the Cy that fluorescence is modified ^_3-or Cy ^_5-dCTP) in reverse transcription reaction, directly be incorporated among the cDNA.Perhaps, can then after reverse transcription reaction finishes, N-hydroxy-succinamide (NHS)-fat dye-coupling be modified cDNA to this amino allyl group and finish indirect labelling by mix the Nucleotide that amino allyl group is modified between synthesis phase at cDNA.Perhaps, this probe can be unlabelled, but can be by detected with the part specific combination of direct or indirect mark.The marker and the method that are used for tagged ligand (and probe) are known in this area, for example comprise the radioactively labelled substance that can mix by currently known methods (for example nick translation or tyrosine phosphorylation (kinasing)).Other suitable marker includes but not limited to vitamin H, fluorophore, chemoluminescence group (for example dioxane, the especially dioxane of Yin Faing, enzyme, antibody etc.

In order to carry out the differential gene expression analysis, the cDNA that produces from the different RNA sample is by Cy ^_3 marks.The cDNA of resulting mark is purified to remove uncorporated Nucleotide, free dye and residual RNA.After the purifying, the cDNA sample of mark is hybridized to microarray.The stringency of this hybridization comprises the concentration of temperature, ionic strength, duration and methane amide by the multiple factor decision in the crossover process and in the washing process.For example (these factors have been summarized among the MolecularCloning:A Laboratory Manual (molecular cloning: laboratory manual), 2nd ed., 1989) at Sambrook et al..Fluorescence microarray scanner scanning microarray is used in the hybridization back.The fluorescence intensity of each point is represented the expression level of institute's analyzing gene; Bright spot is corresponding to the gene of strongly expressed, and dim spot is represented weak expression.

In case obtained image, needed to analyze raw data.At first, must be from the fluorescence of each some subtracting background fluorescence.With the stdn of data relative comparison sequence, control sequence is the nucleic acid of external source interpolation (preferred RNA or DNA) for example, or the house-keeping gene group, to remedy the difference of any non-specific hybridization, array defect or determinator, cDNA mark, hybridization or washing then.Data normalization makes and can the result of a plurality of mensuration be compared.

Another aspect of the present invention relates to the test kit that is used in the method according to this invention diagnosis individuality cancer, and described test kit comprises: measure and be selected from Septin 9 (comprising the transcript variant that they are all), FOXL2, SARM1, VTN, PRDM6, NR2E1, FAT and the gene of SEQ IDNOS:160 to SEQ ID NO:165 or the assembly of genome sequence transcriptional level.In preferred embodiments, comprise can be under tight or medium stringent condition and the oligonucleotide or the polynucleotide of the transcription product hybridization of gene that is selected from Septin 9 (comprising the transcript variant that they are all), FOXL2, SARM1, VTN, PRDM6, NR2E1, FAT and SEQ ID NOS:160 to SEQID NO:165 or genome sequence for the assembly that is used to measure transcriptional level.Preferably, described oligonucleotide or polynucleotide can be hybridized with at least a transcription product of gene that is selected from Septin 9 (comprising the transcript variant that they are all), FOXL2, SARM1, VTN, PRDM6, NR2E1, FAT and SEQ ID NOS:160 to SEQ ID NO:165 or genome sequence under tight or medium stringent condition, as providing among SEQ ID NOS:16 to the SEQID NO:19.In one embodiment, described oligonucleotide or polynucleotide comprise at least 9,18 or 25 bases of the sequence of or hybridization complementary with at least one sequence that is selected from SEQ ID NOS:16 to SEQ ID NO:19 and complementary sequence thereof.

In the most preferred embodiment, determine transcriptional level by the technology that is selected from Northern engram analysis, reverse transcriptase PCR, PCR in real time, RNA enzyme protection and microarray.In another embodiment of the present invention, this test kit also comprises the device that is used for obtaining from the patient biological sample.Preferably, test kit also comprises container, and it most preferably is suitable for splendid attire and is used to measure the assembly of transcriptional level and patient's biological sample, most preferably, also comprises the specification sheets that uses and explain the test kit result.

In preferred embodiments, this test kit comprises multiple oligonucleotide or the polynucleotide that (a) can hybridize with the transcription product of at least a gene that is selected from Septin 9 (comprising the transcript variant that they are all), FOXL2, SARM1, VTN, PRDM6, NR2E1, FAT and SEQ ID NOS:160 to SEQ ID NO:165 or genome sequence under tight or medium stringent condition; (b) container, the patient's biological sample that preferably is suitable for described oligonucleotide of splendid attire or polynucleotide and comprises transcription product, wherein said oligonucleotide or polynucleotide can be hybridized with described transcription product under tight or medium stringent condition; (c) be used for detecting the assembly of the hybridization of (b), and randomly, (d) use and explain test kit result's specification sheets.Further preferably, each of the oligonucleotide of described (a) or polynucleotide all comprises at least 9,18 or 25 bases of the sequence of or hybridization complementary with at least one sequence that is selected from SEQ ID NOS:16 to SEQ ID NO:19 and complementary sequence thereof.

Described test kit also can contain other component, such as being packaged in the hybridization buffer (wherein oligonucleotide will be used as probe) that separates in the container.Perhaps, when described oligonucleotide will be used to amplified target when zone, described test kit can contain the polysaccharase that is packaged in the container separately and the reaction buffer that is used for polymerase-mediated primer extension of optimization, as PCR.Preferably, described polysaccharase is a reversed transcriptive enzyme.Further preferably described test kit also contains RNA enzyme reagent.

The present invention also is provided for detecting the method that whether exists by described gene order encoded polypeptides from the sample that the patient obtains.

Expression of polypeptides horizontal abnormality by gene that is selected from Septin 9 (comprising the transcript variant that they are all), FOXL2, SARM1, VTN, PRDM6, NR2E1, FAT and SEQ ID NOS:160 to SEQ ID NO:165 or genome sequence encoded polypeptides is relevant with the existence of cancer.

According to the present invention, the existence that the owing of described polypeptide expressed with cancer is relevant.Especially preferably, described polypeptide is at least a aminoacid sequence that provides from the SEQ ID of Septin 9 genes NOS:20 to SEQ ID NO:23 polypeptide is provided.

Can use any method that is used to detect polypeptide well known in the prior art.These class methods comprise, but (for example be not limited to mass spectroscopy, immunodiffusion method, immunoelectrophoresis, immuno-chemical method, binding substances-part assay method, immunohistochemistry technique, aggegation and complement assay method, referring to Basic and Clinical Immunology (basis and clinical immunology), Sites and Terr, eds., Appleton ﹠amp; Lange, Norwalk, Conn, pp 217-262,1991, incorporate it into this paper by reference).Binding substances-part method of immunity preferably comprises making antibody and the reaction of one or more epi-position, and the polypeptide or derivatives thereof of alternative label competitively.

Certain embodiments of the present invention comprise that use is specific to by being selected from Septin 9 (comprising the transcript variant that they are all), FOXL2, SARM1, VTN, PRDM6, NR2E1, FAT and the gene of SEQ ID NOS:160 to SEQ ID NO:165 or the antibody of genome sequence encoded polypeptides.Especially preferredly be at least a aminoacid sequence that described polypeptide provides for SEQ ID NOS:20 to SEQ IDNO:23.

This antibody-like can be used for cancer diagnosis.In certain embodiments, the generation of mono-clonal or polyclonal antibody can be induced as antigen by using by the epi-position of the peptide coding of SEQ ID NOS:20 to SEQ ID NO:23.This antibody-like can be used for detecting the polypeptide expressed as the cancer diagnosis marker again.Can be by the level that exists of quantitative these polypeptide of ordinary method.Can detect and quantitatively antibody-polypeptide combination by multiple means well known in the prior art, such as with fluorescence or radioligand mark.The present invention also comprises the test kit that is used to carry out aforesaid method, and wherein these test kits contain the antibody that is specific to the polypeptide of studying.

Multiple competitiveness known in this field and noncompetitive polypeptide binding immunoassay assay method.The antibody that uses in these are measured can not be labeled, for example is used in the aggegation test, or be labeled, be used for multiple measuring method.Spendable marker comprises radionuclide, enzyme, fluorescent agent, chemoluminescence agent, enzyme substrates or cofactor, enzyme inhibitors, particle, dyestuff or the like.Preferred mensuration includes but not limited to radioimmunoassay (RIA), enzyme immunoassay, for example enzyme-linked immunosorbent assay (ELISA), fluorescence immunoassay etc.Can prepare the polyclone or monoclonal antibody or its epi-position that are used for immunoassay by any method in the several different methods known in the art.

In other embodiment of described method, described albumen can detect with the western engram analysis.Described analysis is standard in the art.In brief, by electrophoresis such as SDS-PAGE albumen is separated.Subsequently the albumen that separates is transferred on the suitable film (or paper),, keeps the spatial isolation that obtains by electrophoresis simultaneously as nitrocellulose.Then have the closed reagent of associativity position to hatch with film is remaining on binding film, normally used reagent comprises general albumen (for example milk-protein).Then, add the antibody that is specific to target protein, described antibody can be detected ground mark, for example by dyestuff or Enzymology method (for example alkaline phosphatase or horseradish peroxidase).Detect the position of described antibody on film subsequently.

In other embodiment of this method, described albumen can detect (use antibody is surveyed the specific antigen in the sample) by the immunohistochemical methods method.Described analysis is standard in the prior art, wherein detection of antigens in the tissue is called as immunohistochemistry, and the detection in culturing cell is commonly referred to immunocytochemistry.In brief, primary antibody is detected by being attached to its specific antigen.Subsequently, this antibody-antigenic compound is by secondary enzyme link coupled antibodies.In the presence of the substrate and chromophoric group of necessity, detect the bonded enzyme according to coloured deposition at antibody-antigen binding site place.The sample type that is fit to, Ag-Ab affinity, antibody type and detection Enhancement Method all have multiple.Therefore, the optimal conditions that is used for the detection of immunohistochemistry or immunocytochemistry must be determined separately for each example by those skilled in the art.

A kind of preparation at the method for the antibody of polypeptide is: all or part of aminoacid sequence of selecting and prepare this polypeptide, this aminoacid sequence of chemosynthesis also is injected into suitable animal with it, rabbit or mouse (Milstein and Kohler Nature 256:495-497,1975 normally; Gulfreand Milstein, the Methods in Enzymology:Immunochemical Techniques (method in the zymetology: 73:1-46 immunochemical technique), Langone and Banatis eds., Academic Press, 1981, incorporate its integral body into this paper by reference).The method for preparing polypeptide or its epi-position includes, but are not limited to chemosynthesis, recombinant DNA technology or separates from biological sample.

In the final step of this method, determine patient's diagnostic result, wherein (be selected from least a gene of Septin9 (comprising the transcript variant that they are all), FOXL2, SARM1, VTN, PRDM6, NR2E1, FAT and SEQ ID NOS:160 to SEQ ID NO:165 or genome sequence) and owe to show and have cancer.Term is owed to express and should be considered to be meant that detected level is less than predetermined threshold value, and this threshold value can be selected from the threshold value of average, intermediate value or optimization.

Another aspect of the present invention is provided for the test kit according to cancer in the inventive method diagnosis individuality, comprising: the assembly that is used to detect the polypeptide of at least one gene that is selected from Septin 9 (comprising the transcript variant that they are all), FOXL2, SARM1, VTN, PRDM6, NR2E1, FAT and SEQ IDNOS:160 to SEQ ID NO:165 or genome sequence.Preferably, the sequence of described polypeptide provides as SEQ ID NOS:20 to SEQ ID NO:23.The assembly that is used to detect described polypeptide preferably includes antibody, antibody derivatives or antibody fragment.The described polypeptide most preferably Western trace of the antibody by utilizing mark detects.In another embodiment of the present invention, this test kit also comprises the assembly that obtains patient's biological sample.Preferably, test kit also comprises the container that is suitable for polypeptide in the splendid attire detection patient biological sample, most preferably also comprises the specification sheets that uses and explain the test kit result.In preferred embodiments, described test kit comprises: (a) be used to detect at least a Septin of being selected from 9 (comprising the transcript variant that they are all), FOXL2, SARM1, VTN, PRDM6, NR2E1, FAT and the gene of SEQID NOS:160 to SEQ ID NO:165 or the assembly of genome sequence polypeptide; (b) be suitable for described assembly of splendid attire and the container that comprises patient's biological sample of described polypeptide, wherein said assembly can form mixture with described polypeptide; (c) assembly of the mixture of detection (b); And randomly (d) uses and explains test kit result's specification sheets.Preferably, the assembly of the polypeptide of the gene of at least a Septin of being selected from 9 of described detection (comprising the transcript variant that they are all), FOXL2, SARM1, VTN, PRDM6, NR2E1, FAT and SEQ ID NOS:160 to SEQ ID NO:165 or genome sequence is specific to the peptide sequence of at least a SEQ of being selected from ID NOS:20 to SEQ ID NO:23.Described test kit can also contain other component that is packaged in the container separately, for example is used to block, wash or wrap the damping fluid or the solution of quilt.

Specific embodiments of the present invention provides the new application to the analysis of methylation level and/or pattern in the described sequence, and it makes accurate detection, sign and/or treatment liver and/or colorectal cell proliferative disorders become possibility.The early detection of cancer directly interrelates with disease prognosis, thereby method disclosed herein makes and can make doctor and patient better more proper treatment determines.

Further improve

The invention provides the new purposes of genome sequence SEQ ID NOS:1 to SEQ ID NO:3, SEQ IDNO:24, SEQ ID NO:28, SEQ ID NOS:159 to SEQ ID NO:167.Other embodiment provides the modified variant of SEQ ID NOS:1 to SEQ ID NO:3, SEQ IDNO:24, SEQ ID NO:28, SEQ ID NOS:159 to SEQ ID NO:167, and the oligonucleotide and/or the PNA-oligomer that are used to analyze cytosine methylation patterns having in SEQ ID NOS:1 to SEQ ID NO:3, SEQ ID NO:24, SEQ ID NO:28, SEQ ID NOS:159 to the SEQ ID NO:167.

Purpose of the present invention comprises the methylation state of the one or more CpG dinucleotides in the sequence of analyzing at least a SEQ of being selected from ID NOS:1 to SEQ IDNO:3, SEQ ID NO:24, SEQ ID NO:28, SEQ ID NOS:159 to SEQ ID NO:167 and complementary sequence thereof.

Disclosed invention provides the treated nucleic acid derived from genome SEQ ID NOS:1 to SEQ ID NO:3, SEQ ID NO:24, SEQ ID NO:28, SEQ ID NO:159 to SEQ ID NO:167, and wherein said processing is suitable for that at least one unmethylated cytosine(Cyt) base with described genomic dna sequence changes uridylic into or other can be different from other base of cytosine(Cyt) with detecting in hybridization.The genome of being discussed can comprise one or more successive methylated CpG position.Described processing preferably includes uses the reagent that is selected from hydrosulphite, bisul-phite, disulfite and combination thereof.In the preferred embodiment of the invention, the invention provides the modified nucleic acid that non-natural produces, it comprises the sequence of the length of the sequence that is selected from SEQ ID NOS:10 to SEQ ID NO:15, SEQ ID NOS:28 to SEQ ID NO:33, SEQ ID NOS:30 to SEQ ID NO:31, SEQ ID NOS:42 to SEQ ID NO:43, SEQ ID NOS:38 to SEQ ID NO:39, SEQ ID NOS.50 to SEQ ID NO:51, SEQ ID NOS:168 to SEQ ID NO:203 at least 16 continuous nucleotide base.In a further preferred embodiment, described nucleic acid is the fragment that is disclosed in the nucleotide sequence among SEQ ID NOS:10 to SEQ ID NO:15, SEQ ID NOS:28 to SEQ ID NO:33, SEQ ID NOS:30 to SEQ ID NO:31, SEQ ID NOS:42 to SEQ ID NO:43, SEQ ID NOS:38 to SEQ ID NO:39, SEQ ID NOS:50 to SEQ ID NO:51, SEQ ID NOS:168 to the SEQ ID NO:203 of at least 50,100,150,200,250 or 500 base pair length.Especially preferred be not with SEQ ID NOS:10 to SEQ IDNO:15, SEQ ID NO:28 to SEQ ID NO:33, SEQ ID NOS:30 to SEQ IDNO:31, SEQ ID NOS:42 to SEQ ID NO:43, SEQ ID NOS:38 to SEQ IDNO:39, SEQ ID NOS:50 to SEQ ID NO:51, SEQ ID NOS:168 to SEQ IDNO:203 rather than SEQ ID NOS:1 to SEQ ID NO:3, SEQ ID NO:24, SEQID NO:28, identical or the complementary nucleic acid molecule of all or part of sequence of the DNA of SEQ ID NOS:159 to SEQ ID NO:167 or other natural generation.

Preferably, described sequence comprise CpG, TpA or CpA dinucleotides and with its complementary sequence at least one.SEQ ID NOS:10 to SEQ ID NO:15, SEQ IDNOS:28 to SEQ ID NO:33, SEQ ID NOS:30 to SEQ ID NO:31, SEQ IDNOS.42 to SEQ ID NO:43, SEQ ID NOS:38 to SEQ ID NO:39, SEQ IDNOS:50 to SEQ ID NO:51, the sequence of SEQ ID NOS:168 to SEQ ID NO:203 provides SEQ ID NOS:1 to SEQ ID NO:3, SEQ ID NO:24, SEQ ID NO:28, the modified form that the non-natural of SEQ ID NOS:159 to SEQ ID NO:167 produces, wherein the modification of each genome sequence causes synthetic following have unique and being different from the nucleic acid of the sequence of described genome sequence.For each sense strand genomic dna such as SEQ ID NO:1,4 kinds of forms that quilt changes are disclosed.First kind of form is that " C " is transformed into " T ", " but CpG " still keeps " CpG " (promptly, corresponding to such situation: wherein for genome sequence, " C " residue in all " CpG " dinucleotides sequences is methylated, and is not therefore changed); Second kind of form discloses the complementary sequence (being antisense strand) of disclosed genomic dna sequence, wherein " C " is transformed into " T ", " but CpG " still keeps " CpG " (promptly, corresponding to such situation: wherein for genome sequence, " C " residue in all " CpG " dinucleotides sequences is methylated, and is not therefore changed).The sequence of " going up methylated " transformation of SEQ ID NOS:1 to SEQ ID NO:3, SEQ ID NO:24, SEQ ID NO:28, SEQ ID NOS:159 to SEQ ID NO:167 is corresponding to SEQ ID NOS:10 to SEQ ID NO:15, SEQ ID NOS:30 to SEQ ID NO:31, SEQ ID NOS:38 to SEQ ID NO:39, SEQ ID NOS:168 to SEQ ID NO:185.The third chemical transformation form of each genome sequence is provided, wherein all changed into " T " for all " C " residues " C ", comprise in " CpG " dinucleotides sequence those (promptly, corresponding to such situation: wherein for genome sequence, all " C " residues in " CpG " dinucleotides sequence are not by methylated); Last a kind of chemical transformation form of each sequence discloses the complementary sequence (being antisense strand) of disclosed genomic dna sequence, wherein all changed into " T " for all " C " residues " C ", comprise in " CpG " dinucleotides sequence those (promptly, corresponding to such situation: wherein for the complementary sequence (antisense strand) of each genome sequence, all " C " residues in " CpG " dinucleotides sequence are not by methylated).The sequence of " following methylated " transformation of SEQ ID NOS:1 to SEQ ID NO:3, SEQ ID NO:24, SEQ ID NO:28, SEQ ID NOS:159 to SEQ ID NO:167 is corresponding to the sequence of SEQ ID NOS:28 to SEQ ID NO:33, SEQ ID NOS:42 to SEQ IDNO:43, SEQ ID NOS:50 to SEQ ID NO:51, SEQ ID NOS:186 to SEQ IDNO:203.

Therefore, importantly, the nucleotide sequence of SEQ ID NOS:10 to SEQ ID NO:15, SEQ IDNOS:28 to SEQ ID NO:33, SEQ ID NOS:30 to SEQ ID NO:31, SEQ IDNOS:42 to SEQ ID NO:43, SEQ ID NOS:38 to SEQ ID NO:39, SEQ IDNOS:50 to SEQ ID NO:51, SEQ ID NOS:168 to SEQ ID NO:203 and molecule does not relate to or interrelate with detection, classification or the treatment of cell proliferative disorders.

In other embodiment preferred, the present invention also provides oligonucleotide or the oligomer that is suitable for in the methods of the invention, is used to detect SEQ ID NOS:1 to SEQ ID NO:3, SEQID NO:24, SEQ ID NO:28, SEQ ID NOS:159 to SEQ ID NO:167, SEQID NOS:10 to SEQ ID NO:15, SEQ ID NOS:28 to SEQ ID NO:33, SEQID NOS:30 to SEQ ID NO:31, SEQ ID NOD:42 to SEQ ID NO:43, SEQID NOD:38 to SEQ ID NO:39, SEQ ID NOS:50 to SEQ ID NO:51, cytosine methylation state in the genome of SEQID NOS:168 to SEQ ID NO:203 or treated (chemically modified) DNA.Described oligonucleotide or oligomer nucleic acid provide new diagnostic means.Described oligonucleotide or oligomer comprise the nucleotide sequence with at least nine (9) individual Nucleotide, it is same as or treated nucleic acid sequence SEQ ID NOS:10 to the SEQ ID NO:15 of (as hereinbefore defined) hybridization under medium tight or stringent condition, SEQ IDNOS:28 to SEQ ID NO:33, SEQ ID NOS:30 to SEQ ID NO:31, SEQ IDNOS:42 to SEQ ID NO:43, SEQ ID NOS:38 to SEQ ID NO:39, SEQ IDNOS:50 to SEQ ID NO:51, SEQ ID NOS:168 to SEQ ID NO:203 and/or its complementary sequence, perhaps genome sequence SEQ ID NOS:1 to SEQ ID NO:3, SEQ IDNOS:24, SEQ ID NO:28, SEQ ID NOS:159 to SEQ ID NO:167 and/or its complementary sequence.

Therefore, present invention resides under the medium tight and/or tight hybridization conditions hybridization and be selected from SEQID NOS:1 to SEQ ID NO:3, SEQ ID NO:24, SEQ ID NO:28, SEQ IDNOS:159 to SEQ ID NO:167, SEQ ID NOS:10 to SEQ ID NO:15, SEQID NOS:28 to SEQ ID NO:33, SEQ ID NOS:30 to SEQ ID NO:31, SEQID NOS:42 to SEQ ID NO:43, SEQ ID NOS:38 to SEQ ID NO:39, SEQID NOS:50 to SEQ ID NO:51, the nucleic acid molecule of all or part of sequence of SEQ ID NOS:168 to SEQ ID NO:203 or its complementary sequence (for example oligonucleotide and peptide nucleic acid(PNA) (PNA) molecule (PNA-oligomer)).Especially preferred is that hybridization is selected from SEQ ID NOS:10 to SEQ ID NO:15 under medium tight and/or tight hybridization conditions, SEQ ID NOS:28 to SEQ ID NO:33, SEQ ID NOS:30 to SEQ ID NO:31, SEQ ID NOS:42 to SEQ ID NO:43, SEQ ID NOS:38 to SEQ ID NO:39, SEQ ID NOS:50 to SEQ ID NO:51, SEQ ID NOS:168 to SEQ ID NO:203 rather than SEQ IDNOS:1 to SEQ ID NO:3, SEQ ID NO:24, SEQ ID NO:28, the nucleic acid molecule of SEQ ID NOS:159 to SEQ ID NO:167 or other human gene group DNA's all or part of sequence.

Identical or the hybridization portion of described hybrid nucleic acid length usually is at least 9,16,20,25,30 or 35 Nucleotide.But longer molecule has application of the present invention, therefore is also contained in the scope of the present invention.

Preferably, the hybridization portion of hybrid nucleic acid molecule of the present invention be selected from SEQ ID NOS:1 to SEQ ID NO:3, SEQ ID NO:24, SEQ ID NO:28, SEQ ID NOS:159 to SEQ ID NO:167, SEQ ID NOS:10 to SEQ ID NO:15, SEQ ID NOS:28 to SEQ ID NO:33, SEQ ID NOS:30 to SEQ ID NO:31, SEQ ID NOS:42 to SEQ ID NO:43, SEQ ID NOS:38 to SEQ ID NO:39, SEQ ID NOS:50 to SEQ ID NO:51, sequence or its part of SEQ ID NOS:168 to SEQ ID NO:203 or its complementary sequence have at least 95% or at least 98% or 100% consistence.

Hybrid nucleic acid type described herein can for example be used as primer (for example, PCR primer) or diagnosis and/or prognosis probe or primer.Preferably, the hybridization of described oligonucleotide probe and nucleic acid samples is carried out under stringent condition, and this probe is identical with target sequence 100%.Nucleic acid duplex or hybrid stability are expressed as melting temperature (Tm) or Tm, and it is probe and the dissociated temperature of target DNA.This melting temperature (Tm) can be used for determining required stringent condition.

For for corresponding sequence SEQ ID NOS:1 to SEQ ID NO:3, SEQ ID NO:24, SEQ ID NO:28, target sequence (for example allelic variant and SNP) that SEQ ID NOS:159 to SEQ ID NO:167 is relevant or basic identical rather than identical, usefully at first use the salt (for example SSC or SSPE) of specific concentrations to determine only to take place the minimum temperature of homology hybridization.Then, suppose that 1% mispairing causes Tm to reduce by 1 ℃, the also corresponding reduction of temperature of last washing in the hybridization (for example, have＞sequence of 95% identity if detect with probe, then final wash temperature reduces by 5 ℃).In fact, the variation of Tm can be between 0.5 ℃ to 1.5 ℃ of per 1% mispairing.

Length is the example of the oligonucleotide of the present invention of X (in Nucleotide), show as polynucleotide position by reference example such as SEQ ID NO:1, comprise the continuous overlapping oligonucleotide collection (justice collection and antonymous set are arranged) corresponding to those length X, wherein the oligonucleotide (corresponding to given X value) in each continuous overlapping collection is defined as from nucleotide position:

N is to (n+ (X-1))

The finite set of Z oligonucleotide;

N=1 wherein, 2,3 ... (Y-(X-1));

Wherein Y equals the length (Nucleotide or base pair) (219909) of SEQ ID NO:1;

Wherein X equals the described common length (in Nucleotide) of each oligonucleotide of concentrating (for example for continuous eclipsed 20 aggressiveness (20-mer), X=20); And

Wherein be the given SEQ ID NO of Y for length, length is that the quantity (Z) of the continuous overlapping oligomer of X equals Y-(X-1).For example, when X=20, for the Z=219909-19=219890 for justice or the antonymous set that has of SEQ ID NO:1.

Preferably, described collection is restricted to those oligomer that comprise at least one CpG, TpG or CpA dinucleotides.

The example of the present invention's 20 aggressiveness oligonucleotide comprises the collection (and with its complementary antonymous set) of following 219890 oligomer, represents by the polynucleotide position of reference SEQ ID NO:1:

1-20,2-21,3-22,4-23,5-24 ... ... and 219890-219909.

Preferably, described collection is limited in those oligomer that comprise at least one CpG, TpG or CpA dinucleotides.

Similarly, the example of 25 aggressiveness oligonucleotide of the present invention comprises the collection (and with its complementary antonymous set) of following 219885 oligomer, represents by the polynucleotide position of reference SEQ ID NO:1:

1-25,2-26,3-27,4-28,5-29............ and 219885-219909.

Preferably, described collection is limited in those oligomer that comprise at least one CpG, TpG or CpA dinucleotides.

For SEQ ID NOS:1 to SEQ ID NO3, SEQ ID NO.24, SEQ IDNO:28, SEQ ID NOS:159 to SEQ ID NO:167, SEQ ID NOS:10 to SEQID NO:15, SEQ ID NOS:28 to SEQ ID NO:33, SEQ ID NOS:30 to SEQID NO:31, SEQ ID NOS:42 to SEQ ID NO:43, SEQ ID NOS:38 to SEQID NO:39, SEQ ID NOS:50 to SEQ ID NO:51, among SEQ ID NOS:168 to the SEQID NO:203 (have justice and antisense) each the present invention includes a plurality of continuous overlapping collection of the oligonucleotide of oligonucleotide that length is X or modification.

Oligonucleotide of the present invention or oligomer constitute the heredity of the genome sequence that can be used for determining being selected from SEQ ID NOS:1 to SEQ ID NO:3, SEQ ID NO:24, SEQ ID NO:28, SEQ ID NOS:159 to SEQ ID NO:167 and the effective tool of epigenetic parameter.The preferred collection of oligonucleotide that this class length is X or modified oligonucleotide is that those are corresponding to SEQ ID NOS:1 to SEQ ID NO:3, SEQ ID NO:24, SEQ ID NO:28, SEQID NOS:159 to SEQ ID NO:167, SEQ ID NOS:10 to SEQ ID NO:15, SEQ ID NOS:28 to SEQ ID NO:33, SEQ ID NOS:30 to SEQ ID NO:31, SEQ ID NOS:42 to SEQ ID NO:43, SEQ ID NOS:38 to SEQ ID NO:39, SEQ ID NOS:50 to SEQ ID NO:51, the continuous overlapping collection of the oligomer of SEQ ID NO:168 to SEQ ID NO:203 (and complementary sequence).Preferably, described oligomer comprises at least one CpG, TpG or CpA dinucleotides.

Especially preferred oligonucleotide of the present invention or oligomer are positioned at those of middle part 1/3rd of this oligonucleotide for the cytosine(Cyt) of CpG dinucleotides wherein (or TpG or CpA dinucleotides of corresponding transformation) sequence; Promptly wherein this oligonucleotide for example is that 13 bases are long, and then CpG, TpG or CpA dinucleotides are positioned at from the 5th to the 9th amino acid of 5 ' end.

Oligonucleotide of the present invention also can be by being connected to one or more parts with this oligonucleotide chemistry or conjugate is modified, with the activity, the stability that improve this oligonucleotide or detect.This class part or conjugate comprise chromophore, and fluorophore is such as the lipid of cholesterol, cholic acid, thioether, aliphatic chain, phosphatide, polyamines, polyoxyethylene glycol (PEG), palmityl part and other for example are disclosed in United States Patent (USP) 5,514,758,5,565,552,5,567,810,5,574,142,5,585,481,5,587,371,5,597, in 696 and 5,958,773.Described probe also can be the form of PNA (peptide nucleic acid(PNA)), and it has particularly preferred pairing performance.Therefore, described oligonucleotide can comprise other additional group, for example peptide, and can comprise cutting agent that hybridization triggers people such as (, BioTechniques 6:958-976,1988) Krol or intercalating agent (Zon, Pharm.Res.5:539-549,1988).For this reason, described oligonucleotide can be coupled to another molecule, for example the cutting agent that triggers of the linking agent, transport agents, the hybridization that trigger of chromophore, fluorophore, peptide, hybridization etc.

Described oligonucleotide also can comprise the sugar and/or the base portion of at least a known modification, maybe can comprise key between the main chain of modification or non-natural nucleoside.

According to particular of the present invention, described oligonucleotide or oligomer are used in " collection " usually, it contains at least one oligomer, be used for analyzing and be selected from SEQ ID NOS:1 to SEQ ID NO:3, SEQ ID NO:24, SEQ ID NO:28, each CpG dinucleotides of the genome sequence of SEQ ID NOS:159 to SEQ ID NO:167 and complementary sequence, or treated nucleic acid SEQ ID NOS:10 to SEQ ID NO:15, SEQ ID NOS:28 to SEQ ID NO:33, SEQ ID NOS:30 to SEQ ID NO:31, SEQ ID NOS:42 to SEQ ID NO:43, SEQ ID NOS:38 to SEQ ID NO:39, SEQ ID NOS:50 to SEQ ID NO:51, the CpG of correspondence in SEQ ID NOS:168 to SEQ ID NO:203 and the complementary sequence thereof, TpG or CpA dinucleotides.But expection can preferably be analyzed the CpG of limited selection in the described sequence for economy or other factors, and correspondingly changes the capacity of described oligonucleotide collection.

Therefore, in specific embodiments, the invention provides the collection that contains at least two (2) individual (oligonucleotide and/or PNA oligomer), can be used for detecting treated genomic dna (SEQ IDNOS:10 to SEQ ID NO:15, SEQ ID NOS:28 to SEQ ID NO:33, SEQ IDNOS:30 to SEQ ID NO:31, SEQ ID NOS:42 to SEQ ID NO:43, SEQ IDNOS:38 to SEQ ID NO:39, SEQ ID NOS:50 to SEQ ID NO:51, SEQ IDNOS:168 to SEQ ID NO:203) or genomic dna (SEQ ID NOS:1 to SEQ IDNO:3, SEQ ID NO:24, SEQ ID NO:28, SEQ ID NOD:159 to SEQ IDNO:167 and complementary sequence thereof) in the cytosine methylation state.These probes make the heredity and the epigenetic parameter of diagnosis, classification and/or treatment liver and/or colorectal cell proliferative disorders become possibility.This cover oligomer also can be used to detect treated genomic dna (SEQID NOS:10 to SEQ ID NO:15, SEQ ID NOS:28 to SEQ ID NO:33, SEQID NOS:30 to SEQ ID NO:31, SEQ ID NO:42 to SEQ ID NO:43, SEQ IDNO:38 to SEQ ID NO:39, SEQ ID NOS:50 to SEQ ID NO:51, SEQ IDNOS:168 to SEQ ID NO:203) in, or genomic dna (SEQ ID NOS:1 to SEQII NO:3, SEQ ID NO:24, SEQ ID NO:28, SEQ ID NO:159 to SEQ IDNOS:167 and complementary sequence thereof) in single nucleotide polymorphism (SNPs).

In preferred embodiments, at least a, more preferably all members of oligonucleotide collection are incorporated in to solid phase.

In other embodiments, the invention provides the collection that contains at least two (2) individual Nucleotide, they are used as " primer " oligonucleotide SEQ ID NOS:1 to SEQ ID NO:3 that is used to increase, SEQ ID NO:24, SEQ ID NO:28, SEQ ID NOS:159 to SEQ ID NO:167, SEQ ID NOS:10 to SEQ ID NO:15, SEQ ID NOS:28 to SEQ ID NO:33, SEQ ID NOS:30 to SEQ ID NO:31, SEQ ID NOS:42 to SEQ ID NO:43, SEQ ID NOS:38 to SEQ ID NO:39, SEQ ID NOS:50 to SEQ ID NO:51, the dna sequence dna of SEQ ID NOS:168 to SEQ ID NO:203 and one of complementary sequence or its fragment.

Expect that described oligonucleotide can constitute whole or part " array " or " DNA chip " (that is, being attached to the arrangement of the different oligonucleotide and/or the PNA-oligomer of solid phase).The feature of the array of this different IPs thuja acid and/or PNA-oligomer sequence can for example be to arrange with rectangle or hexagonal-lattice on solid phase.Described solid phase surface can be made of silicon, glass, polystyrene, aluminium, steel, iron, copper, nickel, silver or gold.Also can use nitrocellulose and plastics such as nylon, it can exist with sedimental form or as resinous substrates, also can be used.The summary that the oligomer array prepares the aspect prior art can obtain from the special version of Nature Genetics (Nature Genetics Supplement, Volume 21, January 1999, and the document of wherein being quoted).Fluorescently-labeled probe is generally used for scanning immobilized DNA array.It is last especially suitable for fluorescent marker that Cy3 and Cy5 dyestuff simply are attached to 5 ' of particular probe-OH.The detection of fluorescence probe to hybridization can for example be undertaken by Laser Scanning Confocal Microscope.Cy3 and Cy5 dyestuff and much other dyestuff all be commercially available.

Expect that also described oligonucleotide or its particular sequence can constitute all or part of of " virtual array ", wherein said oligonucleotide or its particular sequence are as for example " assigned object (specifier) ", as various group the part that is labeled probe of uniqueness, or analyze the complex mixture of assay with its combination.This method for example is described among the US 2003/0013091 (United States serial 09/898,743, on January 16th, 2003 is open).In these methods, produce abundant marker, so that every kind of nucleic acid in this complex mixture (being every kind of analyte) can be by the unique combination of unique tag thing, thereby detected (every kind of marker is a direct census, obtains the digital readout of every kind of molecule in the mixture).

Especially preferred is that oligomer of the present invention is used for one of following purposes at least: detect, detect and distinguish hypotype, diagnosis, prognosis, treatment, monitoring and treatment and monitoring liver and/or colorectal cell proliferative disorders.This realizes by using described collection and detect or detect and distinguish in the following types of organization one or more: colorectal carcinoma, colorectal carcinoma, inflammatory colon, 2 grades of heteroplasia adenoma of colon less than 1cm, 3 grades of heteroplasia adenoma of colon greater than 1cm, normal colon, non-colon health tissue and non-colon cancer tissue.

Especially preferred is those oligomer collection among the embodiment.

In the most preferred embodiment of described method, determine whether to exist cell proliferative disorders, most preferably definite knurl sexual cell breeds or itself and optimum illness is distinguished.This realizes by analyzing at least a methylation state that comprises the target sequence of at least one CpG position, at least 16 continuous nucleotides that wherein said sequence comprises or hybridization is selected from the sequence of SEQ ID NOS:1 to SEQ ID NO:3, SEQ ID NO:24, SEQ ID NO:28, SEQ ID NOS:159 to SEQ ID NO:167 and complementary sequence thereof under stringent condition.The present invention also provides by analyzing cytosine methylation and single nucleotide polymorphism and determines genome sequence SEQ IDNOS:1 to SEQ ID NO:3 in the individuality, SEQ ID NO:24, SEQ ID NO:28, the heredity of SEQ ID NOS:159 to SEQ ID NO:167 and/or the method for epigenetic parameter.Described method comprises makes the nucleic acid that comprises SEQ ID NOS:1 to SEQ IDNO:3, SEQ ID NO:24, SEQ ID NO:28, SEQ ID NOS:159 to SEQ ID NO:167 from the described individual biological sample that obtains with at least a reagent or become group reagent contact, wherein said reagent or in groups reagent area divide described target nucleic acid interior methylating and non-methylated CpG dinucleotides.

In preferred embodiments, said method comprising the steps of: in the first step, obtain tissue sample to be analyzed.This source can be any suitable source, for example clone, Histological section, biopsy, paraffin-embedded tissue, body fluid, ight soil, colon effluent, urine, blood plasma, serum, whole blood, isolating hemocyte, from the cell and all possible combination thereof of blood separation.Preferably, the described source of DNA is ight soil or body fluid, is selected from the cell of colon effluent, urine, blood plasma, serum, whole blood, isolating hemocyte, separation autoblood.

Then from described sample separation genomic dna.Can separate by any standard approach of the prior art, comprise and use commercially available test kit.In brief, when target DNA was wrapped in the cytolemma, this biological sample must be broken and be cleaved by enzyme, chemistry or mechanical means.For example remove albumen and other pollutent subsequently by the digestion of protein kinase K.Then reclaim genomic dna from solution.This can realize by the whole bag of tricks, comprise saltout, organic extraction or DNA is attached to solid support.Selection to method can be subjected to influence of various factors, comprises the amount of time, expense and required DNA.

When described sample DNA is not wrapped in the cytolemma circulation DNA of blood sample (for example from), can uses and separate in the prior art and/or the standard method of purify DNA.These methods comprise uses proteolytic degradation reagent, chaotropic salt for example, example hydrochloric acid guanidine or urea; Or stain remover, as sodium laurylsulfonate (SDS), cyanogen bromide.Other method includes but not limited to ethanol sedimentation or propyl alcohol precipitation, passes through centrifugal vacuum concentration etc.Those skilled in the art also can use device, for example such as the filter of ultrafiltration, and silicon face or film, magnetic-particle, granules of polystyrene, polystyrene surface, positively charged surface and with the film of positive electric charge, charged membrane, powered surfaces, charged conversion film, charged conversion surface.

In case nucleic acid is extracted, just the genome double-stranded DNA is used for analyzing.

In second step of described method, described genome DNA sample handled so that changed into uridylic, thymus pyrimidine or in the hybridization behavior, be not used in another base of cytosine(Cyt) 5 ' unmethylated cytosine(Cyt) base.This should be understood that " pre-treatment " as herein described or " processing ".

This preferably realizes by the hydrosulphite agent treated.Term " hydrosulphite reagent " refers to comprise the reagent of hydrosulphite, hydrosulphite (disulfite), bisul-phite or its combination, can be used for as disclosed herein distinguishing methylating and unmethylated CpG dinucleotides sequence.Described processing is well known in the art (for example PCT/EP2004/011715 incorporates its integral body into this paper by reference).Preferably, this bisulf iotate-treated is carried out in the presence of the sex change solvent, and described sex change solvent is such as, but not limited to positive alkyl diol, and especially diethylene glycol dimethyl ether (DME) perhaps carries out in the presence of diox or dioxane derivatives.In preferred embodiments, described sex change solvent uses with the concentration of 1% to 35% (v/v).Also preferred this bisulfite reaction carries out in the presence of scavenging agent, such as but not limited to the chromanane derivative, as 6-hydroxyl-2,5,7,8 ,-tetramethyl-chromanane 2-carboxylic acid or trihydroxybenzoic acid and derivative thereof, gallic acid (referring to PCT/EP2004/011715, with its integral body by with reference to incorporating this paper into) for example.This hydrosulphite changes and preferably carries out under 30 ℃ to 70 ℃ temperature of reaction, and wherein during reaction temperature increases in short time and surpasses 85 ℃ (referring to PCT/EP2004/011715, incorporating its integral body into this paper by reference).DNA through bisulf iotate-treated preferably carried out purifying before quantitatively.This can be undertaken by any method well known in the prior art, such as but not limited to ultrafiltration, is preferably undertaken by Microcon^ (TM) post (being produced by Millipore^ (TM)).This purifying carries out (referring to PCT/EP2004/011715, with its integral body by with reference to incorporating this paper into) according to the scheme of manufacturers of improvement.

In the 3rd step of described method, adopt the fragment of the treated DNA of primer set oligonucleotide of the present invention and amplification enzymatic amplification.Can in same reaction vessel, carry out the amplification of several dna fragmentations simultaneously.Usually, this amplified reaction adopts polymerase chain reaction (PCR) to carry out.Preferably, the length of described amplified production is 100 to 2,000 base pairs.Described complete primer tasteless nucleotide comprises at least two kinds of oligonucleotide, the sequence of each all reverse complemental in, be same as, or under tight or height stringent condition hybridization SEQ ID NOS:10 to SEQID NO:15, SEQ ID NOS:28 to SEQ ID NO:33, SEQ ID NOS:30 to SEQID NO:31, SEQ ID NOS:42 to SEQ ID NO:43, SEQ ID NOs:38 to SEQID NO:39, SEQ ID NOS:50 to SEQ ID NO:51, the long fragment of at least 16 bases of the base sequence of one of SEQ ID NOS:168 to SEQID NO:203 and complementary sequence thereof.

In other embodiment of described method, the methylation state of the CpG position of preliminary election can detect by the primer tasteless nucleotide that uses methylation specific in the nucleotide sequence of at least a SEQ of being selected from ID NOS:1 to SEQ ID NO:3, SEQ ID NO:24, SEQ ID NO:28, SEQ ID NOS:159 to SEQ ID NO:167.This technology (MSP) is described in the United States Patent (USP) 6,265,171 of authorizing Herman.Using the methylation state special primer to increase methylates and unmethylated nucleic acid through feasible can the differentiation of the DNA of bisulf iotate-treated.The MSP primer is to containing the primer of at least one hybridization through the CpG of bisulf iotate-treated dinucleotides.Therefore, the sequence of described primer comprises at least one CpG dinucleotides.Being specific to not, the MSP primer of methylate DNA contains " T " in the C position of CpG.Preferably, thereby the base sequence of described primer need comprise the sequence with at least 9 length of nucleotides, nucleic acid sequence SEQ ID NOS:10 to the SEQ ID NO:15 that its hybridization is treated, SEQ IDNOS:28 to SEQ ID NO:33, SEQ ID NOS.30 to SEQ ID NO:31, SEQ IDNOS:42 to SEQ ID NO:43, SEQ ID NOS:38 to SEQ ID NO:39, SEQ IDNOS:50 to SEQ ID NO:51, one of SEQ ID NOS:168 to SEQ ID NO:203 and complementary sequence thereof, the base sequence of wherein said oligomer comprise at least one CpG dinucleotides.Further preferred embodiment of the present invention comprises uses blocking-up oligonucleotide (HeavyMethyl ^TMMeasure).To the use of this class blocking-up oligonucleotide by people such as Yu, BioTechniques 23:714-720,1997 describe.Blocking-up probe oligonucleotides and PCR primer are hybridized simultaneously to the nucleic acid through bisulf iotate-treated.The pcr amplification of this nucleic acid stops in 5 ' position of blocking-up probe, so that the amplification of nucleic acid is suppressed when existence is complementary to the sequence of blocking-up probe.Described probe can be designed as in the special mode of methylation state hybridizes nucleic acid through bisulf iotate-treated.For example, in order to detect the methylated nucleic acid in the methylated nucleic acid group not, can be undertaken by using the blocking-up probe inhibition in the amplification of the unmethylated nucleic acid in discussion position, this blocking-up probe comprises " CpA " or " TpA " in the discussion position, this " CpG " during with the amplification that wish to suppress methylated nucleic acid is opposite.

For the PCR method that adopts the blocking-up oligonucleotide, effectively destroying polymerase-mediated amplification needs blocker not to be aggregated the enzyme extension.Preferably, this is by using 3 '-deoxy-oligonucleotide blocker or realizing at 3 ' deutero-oligonucleotide blocker that has except that " freedom " oh group.For example, 3 '-O-ethanoyl oligonucleotide is the representative of the preferred classes of blocker molecule.

In addition, should get rid of polymerase-mediated blocking-up oligonucleotide degraded.Preferably, this eliminating comprises uses the polysaccharase that lacks 5 '-3 ' 5 prime excision enzyme activity, perhaps uses the blocking-up oligonucleotide of modifying, and it for example has the thioesters bridge at its 5 ' end, and this gives this blocker molecule nuclease resistance.Specific application can not need this 5 ' of blocker to modify.For example, if blocking-up and primer binding site are overlapping thereby prevented the combination (for example, blocker is excessive) of primer, the degraded of then blocking oligonucleotide will prevent basically.This is because polysaccharase can not extend primer forward and pass the process that (5 '-3 ' direction) blocker-a kind of causes the blocking-up oligonucleotide degraded of hybridizing usually.

For purposes of the present invention and as implementing here, especially preferred blocker/PCR embodiment comprises to be used peptide nucleic acid(PNA) (the PNA oligomer is as the blocking-up oligonucleotide.This PNA blocking-up oligomer is fit to admirably, also is not aggregated the enzyme extension because they are not degraded.

Preferably, therefore the base sequence of described blocking-up oligonucleotide requires to comprise the sequence with at least 9 length of nucleotides, one of nucleic acid sequence SEQ ID NOS:10 to SEQ ID NO:15, SEQ ID NOS:28 to SEQ ID NO:33, SEQ ID NOS:30 to SEQ ID NO:31, SEQ ID NOS:42 to SEQ ID NO:43, SEQ ID NOS:38 to SEQ ID NO:39, SEQ ID NOS:50 to SEQ ID NO:51, SEQ ID NOs:168 to SEQ ID NO:203 and complementary sequence thereof that its hybridization is treated, wherein.The base sequence of described oligonucleotide comprises at least one CpG, TpG or CpA dinucleotides.

The fragment portability that obtains by amplification has the marker that can detect directly or indirectly.Preferably, marker is the form of fluorescent marker, the radionuclide molecule fragment that maybe can adhere to, and this molecule fragment that can adhere to has the quality that can detect usually in mass spectrum.When described marker was the mass spectrum marker, preferably the amplified production of mark had single positive or negative net charge, and making can be detected better in mass spectrograph.Can or use electrospray ionization mass spectrum (ESI) to detect and observe by for example substance assistant laser desorpted/MALDI-MS (MALDI).

Substance assistant laser desorpted/MALDI-MS (MALDI-TOF) is the very effective progress of analysing biomolecules (Karas ﹠amp; Hillenkamp, Anal Chem., 60:2299-301,1988).Analyte is embedded in the light absorbing matrix.This matrix is evaporated by short laser pulse, and the mode with non-fragmentation is delivered into vapor phase with analyte molecule thus.This analyte is ionized by the collision with substrate molecule.The voltage that applies quickens this ion and enters the field-free flight pipe.Because their different quality, ion is accelerated with different speed.Small ion is than the faster arrival detector of heavy ion.The MALDI-TOF mass spectrum is suitable for analyzing peptide and albumen very much.To the molecule of nucleic acid some difficulty (Gut ﹠amp slightly; Beck, Current Innovations and Future Trends, 1:147-57,1995).The susceptibility of foranalysis of nucleic acids is approximately little 100 times than peptide, and is inversely proportional to the clip size that increases.In addition, for main chain, lower via the obvious efficient of ionization process of matrix with a plurality of negative charges.In the MALDI-TOF mass spectrum, extremely crucial to choice of base.For the desorb of peptide, found several very effective matrix, it produces fabulous crystallization.The matrix of replying that several DNA of being used for are arranged now, still, sensitivity difference is not eliminated between peptide and nucleic acid.Yet sensitivity difference can become it by chemically modified DNA and be similar to peptide more and reduce.For example, adopt simple alkylation chemistry, thiophosphatephosphorothioate (phosphorothioate) nucleic acid (wherein common phosphide main chain is replaced by thiophosphatephosphorothioate (thiophosphate)) can be changed advances (Gut ﹠amp among the electroneutral DNA; Beck, NucleicAcids Res.23:1367-73,1995).The electric charge label is connected to this modified DNA causes MALDI-TOF susceptibility to increase to the level of peptide.Other advantage of electric charge label is the analysis stability that overcomes the increase of impurity, and wherein impurity makes that the substrate that detects unmodified is obviously difficult more.

In the 4th step of described method, analyze the amplified production that in the 3rd step of described method, obtains, so that the methylation state of CpG dinucleotides before determining to handle.

Obtaining in the embodiment of amplified production by the MSP amplification, according to the base sequence of described primer, whether amplified production exists the methylation state that self has just shown the CpG position that is covered by this primer.

All can further analyze by the amplified production that standard and methylation specific PCR obtain by method based on base, such as but not limited to array technique with based on the technology of probe, and by the technology such as order-checking and template guided extension.

In an embodiment of described method, the synthetic amplified production is hybridized subsequently to oligonucleotide and/or PNA probe array or oligonucleotide and/or PNA probe sets in the 3rd step.In this case, hybridization is carried out as follows: the probe sets of using in the crossover process preferably is made up of at least two oligonucleotide or PNA oligomer; In this process, amplified production is attached to the oligonucleotide of solid phase as probe before its hybridization; Remove the not fragment of hybridization subsequently; Described oligonucleotide contains at least one base sequence with at least 9 length of nucleotides, its reverse complementation or be same as the fragment of the base sequence that provides in sequence table of the present invention; And described fragment comprises at least one CpG, TpG or CpA dinucleotides.The length of the hybridization portion of hybrid nucleic acid typically is at least 9,15,20,25,30 or 35 Nucleotide.But longer molecule has application of the present invention, therefore also falls within the scope of the present invention.

In preferred embodiments, described Nucleotide is present in the centre 1/3rd of described oligomer.For example, when described oligomer comprised a CpG dinucleotides, described dinucleotides was preferably the 5th to the 9th Nucleotide from 5 ' end of 13 aggressiveness.For being selected from SEQ IDNOS:1 to SEQ ID NO:3, SEQ ID NO:24, SEQ ID NO:28, each CpG dinucleotides in the sequence of SEQ IDNOS:159 to SEQ ID NO:167 and SEQID NOS:10 to SEQ ID NO.15, SEQ ID NOS:28 to SEQ ID NO.33, SEQID NOs:30 to SEQ ID NO:31, SEQ ID NOS:42 to SEQ ID NO:43, SEQID NOS:38 to SEQ ID NO:39, SEQ ID NOS:50 to SEQ ID NO:51, equivalent site in SEQID NOS:168 to the SEQ ID NO:203 all exists a kind of oligonucleotide to be used for its analysis.

Described oligonucleotide also can exist with the form of peptide nucleic acid(PNA).Remove the not amplified production of hybridization then.Detect the amplified production of hybridization subsequently.In this case, preferably, the marker that is connected to amplified production all can be differentiated in residing each position of the oligonucleotide of solid phase.

In other embodiments, the genomic methylation state of CpG position can by with the pcr amplification primer (wherein said primer can be methylation specific or standard) hybridize simultaneously through the oligonucleotide probe (as above describing in detail) of the DNA of bisulf iotate-treated and determine.

In the especially preferred embodiment of this method, use the fluorescence oligonucleotide probe (TaqMan that adopts double-tagging ^TMPCR adopts ABI Prism 7700 Sequence DetectionSystem, Perkin Elmer Applied Biosystems, Foster City, California) real-time quantitative PCR (people such as Heid, Genome Res.6:986-994,1996 based on fluorescence; Also referring to United States Patent (USP) 6,331,393).This TaqMan ^TMInextensible detection oligonucleotide is adopted in the PCR reaction, is called TaqMan ^TMProbe, in preferred embodiments, it is designed to and the sequence hybridization that is rich in CpG between forward and reverse amplimer.This TaqMan ^TMProbe also comprises fluorescence " reporter part " and " cancellation part ", and they are covalently bound to being attached to described TaqMan ^TMThe shank of the Nucleotide of oligonucleotide (for example phosphoramidite).For methylating in bisulf iotate-treated post analysis nucleic acid, needing probe is methylation specific, as United States Patent (USP) 6,331, described in 393 (by with reference to incorporating its integral body into this paper), is also referred to as MethyLightTM ^TMMeasure.Also be applicable to TaqMan of the present invention ^TMThe variation of detection method comprises uses two probe technique (Lightcycler ^TM) or amplified fluorescence primer (Sunrise ^TMTechnology).These two kinds of technology all can be changed being applicable to the DNA through bisulf iotate-treated, and are used for the methylation analysis in the CpG dinucleotides.

In the further preferred embodiment of described method, the 4th step of described method comprises uses template guided oligonucleotide to extend, as Gonzalgo ﹠amp; Jones, Nucleic Acids Res.25:2529-2531,1997 MS-SNuPE that describe.

In other embodiment of described method, the 4th step of described method comprises amplified production order-checking that described method was produced in the 3rd step and sequential analysis subsequently people such as (, Proc Natl Acad Sci USA 74:5463-5467,1977) Sanger F..

Preferred plan

In the most preferred embodiment of described method, described genomic nucleic acids is separated and processing according to the first three steps of aforesaid method, that is:

A) obtain to have the biological sample of genes of individuals group DNA from individuality;

B) extract or otherwise separate described genomic dna;

C) with one or more agent treated b) genomic dna or its fragment, changing uridylic into or in another base that can be different from cytosine(Cyt) aspect the cross performance 5 ' unmethylated cytosine(Cyt) base with detecting; And wherein

D) amplification after handling c) is carried out in the mode of methylation specific, promptly passes through the primer or the blocking-up oligonucleotide of methylation specific, and further, wherein

E) detection to amplified production is to be undertaken by real-time detection probes, as mentioned above.

Preferably, as d) increase subsequently when being undertaken by the mode of aforesaid methylation specific primer, the primer of described methylation specific comprises the sequence with at least 9 Nucleotide length, nucleic acid sequence SEQ ID NOS:10 to the SEQ ID NO:15 that this sequence hybridization is treated, SEQID NOS:28 to SEQ ID NO:33, SEQ ID NOS:30 to SEQ ID NO:31, SEQID NS:42 to SEQ ID NO:43, SEQ ID NOS:38 to SEQ ID NO:39, SEQ IDNOS:50 to SEQ ID NO:51, one of SEQ ID NOs:168 to SEQ ID NO:203 and complementary sequence thereof, the base sequence of wherein said oligomer comprise at least one CpG dinucleotides.

The step e) of described method is promptly undertaken by aforesaid real-time detection method the detection that shows the specific amplified product of one or more CpG position methylation state of at least a sequence among SEQ ID NOS:1 to SEQ ID NO:3, SEQ ID NO:24, SEQ ID NO:28, SEQ ID NOS:159 to the SEQ ID NO:167.

Other embodiment of the present invention provides the method for analysis genomic dna of the present invention (SEQ ID NOs:1 to SEQ ID NO:3, SEQ ID NO:24, SEQ IDNO:28, SEQ ID NOS:159 to SEQ ID NO:167 and the complementary sequence thereof) methylation state that need not the hydrosulphite transformation.Such method known in the state of the art, include but not limited to DMH, the a series of restriction enzyme reagent that wherein methylate responsive restriction enzyme reagent or comprise the responsive restriction enzyme reagent that methylates are used to determine to methylate, and this responsive restriction enzyme reagent that methylates can be distinguished and methylate in the target region and methylated CpG dinucleotides not.

In the first step of this other embodiment, from tissue or cell source isolation of genomic DNA.Genomic dna can separate by any standard approach in the prior art, comprises the test kit that use can be buied.In brief, when target DNA was wrapped in the cytolemma, this biological sample must be broken and be cleaved by enzyme, chemistry or mechanical means.For example remove albumen and other pollutent subsequently by the digestion of protein kinase K.Then reclaim this genomic dna from solution.This can realize by the whole bag of tricks, comprise saltout, organic extraction or DNA is attached to solid support.Selection to method can be subjected to influence of various factors, comprises the amount of time, expense and required DNA.All clinical sample kinds, comprise knurl material or potential knurl material, all be suitable for use in the inventive method, preferably clone, Histological section, biopsy, paraffin-embedded tissue, body fluid, ight soil, colon effluent, urine, blood plasma, serum, whole blood, isolating hemocyte, from blood isolated cells, and combination.Body fluid is preferred DNA source; Especially preferred is blood plasma, serum, whole blood, isolating hemocyte and from the cell of blood separation.

In case after nucleic acid was extracted, the genome double-stranded DNA just was used in the analysis.

In preferred embodiments, described DNA can be cut before with the responsive restriction enzyme treatment that methylates.These class methods are known in the prior art, can comprise physics and chemical means.The especially preferred restriction enzyme that is to use one or more non-sensitivities that methylate, and their recognition site is rich in AT and does not comprise the CG dinucleotides.This zymoid uses the feasible zone that can keep the CpG island and be rich in CpG in the DNA of fragmentation.The restriction enzyme of described non-methylation specific preferably is selected from MseI, BfaI, Csp6I, Tru1I, Tvu1I, Tru9I, Tvu9I, MaeI and XspI.Especially preferred two or three this fermentoid that is to use.The especially preferred combination that is to use MseI, BfaI and Csp6I.

The DNA of fragmentation can be connected to the joint oligonucleotide subsequently, to help enzyme process amplification subsequently.It is known in the prior art that oligonucleotide is connected to flat dna fragmentation terminal and sticky end, by making terminal dephosphorylation (for example using ox or shrimp alkaline phosphotase) and using ligase enzyme (for example T4 dna ligase) to connect subsequently in the presence of dATPs and finish.It is long that described joint oligonucleotide is generally at least 18 base pairs.

In the 3rd step, digest described DNA (or its fragment) with one or more responsive restriction enzymes that methylate subsequently.Carry out described digestion so that DNA provides the methylation state information of the specific CpG dinucleotides of the gene of at least a Septin of being selected from 9 (comprising its all transcript variants), FOXL2, SARM1, VTN, PRDM6, NR2E1, FAT and SEQ ID NOS:160 to SEQ ID NO:165 or genome sequence in the hydrolysis of restriction site.

Preferably, the restriction enzyme of methylation specific is selected from the mixture of Bsi EI, Hga I HinPI, Hpy99I, Ava I, Bce AI, Bsa HI, BisI, BstUI, Bshl236I, AccII, BstFNI, McrBC, GIaI, MvnI, HpaII (HapII), HhaI, AciI, SmaI, HinP1I, HpyCH4IV, EagI and above two or more enzymes.The mixture that preferably contains restriction enzyme BstUI, HpaII, HpyCH4IV and HinP1I.

In the 4th step, it is for choosing wantonly but embodiment preferred, and described restriction fragment is amplified.This can be undertaken by the polymerase chain reaction, and described amplified production can have the certification mark thing that is fit to as mentioned above, i.e. fluorescent marker, radionuclide and mass spectrum marker.Especially preferred is that each primer that all comprises the long continuous sequence of at least 16 Nucleotide increases by amplification enzyme and at least two kinds, and described continuous sequence is complementary to or hybridizes under medium tight or stringent condition and is selected from SEQ ID NOS:1 to SEQ ID NO:3, SEQ ID NO:24, SEQ ID NO:28, the sequence of SEQ ID NOS:159 to SEQ ID NO:167 and the sequence of complementary sequence thereof.Preferably, described continuous sequence is long at least 16,20 or 25 Nucleotide.In other embodiments, described primer can be complementary to and be connected to described segmental any joint.

In the 5th step, detect described amplified production.This detection can make any standard approach of the prior art, such as but not limited to gel electrophoresis analysis, hybridization analysis, with detectable mix in the PCR product, DNA array analysis, MALDI or ESI analyze.Preferably, described detection is undertaken by hybridizing at least a each nucleic acid or peptide nucleic acid(PNA) that all comprises the long continuous sequence of 16 Nucleotide at least, described continuous sequence be complementary to or medium forbid or stringent condition under hybridization be selected from the sequence of SEQ ID NOS:1 to SEQ ID NO:3, SEQ ID NO:24, SEQID NO:28, SEQ ID NOS:159 to SEQ ID NO:167 and complementary sequence thereof.Preferably, described continuous sequence is long at least 16,20 or 25 Nucleotide.

After the methylation state or level of determining described genomic nucleic acids, based at least a SEQ ID NOS:1 to the SEQ ID NO:3 that is selected from, SEQ ID NO:24, SEQ ID NO:28, the methylation state or the level of at least one CpG dinucleotides sequence of the sequence of SEQ ID NOS:159 to SEQ ID NO:167, or reflect at least a SEQ of being selected from ID NOS:1 to SEQ ID NO:3, SEQ ID NO:24, SEQ ID NO:28, the average of the average methylation state of a plurality of CpG dinucleotides sequences of the sequence of SEQ ID NOS:159 to SEQ ID NO:167 or value infer whether cell proliferative disorders exists or its classification, and it is relevant with cell proliferative disorders before knurl or the knurl wherein to methylate.Methylate when determining when described, be used for determining that the described threshold value that exists that methylates is preferably zero (promptly when sample shows methylating of any degree, being defined as having methylated state in the CpG position of analysis) by quantitative means.Yet, can predict that those skilled in the art may wish to adjust described threshold value so that provide particularly preferred susceptibility or specificity for mensuration.Correspondingly, described threshold value can improve (therefore improving specificity), and described threshold value can be in the scope of 0%-5%, 5%-10%, 10%-15%, 15%-20%, 20%-30% or 30%-50%.Especially preferred is threshold value 10%, 15%, 25% and 30%.

In other embodiment of described method, wherein gene comprises the transcript Q9HC74 and at least a FOXL2 of being selected from of Septin 9 or its brachymemma in groups, NGFR, TMEFF2, SIX6, SARM1, the gene of VTN and ZDHHC22, after the methylation state of determining described genomic nucleic acids, methylation state according at least one CpG dinucleotides sequence of at least one the CpG dinucleotides sequence of SEQ ID NO:1 and SEQ ID NO:24 to SEQ ID NO:29, or the average or the value that reflect the average methylation state of its a plurality of CpG dinucleotides infer whether have cell proliferative disorders or its hypotype, especially liver and/or colorectal cell proliferative disorders, wherein methylate and cancer, especially liver and/or colorectal carcinoma are relevant.

The diagnosis of cell proliferative disorders and prognosis are measured

The invention enables to diagnose to be unfavorable for patient or individual incident, the gene of the wherein at least a Septin of being selected from 9 (comprising the transcript variant that they are all), FOXL2, SARM1, VTN, PRDM6, NR2E1, FAT and SEQ ID NOS:160 to SEQ ID NO:165 or the important heredity in the genome sequence and/or epigenetic parameter can be used as mark.The described parameter that obtains by the inventive method can compare with another set of heredity and/or epigenetic parameter, and its difference is as the diagnosis of the incident that is unfavorable for patient or individuality and/or the basis of prognosis.

More specifically, the invention enables and to screen risk population, most preferably liver cancer and/or colorectal carcinoma with the early detection cancer.In addition, the invention enables and to distinguish knurl (for example malignant tumour) and optimum (non-carcinous) cell proliferative disorders.For example, its feasible energy discriminating colorectal rectum cancer and minicell adenoma of colon or polyp.Knurl sexual cell proliferative disorders performance reduces in the gene of at least a Septin of being selected from 9 (comprising the transcript variant that they are all), FOXL2, SARM1, VTN, PRDM6, NR2E1, FAT and SEQ ID NOS:160 to SEQ ID NO:165 or genome sequence methylate (i.e. the expression of Jiang Diing) is opposite with the methylated described optimum illness that does not show reduction.

Particularly, the invention provides cancer diagnosis and classification and determination method, it is based on the measurement to the differential expression of one or more CpG dinucleotides of the gene that is selected from SEQ ID NOS:1 to SEQ ID NO:3, SEQ IDNO:24, SEQ ID NO:28, SEQ ID NOS:159 to SEQ ID NO:167 of at least a CpG of comprising dinucleotides.Usually, this mensuration comprises from individuality acquisition sample, measure to weigh at least a Septin of being selected from 9 (comprising the transcript variant that they are all), FOXL2, SARM1, VTN, PRDM6, NR2E1, the gene of FAT and SEQ ID NOS:160 to SEQ ID NO:165 or the expression of genome sequence, preferably by determining at least a SEQ ID NOS:1 to the SEQID NO:3 that is selected from derived from described sample, SEQ ID NO:24, SEQ ID NO:28, the methylation state with respect to control sample or known standard product of the sequence of SEQ ID NOS:159 to SEQ IDNO:167, and make diagnosis thus.

In particularly preferred embodiments, oligomer of the present invention is used to assess the methylation state of CpG dinucleotides, for example based on SEQ ID NOS:1 to SEQ ID NO:3, SEQ IDNO:24, SEQ ID NO:28, SEQ ID NOS:159 to SEQ ID NO:167, SEQ IDNOS:10 to SEQ ID NO:15, SEQ ID NOS:28 to SEQ ID NO:33, SEQ IDNOS:30 to SEQ ID NO:31, SEQ ID NOS:42 to SEQ ID NO:43, SEQ IDNOS:38 to SEQ ID NO:39, SEQ ID NOS:50 to SEQ ID NO:51, those or its array of SEQ IDNOS:168 to SEQ ID NO:203, and be arranged in based on they test kit and can be used for the diagnosis and/or the classification of cell proliferative disorders.

Test kit

In addition, another aspect of the present invention is a test kit, and it comprises: be used for determining at least a Septin of being selected from 9 (comprising the transcript variant that they are all), FOXL2, SARM1, VTN, PRDM6, NR2E1, FAT and the gene of SEQ ID NOS:160 to SEQ ID NO:165 or the methylated assembly of genome sequence.Describedly be used for determining that methylated assembly preferably includes the reagent that contains hydrosulphite; One or more oligonucleotide, its each sequence all are same as, are complementary to or hybridization is selected from the sequence of SEQ ID NOS:10 to SEQ ID NO:15, SEQ ID NOS:28 to SEQ ID NO:33, SEQ ID NOS:30 to SEQ ID NO:31, SEQ ID NOS:42 to SEQ ID NO:43, SEQ ID NOS:38 to SEQ ID NO:39, SEQ ID NOS:50 to SEQ ID NO:51, SEQ ID NOS:168 to SEQ ID NO:203 under tight or height stringent condition 9 or more preferably 18 fragments that base is long; And preferably, be used to carry out and assess the specification sheets of described methylation analysis method.In one embodiment, the base sequence of described oligonucleotide comprises at least one CpG, CpA or TpG dinucleotides.

In other embodiments, described test kit can also comprise the standard reagent that is used to carry out the special methylation analysis in CpG position, and wherein said analysis comprises one or more following technology: MS-SNuPE, MSP, MethyLight ^TM, HeavyMethyl, COBRA and nucleic acid sequencing.But, belong to the part that test kit of the present invention also can only contain aforementioned component.

In preferred embodiments, described test kit can comprise other hydrosulphite transformation reagent that is selected from following reagent: DNA sex change damping fluid; The sulfonation damping fluid; DNA reclaims reagent or test kit (for example, precipitation, ultrafiltration, affinity column); The desulfonation damping fluid; And DNA reclaims component.

In other embodiments, described test kit can contain the polysaccharase that is packaged in the container separately and be used for for example reaction buffer of the polymerase-mediated primer extension of PCR through optimization.In another embodiment of the present invention, described test kit also comprises the assembly that is used to obtain patient's biological sample.Preferably such test kit, it also comprises and is suitable for the container that splendid attire is used for determining the methylated assembly of the gene of at least a Septin of being selected from 9 of patient's biological sample (comprising the transcript variant that they are all), FOXL2, SARM1, VTN, PRDM6, NR2E1, FAT and SEQ ID NOS:160 to SEQID NO:165 or genome sequence, most preferably also comprises the specification sheets that uses and explain the test kit result.In preferred embodiments, described test kit comprises: (a) hydrosulphite reagent; (b) be suitable for the container of the described hydrosulphite reagent of splendid attire and patient's biological sample; (c) at least one cover comprises the primer tasteless nucleotide of two kinds of oligonucleotide, and the sequence of described each oligonucleotide all is same as, be complementary to or under tight or height stringent condition, hybridize and be selected from SEQ ID NOS:10 to SEQ ID NO:15, SEQ ID NOS:28 to SEQ ID NO:33, SEQ ID NOS:30 to SEQ ID NO:31, SEQ ID NOS:42 to SEQ ID NO:43, SEQ ID NOS:38 to SEQ ID NO:39, SEQ ID NOS:50 to SEQ ID NO:51,9 or more preferably long fragments of 18 bases of the sequence of SEQ ID NOS:168 to SEQ ID NO:203; And preferably, (d) be used to use and explain test kit result's specification sheets.In another embodiment preferred, described test kit comprises: (a) hydrosulphite reagent; (b) be suitable for the container of the described hydrosulphite reagent of splendid attire and patient's biological sample; (c) have at least a oligonucleotide and/or the PNA-oligomer of at least 9 or 16 length of nucleotides, it is same as or hybridizes one of pretreated nucleic acid sequence SEQ ID NOS:10 to SEQID NO:15, SEQ ID NOS:28 to SEQ ID NO:33, SEQ ID NOS:30 to SEQID NO:31, SEQ ID NOS:42 to SEQ ID NO:43, SEQ ID NOS:38 to SEQID NO:39, SEQ ID NOS:50 to SEQ ID NO:51, SEQ ID NOS:168 to SEQID NO:203 and complementary sequence thereof; And randomly, (d) about using and explain test kit result's specification sheets.

In another embodiment, described test kit comprises: (a) hydrosulphite reagent; (b) be suitable for the container of the described hydrosulphite reagent of splendid attire and patient's biological sample; (c) at least one cover contains the primer tasteless nucleotide of two kinds of oligonucleotide, its each sequence is same as, is complementary to or hybridization is selected from SEQ ID NOS:10 to SEQ ID NO:15, SEQ ID NOS:28 to SEQ ID NO:33, SEQ ID NOS:30 to SEQ IDNO:31, SEQ ID NOS:42 to SEQ ID NO:43, SEQ ID NOS:38 to SEQ IDNO:39, SEQ ID NOS:50 to SEQ ID NO:51, SEQ ID NOS:168 to SEQ IDNO:203 under tight or height stringent condition 9 or more preferably 18 fragments that base is long; (d) have at least a oligonucleotide and/or the PNA-oligomer of at least 9 or 16 length of nucleotides, it is same as or hybridizes one of pretreated nucleic acid sequence SEQ ID NOS:10 to SEQ ID NO:15, SEQ ID NOS:28 to SEQ ID NO:33, SEQ ID NOS:30 to SEQ ID NO:31, SEQ ID NOS:42 to SEQ ID NO:43, SEQ ID NOS:38 to SEQ ID NO:39, SEQ ID NOS:50 to SEQ ID NO:51, SEQ ID NOS:168 to SEQ ID NO:203 and complementary sequence thereof; And randomly (e) about using and explain test kit result's specification sheets.

Described test kit also can contain other the component that is packaged in the container separately, as is used to block, wash or wrap the damping fluid or the solution of quilt.

Be used for COBRA ^TMThe typical agents of analyzing (for example may be typically based on COBRA ^TMTest kit in find) can include, but are not limited to: be used at least a Septin of being selected from 9 (comprising the transcript variant that they are all), FOXL2, SARM1, VTN, PRDM6, NR2E1, FAT and the gene of SEQ ID NOS:160 to SEQ ID NO:165 or the PCR primer of genome sequence; Restriction enzyme and suitable damping fluid; The gene recombination oligomer; Contrast hybridization oligomer; The kinases labelling kit that is used for the oligomer probe; And the Nucleotide of mark.Be used for MethyLight ^TMThe typical agents of analyzing (for example may be typically based on MethyLight ^TMTest kit in find) can include, but are not limited to: the PCR primer that is used for the sequence that transforms through hydrosulphite of the gene of at least a Septin of being selected from 9 (comprising the transcript variant that they are all), FOXL2, SARM1, VTN, PRDM6, NR2E1, FAT and SEQ ID NOS:160 to SEQ ID NO:165 or genome sequence; The special probe of hydrosulphite (TaqMan for example ^TMOr Lightcycler ^TM); PCR damping fluid and the deoxynucleotide optimized; And Taq polysaccharase.

Be used for Ms-SNuPE ^TMThe typical agents of analyzing (for example may be typically based on Ms-SNuPE ^TMTest kit in find) can include, but are not limited to: the PCR primer that is used for the specific gene dna sequence dna or the CpG island of bisulf iotate-treated (or through); PCR damping fluid and the deoxynucleotide optimized; Gel extraction kit; The positive control primer; The Ms-SNuPE that is used for the sequence that transforms through hydrosulphite of the gene of at least a Septin of being selected from 9 (comprising the transcript variant that they are all), FOXL2, SARM1, VTN, PRDM6, NR2E1, FAT and SEQ ID NOS:160 to SEQ ID NO:165 or genome sequence ^TMPrimer; Reaction buffer (being used for the Ms-SNuPE reaction); And the Nucleotide of mark.

The typical agents (for example may find at typical test kit based on MSP) that is used for the MSP analysis can comprise, but be not limited to: be used to be selected from the sequence gene that transforms through hydrosulphite of Septin 9 (comprising the transcript variant that they are all), FOXL2, SARM1, VTN, PRDM6, NR2E1, FAT and SEQ IDNOS:160 to SEQ ID NO:165 or methylating and unmethylated PCR primer of genome sequence, PCR damping fluid and the deoxynucleotide optimized, and special probe.

In addition, others of the present invention are alternative test kit, it comprises and is used for determining at least a Septin of being selected from 9 (comprising the transcript variant that they are all), FOXL2, SARM1, VTN, PRDM6, NR2E1, FAT and the gene of SEQ ID NOS:160 to SEQ ID NO:165 or the methylated assembly of genome sequence that wherein said assembly preferably includes the restriction enzyme of at least a methylation specific; The primer tasteless nucleotide of the sequence of one or more at least one CpG dinucleotides of comprising the sequence that is selected from SEQ ID NO:1 to SEQ ID NO:3, SEQ ID NO:24, SEQ ID NO:28, SEQ ID NOS:159 to SEQ ID NO:167 of being suitable for increasing (preferred one or more primers to); And randomly, be used to carry out and assess the specification sheets of described methylation analysis method.In one embodiment, the length that the base sequence of described oligonucleotide is same as, is complementary to or hybridization is selected from the sequence of SEQ IDNOS:1 to SEQ ID NO:3, SEQ ID NO:24, SEQ ID NO:28, SEQ IDNOS:159 to SEQ ID NO:167 under tight or height stringent condition is the fragment of at least 18 bases.

In other embodiment, described test kit can comprise that one or more are used to analyze the oligonucleotide probe of described digestion fragment, and the length that preferred described oligonucleotide is same as, is complementary to or hybridization is selected from the sequence of SEQ ID NOS:1 to SEQ ID NO:3, SEQ ID NO:24, SEQ ID NO:28, SEQ ID NOS:159 to SEQ ID NO:167 under tight or height stringent condition is the fragment of at least 16 bases.

In preferred embodiments, described test kit can comprise other reagent, and this other reagent is selected from: damping fluid (for example restriction enzyme, PCR, storage or lavation buffer solution); DNA reclaims reagent or test kit (for example precipitation, ultrafiltration, affinity column) and DNA and reclaims component.

In other other embodiment, described test kit can contain polysaccharase and the reaction buffer that is packaged in the container separately, and described reaction buffer is optimized for described polymerase-mediated primer extension, for example PCR.In another embodiment of the present invention, described test kit also comprises the assembly that is used to obtain patient's biological sample.In preferred embodiments, described test kit comprises: responsive restriction enzyme reagent (a) methylates; (b) be suitable for the container of the described reagent of splendid attire and described patient's biological sample; (c) contain at least one cover oligonucleotide of one or more peptide nucleic acid(PNA)s, the length that it is same as, is complementary to or hybridization is selected from the sequence of SEQID NOS:1 to SEQ ID NO:3, SEQ ID NO:24, SEQ ID NO:28, SEQ IDNOS:159 to SEQ ID NO:167 under tight or height stringent condition is the fragment of at least 16 bases; And randomly (d) uses and explains test kit result's specification sheets.

In other embodiment preferred, described test kit comprises: responsive restriction enzyme reagent (a) methylates; (b) be used for the container of the described reagent of splendid attire and patient's biological sample; (c) at least one cover primer tasteless nucleotide of sequence of at least one CpG dinucleotides of comprising the sequence that is selected from SEQ ID NOs:1 to SEQ ID NO:3, SEQ IDNO:24, SEQ ID NO:28, SEQ ID NOS:159 to SEQ ID NO:167 that is suitable for increasing; And randomly, (d) use and explain test kit result's specification sheets.

In another embodiment, described test kit comprises: responsive restriction enzyme (a) methylates; (b) be suitable for the container of the described reagent of splendid attire and patient's biological sample; (c) at least one cover primer tasteless nucleotide of sequence of at least one CpG dinucleotides of comprising the sequence that is selected from SEQ ID NOs:1 to SEQ ID NO:3, SEQ ID NO:24, SEQ IDNO:28, SEQ ID NOS:159 to SEQ ID NO:167 that is suitable for increasing; (d) at least one cover comprises the oligonucleotide of one or more nucleic acid or peptide nucleic acid(PNA), test kit result's specification sheets is used and explained to the length of sequence that it is same as, is complementary to or hybridization is selected from SEQ ID NOs:1 to SEQ ID NO:3, SEQ ID NO:24, SEQ ID NO:28, SEQ ID NOS:159 to SEQ ID NO:167 under tight or height stringent condition for the fragment of at least 9 bases and randomly (e).

Described test kit also can contain other component that is packaged in the container separately, for example damping fluid or solution, and it is suitable for blocking-up, washing or bag quilt.

The invention still further relates to test kit and be used for providing purposes in the diagnosis whether the individuality cell proliferative disorders is existed, it is realized by the responsive restriction enzyme analysis that methylates.Described test kit comprises container and dna microarray component.Described dna microarray component is a surface, and appointed positions is fixed with multiple oligonucleotide thereon, and wherein said oligonucleotide comprises at least one CpG site that methylates.At least a described oligonucleotide is specific to gene or the genome sequence of at least a Septin of being selected from 9 (comprising the transcript variant that they are all), FOXL2, SARM1, VTN, PRDM6, NR2E1, FAT and SEQ ID NOS:160 to SEQ ID NO:165, and it is long but be no more than the sequence of 200 bp to comprise at least 15 base pairs of one of SEQ ID NOS:1 to SEQ ID NO:3, SEQ ID NO:24, SEQ ID NO:28, SEQ ID NOS:159 to SEQ ID NO:167.Preferably, described sequence is that at least 15 base pairs of one of SEQ ID NOS:1 to SEQ ID NO:3, SEQ ID NO:24, SEQ ID NO:28, SEQ ID NOS:159 to SEQ ID NO:167 are long but be no more than the sequence of 80bp.Further preferably, described sequence is that at least 20 base pairs of one of SEQ ID NOS:1 to SEQ ID NO:3, SEQ IDNO:24, SEQ ID NO:28, SEQ ID NOS:159 to SEQ ID NO:167 are long but be no more than the sequence of 30 bp.

Described test kit preferably also comprises the restriction enzyme component that comprises one or more responsive restriction enzymes that methylate.

In another embodiment, the feature of described test kit is that also it comprises the restriction enzyme of at least a methylation specific, and wherein said oligonucleotide comprises the restriction site of the restriction enzyme of described at least a methylation specific.

Described test kit can also comprise the following component of one or more DNA of being used for enrichments known in the prior art: protein ingredient, the methylated DNA of described albumen selective binding; Randomly be in the triplex that is fit in the solution and form nucleic acid component, one or more joints; Material that is used to connect or solution, for example ligase enzyme or damping fluid; Be used to carry out the material or the solution of column chromatography; Be used to carry out material or solution based on immunologic enrichment (for example immunoprecipitation); Be used to carry out for example material or the solution of the nucleic acid amplification of PCR; If if can use one or more dyestuffs that can in solution, use with coupling agent; Material that is used to hybridize or solution; And/or be used to carry out the material or the solution of cleaning step.

The present invention also provides the composition that can be used for detecting, distinguishing and distinguish the colon cell proliferative disorders.Described composition comprises the long nucleic acid of at least a 18 base pairs, it is for being disclosed in SEQ ID NOS:10 to SEQ ID NO:15, SEQ ID NOS:28 to SEQ ID NO:33, SEQ ID NOS:30 to SEQ ID NO:31, SEQ ID NOS.42 to SEQ ID NO:43, SEQ ID NOS:38 to SEQ ID NO:39, SEQ ID NOS:50 to SEQ ID NO:51, the fragment of the nucleotide sequence among SEQ ID NOS:168 to the SEQ ID NO:203, and one or more take from the magnesium chloride of following material: 1-5mM, 100-500 μ M dNTP, 0.5-5 the taq polysaccharase of unit, bovine serum albumin, oligomer is oligonucleotide or peptide Nucleotide (PNA) oligomer especially, each of described oligomer all comprises at least one length and is the base sequence of at least 9 Nucleotide, and it is complementary to or pretreated genomic dna SEQ ID NOS:10 to the SEQ ID NO:15 of hybridization under medium tight or stringent condition, SEQ ID NOS:28 to SEQ ID NO:33, SEQ ID NOS:30 to SEQ ID NO:31, SEQ ID NOS:42 to SEQ ID NO:43, SEQ ID NOS:38 to SEQ ID NO:39, SEQ ID NOS:50 to SEQ ID NO:51, one of SEQ ID NOS:168 to SEQ ID NO:203 and complementary sequence thereof.Preferably the composition of described material comprises such buffered soln: it is suitable for stablizing described nucleic acid and makes and can carry out in described solution based on the reaction of polysaccharase in the aqueous solution.The damping fluid that is fit to is known and commercially available in the prior art.

In further preferred embodiment of the present invention, described at least a nucleic acid is the long segment of at least 50,100,150,200,250 or 500 base pairs that is disclosed in the nucleotide sequence among SEQ ID NOS:10 to SEQ ID NO:15, SEQ ID NOS:28 to SEQ ID NO:33, SEQ ID NOS:30 to SEQ ID NO:31, SEQ ID NOS:42 to SEQ ID NO:43, SEQ ID NOS:38 to SEQ ID NO:39, SEQ ID NOS:50 to SEQ ID NO:51, SEQ ID NOS:168 to the SEQ ID NO:203.

The present invention is described particularly with reference to its some preferred embodiment, and following embodiment only is used to explain the present invention, is not intended to limit it in the scope of principle of the present invention and extensive interpretation and equivalent thereof.

Embodiment

Embodiment 1

In following embodiment, the sequence of below listing is measured by MSP and/or HeavyMethyl and is analyzed.This mensuration is designed to go up operation at LightCycler platform (Roche Diagnostics), but other normally used in the prior art this quasi-instrument also is fit to.

The MSP amplified production detects by the fluorescently-labeled detection probes of Taqman type, and the HeavyMethyl amplified production detects by the two probes of Lightcycler type.

Goal gene group zone:

SEQ ID NO：165

Type: HeavyMethyl

Primer:

SEQ ID NO：249

SEQ ID NO：250

Blocker:

SEQ ID NO：251

Probe:

SEQ ID NO：252

SEQ ID NO：253

The temperature cycle program:

Activation:95 ℃ 10 minutes

55 circulations:95 ℃ 10 seconds (20 ℃/s)

56 ℃ 30 seconds (20 ℃/s)

72 ℃ 10 seconds (20 ℃/s)

Fusion:

95 ℃ 10 seconds 20

35 ℃ of 20 detections in 20 seconds

95 ℃ 0 second 0,1

Goal gene group zone

SEQ ID NO：24

Type: HeavyMethyl

Primer:

SEQ ID NO：254

SEQ ID NO：255

Blocker:

SEQ ID NO：256

Probe:

SEQ ID NO:257 (fluorescently-labeled)

SEQ ID NO:258 (the Red640 mark)

The temperature cycle program:

95 ℃ of sex change

95 ℃ 10 minutes

55 circulations:

95 ℃ of sex change 10 seconds (20 ℃/s)

56 ℃ annealing 30 seconds (20 ℃/s)

72 ℃ extend 10 seconds (20 ℃/s)

Fusion:

95 ℃ 10 seconds 20

35 ℃ 20 seconds 20

95 ℃ 0 second 0,1

Goal gene group zone

SEQ ID NO：24

Type HeavyMethyl

Primer:

SEQ ID NO：264

SEQ ID NO：265

Blocker:

SEQ ID NO：266

Probe:

SEQ ID NO:267 (fluorescently-labeled)

SEQ ID NO:268 (the Red640 mark)

The temperature cycle program:

95 ℃ of sex change

95 ℃ 10 minutes

55 circulations:

95 ℃ of sex change 10 seconds (20 ℃/s)

56 ℃ annealing 30 seconds (20 ℃/s)

72 ℃ extend 10 seconds (20 ℃/s)

Fusion:

95 ℃ 10 seconds 20

35 ℃ 20 seconds 20

95 ℃ 0 second 0,1

Goal gene group zone:

SEQ ID NO：28

Type: MSP

Primer:

SEQ ID NO：274

SEQ ID NO：275

The Taqman probe:

SEQ ID NO：276

The temperature cycle program:

Activation:95 ℃ 10 minutes

55 circulations:95 ℃ 15 seconds (20 ℃/s)

62 ℃ 45 seconds (20 ℃/s)

Cooling:40 ℃ 5 seconds

Goal gene group zone:

SEQ ID NO：1

Type: MSP

Primer:

SEQ ID NO：277

SEQ ID NO：278

The Taqman probe:

SEQ ID NO：279

The temperature cycle program:

Activation:95 ℃ 10 minutes

55 circulations:95 ℃ 15 seconds (20 ℃/s)

62 ℃ 45 seconds (20 ℃/s)

Cooling:40 ℃ 5 seconds

Goal gene group zone:

SEQ ID NO：28

Type: MSP

Primer:

SEQ ID NO：280

SEQ ID NO：281

The Taqman probe:

SEQ ID NO：282

The temperature cycle situation:

Activation:95 ℃ 10 minutes

55 circulations:95 ℃ 15 seconds (20 ℃/s)

62 ℃ 45 seconds (20 ℃/s)

Goal gene group zone:

SEQ ID NO：1

Type: MSP

Primer:

SEQ ID NO：283

SEQ ID NO：284

The Taqman probe:

SEQ ID NO：285

The temperature cycle situation:

Activation:95 ℃ 10 minutes

55 circulations:95 ℃ 15 seconds (20 ℃/s)

62 ℃ 45 seconds (20 ℃/s)

Goal gene group zone:

SEQ ID NO：28

Type: HeavyMethyl

Primer:

SEQ ID NO：286

SEQ ID NO：287

Blocker:

SEQ ID NO：288

Probe:

SEQ ID NO：289

SEQ ID NO：290

The temperature cycle situation:

95 ℃ of activation

95 ℃ 10 minutes

50 circulations:

95 ℃ of sex change 10 seconds (20 ℃/s)

56 ℃ annealing 30 seconds (20 ℃/s)

72 ℃ extend 10 seconds (20 ℃/s)

Fusion

95 ℃ 10 seconds 20

40 ℃ 10 seconds 20

70 ℃ 0 second 0,1

Cooling

40 ℃ 5 seconds

Goal gene group zone

SEQ ID NO：1

Type: HeavyMethyl

Primer:

SEQ ID NO：291

SEQ ID NO：292

Blocker:

SEQ ID NO：293

Probe:

SEQ ID NO：294

SEQ ID NO：295

The temperature cycle situation:

95 ℃ of activation

95 ℃ 10 minutes

50 circulations:

95 ℃ of sex change 10 seconds (20 ℃/s)

56 ℃ annealing 30 seconds (20 ℃/s)

72 ℃ extend 10 seconds (20 ℃/s)

Fusion

95 ℃ 10 seconds 20

40 ℃ 10 seconds 20

70 ℃ 0 second 0,1

Cooling

40 ℃ 5 seconds

Goal gene group zone

SEQ ID NO：1

Type: HeavyMethyl

Primer:

SEQ ID NO：296

SEQ ID NO：297

Blocker:

SEQ ID NO：289

Probe:

SEQ ID NO：299

SEQ ID NO：300

The temperature cycle situation:

95 ℃ of activation

95 ℃ 10 minutes

50 circulations:

95 ℃ of sex change 10 seconds (20 ℃/s)

56 ℃ annealing 30 seconds (20 ℃/s)

72 ℃ extend 10 seconds (20 ℃/s)

Fusion

95 ℃ 10 seconds 20

40 ℃ 10 seconds 20

70 ℃ 0 second 0,1

Cooling

40 ℃ 5 seconds

Goal gene group zone

SEQ ID NO：166

Type: HeavyMethyl

Primer:

SEQ ID NO：259

SEQ ID NO：260

Blocker:

SEQ ID NO：261

Probe:

SEQ ID NO：262

SEQ ID NO：263

The temperature cycle situation:

Activation:95 ℃ 10 minutes

55 circulations: 95 ℃ 10 seconds

58 ℃ 30 seconds

72 ℃ 10 seconds

Melting curve:95 ℃ 10 seconds

35 ℃ 20 seconds

95 ℃ 0 second

Cooling:40 ℃ 5 seconds

Goal gene group zone:

SEQ ID NO：167

Type: HeavyMethyl

Primer:

SEQ ID NO：269

SEQ ID NO：270

Blocker:

SEQ ID NO：271

Probe:

SEQ ID NO：272

SEQ ID NO：273

The temperature cycle situation:

95 ℃ of sex change

95 ℃ 10 minutes

55 circulations:

95 ℃ of sex change 10 seconds

Annealed 30 seconds for 56 ℃

72 ℃ were extended 10 seconds

Fusion

95 ℃ 10 seconds

40 ℃ 10 seconds

Embodiment 2

Carry out following analysis, so that according to the preferred group (panel) of the analysis of dna methylation in the whole blood being selected to be suitable for colorectal carcinoma examination and/or diagnosis.

Adopt the performance of measuring platform (Lightcycler) and every kind of mark of The real time measure method (MSP and/or HeavyMethyl) analysis, as be suitable for use in reference or the clinical laboratory apparatus.In colorectum cancerous tissue and whole blood, test the performance of every kind of mark independently, so that the indication of the tolerance range of every kind of mark is provided.

Described group is selected from following mark:

SEQ ID NO：376

SEQ ID NO：378

SEQ ID NO：27

SEQ ID NO：26

SEQ ID NO：24

SEQ ID NO：1

SEQ ID NO：165

SEQ ID NO：25

SEQ ID NO：28

SEQ ID NO：378

SEQ ID NO：163

Every kind of mark is by the assay method of at least a methylation specific, and promptly MSP and/or HeavyMethyl analyze, and be as shown in table 2.

Carry out further mensuration (non-methylation specific), so that the total DNA in quantitative every kind of sample hereinafter referred to as C3 mensuration.Described C3 is determined as hydrosulphite DNA and measures, and it is independent of methylation state and detects total DNA.Used following primer and probe:

Primer: GGAGTGGAGGAAATTGAGAT SEQ ID NO:62

Primer: CCACACAACAAATACTCAAAAC SEQ ID NO:63

Probe: TGGGTGTTTGTAATTTTTGTTTTGTGTTAGGTT SEQ IDNO:64

Every kind is determined on colorectal carcinoma, normal adjacent tissue and/or the whole blood sample and reruns twice, as shown in table 3.

Adopt commercially available test kit to carry out DNA extraction, carry out hydrosulphite according to the method for describing among the Olek et al. (1996) that modification is arranged slightly and transform.

All mensuration (C3 and methylation specific) all adopts the Lightcycler platform to carry out.

Data interpretation

The calculating of DNA concentration

Cp (intersection point value) that the Lightcycler instrument software calculates and intensity curve are used to determine DNA concentration.Measure for methylation assay and C3, all calculate DNA concentration by the CP value reference standard curve that makes every hole.

Sample repeats

As a rule, every kind of mensuration all will obtain a plurality of measuring results to every kind of sample to every kind of sample operation twice.For every kind of sample, score value is calculated as follows:

1. calculate the right ratio v1/v2 of all samples

2. if the two all is lower than threshold value 0.1ng, then ratio be made as=, if one is=, and another is higher than threshold value, then ratio is made as 100

3. no longer further analyze above each working sample of 2.5 for ratio

4. have the multiple sample twice for out of true ground, get average, do not get any score value per-cent that methylates

Adopt no longer further considering less than the sample of 1ng DNA of C3 mensuration through measuring.For every kind of sample, the per-cent that methylates that is detected is calculated as the DNA concentration of employing methylation assay quantitative measurment with respect to DNA concentration in the sample of measuring quantitative measurment by C3.

On three different threshold levels (referring to table) and on all methylation level, (promptly detect methylated any sample and be regarded as the positive) and determine methylated detection.

The sensitivity of every kind of mensuration determines that from colorectal carcinoma sample positive rate its medium sensitivity is defined as methylating and is detected the sample % of (being true positives) by the positive.

The specificity of every kind of mensuration is determined from the negative recall rate of whole blood sample (being the true negative recall rate), is wherein deducted false positive from the total number of samples of being analyzed.

The result

The ratio that methylating of measuring is positioned at by institute's analytic sample of the various threshold values of independent mensuration is presented at table 4 (colorectum cancerous tissue), 5 (normal adjacent tissue) and 6 (whole bloods).

Figure 30 to 37 shows the relevant polymorphic type distribution plan (the lower-left side of figure) of the ratio (Y-axis) of colorectum cancerous tissue that bivariate distribution figure (upper left side of figure) and the methylation level of measuring be higher than certain threshold (X-axis) and whole blood (and under some situation normal adjacent tissue) sample.The right side of every figure is that sensitivity is schemed with respect to specific ROC.The ROC curve is the figure that is used for the relative false positive rate of True Positive Rate that the difference of diagnostic test may threshold value.Depend on the compromise (any increase of sensitivity will be attended by specific reduction) of selected threshold value between its display sensitivity and the specificity.ROC area under curve (AUC) is that (area is the bigger the better, and the best is 1, and the random test meeting has along cornerwise ROC curve, area 0.5 for measurement to the diagnostic test accuracy; Reference: J.P.Egan.Signal Detection Theory and ROC Analysis, Academic Press, New York, 1975).The AUC of each ROC figure and Wilcoxon p-value are presented in the table 12.

Stage

Further analysis to the colorectal carcinoma result is presented in the table 7 according to cancer staging.In described table, shown to all stages of CRC based on the methylate mark sensitivity of threshold value (＞10% and＞20%) of two differences.For most of marks, sensitivity all is consistent in all CRC stages, so these marks can be suitable for the detection in all stages of CRC in examination or monitoring test.Seeming has the sensitivity trend of rising in II phase cancer.Sensitivity is low more, and more specificity marker thing is tending towards identifying more early stage cancer (for example, SEQ ID NO:25 (measuring 3)) and can increases the sensitivity of examination and/or monitoring test, but also can be used for other application (biopsy, stool test etc.).

Group

Table has shown among the 8-11 in colorectal carcinoma and whole blood by measuring the methylate ratio of institute's analytic sample of being positioned at various threshold values of multiple measurement.Under every kind of situation, form has shown the sample ratio in the given threshold value, and adopts two kinds of marks compared to the only improvement of first kind of mark sample detection.

Embodiment 3

Carry out following analysis, to confirm that gene 9 (comprising its transcript variant Q9HC74) of Septin and group thereof are for being used for the mark that is fit to of colorectal carcinoma examination and/or diagnosis, it is based on the dna methylation analysis in whole blood, by the performance of checking mensuration in a large amount of sample sets.

The performance of mark is analyzed by adopting mensuration platform (Lightcycler) and The real time measure method (MSP and/or HeavyMethyl), as is suitable for use in reference or the clinical laboratory apparatus.In colorectum tissue (normal adjacent tissue), colorectum cancerous tissue and whole blood, test the performance of every kind of mark independently, so that the indication to the mark accuracy is provided.

Adopted following primer and probe:

Adopt the SEQ ID NO:1 (measuring 7) of the Lightcycler probe of table 2 to adopt following scheme to carry out:

Water adds to final volume 10 μ l

MgCl ₂ 3.5

Forward primer 0.3

Reverse primer 0.3

Blocker 4

Detection probes (fluorescence) 0.15

Detection probes (red) 0.15

1a+1b reagent FastStart mixture 1

DNA

The LightCycler program:

The activation: 95 ℃ 10 minutes

55 circulations: 95 ℃ 10 seconds (20 ℃/s)

56 ℃ 30 seconds (20 ℃/s) detect

72 ℃ 10 seconds (20 ℃/s)

Melting curve: 95 ℃ 10 seconds 20

40 ℃ 10 seconds 20

70 ℃ 0 second 0,1

The cooling: 40 ℃ 5 seconds

Adopt the SEQ ID NO:1 (measuring 7) of table 2 Taqman probe to adopt following scheme to carry out:

Scheme:

Water adds to final volume 10 μ l

MgCl ₂ 3.5

Primer 1 0.3

Primer 2 0.3

Blocker 4

TaqMan probe 0.15

1a+1b reagent (FastStart) 1

DNA 10μl

Cycling condition

The activation: 95 ℃ 10 minutes

50 circulations: 95 ℃ 10 seconds (20 ℃/s)

56 ℃ 30 seconds (20 ℃/s) detect

72 ℃ 10 seconds (20 ℃/s)

95 ℃ of melting curves 10 seconds 20

40 ℃ 10 seconds 20

70 ℃ 0 second 0,1

The cooling: 40 ℃ 5 seconds

Carrying out C3 measures with the total DNA in quantitative every kind of sample.This C3 measures as above embodiment 2 carries out.

Every kind is determined on colorectal carcinoma, normal adjacent tissue and/or the whole blood sample and repeats twice.Analyzed two groups of samples, sample sets 1 is presented in the table 13, and sample sets 2 is presented in the table 14.

Sample sets 1 adopts following mensuration to analyze, as describing in detail in the table 2:

SEQ ID NO:1 (measuring 2)

SEQ ID NO:26 (measuring 6)

SEQ ID NO:24 (measuring 5)

SEQ ID NO:25 (measuring 3)

Sample sets 2 adopts following mensuration to analyze, as describing in detail in the table 2:

SEQ ID NO:1 (measuring 7) LightCycler (LC) and Taqman (Taq) variant and following mensuration

SEQ ID NO:28 (measuring 2)

SEQ ID NO:24 (measuring 5b)

SEQ ID NO:29 (measuring 2b)

As describing in detail in the table 7.

Only analyze the sample that contains greater than 4ng DNA.In sample sets 1,27 blood samples and 91 colorectal carcinoma samples have been analyzed.In sample sets 2,26 blood samples have been analyzed, 22 non-colorectum samples that close on and 81 colorectal carcinoma samples.

All mensuration (C3 and methylation specific) all adopts the Lightcycler platform to carry out.

DNA extraction and bisulf iotate-treated

Magna Pure method (Roche) DNA isolation from all samples is passed through in explanation according to manufacturers.Transform the effluent that from purifying, obtains according to following bisulfite reaction then.The bisulfite solution (5.89mol/l) of effluent and 354 μ l and the dioxane that contains free-radical scavengers of 146 μ l ((the 6-hydroxyl-2,5,7 of 98.6mg, 8-tetramethyl-chromanane 2-carboxylic acid is in the 2.5ml dioxane)) are mixed.Under 99 ℃, made the reaction mixture sex change 3 minutes, under following temperature program(me), hatch then altogether 7h minute 50 ℃; A thermal peak (99.9 ℃) 3 minutes; 1.5h 50 ℃; A thermal peak (99 ℃) 3 minutes; 50 ℃ of 3h.Adopt Millipore Microcon subsequently ^TMPost is by the ultrafiltration purification reaction mixture.Basically the specification sheets according to manufacturers carries out purifying.For this reason, make reaction mixture mix, go up sample with the water of 300 μ l, then wash with the 1xTE damping fluid to ultra-filtration membrane, centrifugal 15 minutes.DNA still is retained on the film in this processing.Carry out desulfonation then.For this reason, add 0.2mol/lNaOH and hatching 10 minutes.Order is carried out the washing step of centrifugal (10 minutes) and 1xTE damping fluid then.After this, eluted dna.For this reason, film was mixed 10 minutes with the 1xTE damping fluid (50 ℃) of 75 μ l heating.Specification sheets according to manufacturers overturns film.It is centrifugal to carry out multiple subsequently, with this DNA is removed from film.The effluent of 10 μ l is used to the Lightcycler PCR in real time and measures.

Reaction soln and thermal cycle conditions

SEQ ID NQ:26 measures 6 (HeavvMethyl mensuration)

Reaction soln:

Water

MgCl ₂3.50mM (damping fluid, comprise 1mM! )

Primer mixture 0.30 μ M (every kind)

Blocker 4.00 μ M

Detection probes mixture 0.15 μ M (every kind)

1a+1b reagent FastStart mixture 1.00x

Thermal cycle conditions:

The activation: 95 ℃ 10 minutes

55 circulations: 95 ℃ 10 seconds (20 ℃/s)

56 ℃ 30 seconds (20 ℃/s) detect

72 ℃ 10 seconds (20 ℃/s)

Melting curve: 95 ℃ 10 seconds 20

40 ℃ 10 seconds 20

70 ℃ 0 second 0,1

The cooling: 40 ℃ 5 seconds

SEQ ID NO:25 measures 3 (HeavvMethvl mensuration)

Reaction soln:

Water

MgCl2 3.50mM (damping fluid, comprise 1mM! )

Primer mixture 0.30 μ M (every kind)

Blocker 4.00 μ M

Detection probes mixture 0.15 μ M (every kind)

1a+1b reagent FastStart mixture 1.00x

Thermal cycle conditions:

The activation: 95 ℃ 10 minutes

55 circulations: 95 ℃ 10 seconds (20 ℃/s)

56 ℃ 30 seconds (20 ℃/s) detect

72 ℃ 10 seconds (20 ℃/s)

Melting curve: 95 ℃ 10 seconds 20

40 ℃ 10 seconds 20

70 ℃ 0 second 0,1

The cooling: 40 ℃ 5 seconds

SEQ ID NO：24 Assay 5B(HeavvMethyl Assay)

Reaction soln:

Water

MgCl ₂3.00mM (damping fluid, comprise mM! )

Forward primer 0.30 μ M

Reverse primer 0.30 μ M

Blocker 4.00 μ M

Detection probes fluorescence 0.15 μ M

The red 0.15 μ M of detection probes

1a+1b reagent mixture 1.00x

Thermal cycle conditions:

95 ℃ of sex change

95 ℃ 10 minutes

55 circulations:

95 ℃ of sex change 10 seconds (20 ℃/s)

(20 ℃/s) detect of 58 ℃ of annealing 30 seconds

72 ℃ extend 10 seconds (20 ℃/s)

Fusion

95 ℃ 10 seconds 20

35 ℃ 20 seconds 20

95 ℃ 0 second 0,1

SEQ ID NO:24 measures 5 (HeavvMethyl mensuration)

Reaction soln:

Water

MgCl ₂3.00mM (damping fluid, comprise mM! )

Forward primer 0.30 μ M

Reverse primer 0.30 μ M

Blocker 4.00 μ M

LightCycler probe 0.15 μ M

LightCycler probe 0.15 μ M

1a+1b reagent mixture 1.00x

Thermal cycle conditions:

95 ℃ of sex change

95 ℃ 10 minutes

55 circulations:

95 ℃ of sex change 10 seconds (20 ℃/s)

(20 ℃/s) detect of 58 ℃ of annealing 30 seconds

72 ℃ extend 10 seconds (20 ℃/s)

Fusion

95 ℃ 10 seconds 20

35 ℃ 20 seconds 20

95 ℃ 0 second 0,1

SEQ ID NO:1 measures 2 (MSP mensuration)

Reaction soln:

Water (3315932)

MgCl ₂(2239272) 3.50MM(*)

Forward primer 0.60 μ M

Reverse primer 0.60 μ M

Detection probes 0.30 μ M

1a+1b reagent FastStart mixture 1.00x

Thermal cycle conditions:

The activation: 95 ℃ 10 minutes

50 circulations: 95 ℃ 15 seconds

62 ℃ 45 seconds

The cooling: 40 ℃ 5 seconds

SEQ ID NO:1 measures 7 (LiqhtCycler probe HeawMethyl mensuration)

Reaction soln:

Water

MgCl ₂3.50mM (damping fluid, comprise mM! )

Primer 1 0.30 μ M

Primer 2 0.30 μ M

Blocker 4 μ M

Detection probes (fluorescence) 0.15 μ M

Detection probes (red) 0.15 μ M

1a+1b reagent (FastStart) mixture 1.00x

Thermal cycle conditions:

The activation: 95 ℃ 10 minutes

50 circulations: 95 ℃ 10 seconds (20 ℃/s)

56 ℃ 30 seconds (20 ℃/s) detect

72 ℃ 10 seconds (20 ℃/s)

Melting curve: 95 ℃ 10 seconds 20

40 ℃ 10 seconds 20

70 ℃ 0 second 0,1

The cooling: 40 ℃ 5 seconds

SEQ ID NO:1 measures 7 (Taqman HeavyMethyl mensuration)

Reaction soln:

Water

MgCl ₂3.50mM (damping fluid, comprise mM! )

Primer 1 0.30 μ M

Primer 2 0.30 μ M

Blocker 4.00 μ M

Detection probes 10.15 μ M

Detection probes 20.15 μ M

1a+1b reagent mixture 1.00x

Thermal cycle conditions:

The activation: 95 ℃ 10 minutes

50 circulations: 95 ℃ 10 seconds (20 ℃/s)

56 ℃ 30 seconds (20 ℃/s) detect

72 ℃ 10 seconds (20 ℃/s)

Melting curve: 95 ℃ 10 seconds 20

40 ℃ 10 seconds 20

70 ℃ 0 second 0,1

The cooling: 40 ℃ 5 seconds

SEQ ID NO:28 measures 2 (HeavyMethy) and measures)

Reaction soln:

Water

MgCl ₂3.50mM (damping fluid, comprise mM! )

Primer 1 0.30 μ M

Primer 2 0.30 μ M

Blocker 4.00 μ M

Detection probes 1 0.15 μ M

Detection probes 2 0.15 μ M

1a+1b reagent mixture 1.00x

Thermal cycle conditions:

The activation: 95 ℃ 10 minutes

50 circulations: 95 ℃ 10 seconds (20 ℃/s)

56 ℃ 30 seconds (20 ℃/s) detect

72 ℃ 10 seconds (20 ℃/s)

Melting curve: 95 ℃ 10 seconds 20

40 ℃ 10 seconds 20

70 ℃ 0 second 0,1

The cooling: 40 ℃ 5 seconds

SEQ ID NO:29 measures 2B (HeavvMethyl mensuration)

Reaction soln:

Water

MgCl ₂3.00mM (damping fluid, comprise mM! )

Primer 1 0.30 μ M

Primer 2 0.30 μ M

Blocker 4.00 μ M

Detection probes (fluorescence) 0.15 μ M

Detection probes (red) 0.15 μ M

1a+1b reagent (FastStart) 1.00x

Thermal cycle conditions:

The activation: 95 ℃ 10 minutes

50 circulations: 95 ℃ 10 seconds (20 ℃/s)

58 ℃ 30 seconds (20 ℃/s) detect

72 ℃ 10 seconds (20 ℃/s)

Melting curve: 95 ℃ 10 seconds 20

40 ℃ 10 seconds 20

70 ℃ 0 second 0,1

SEQ ID NO:29 measures 2 (HeavvMethyl mensuration)

Reaction soln:

Water

MgCl ₂3.50mM (damping fluid, comprise mM! )

Primer 1 0.30 μ M

Primer 2 0.30 μ M

Blocker 4.00 μ M

Detection probes 1 0.15 μ M

Detection probes 2 0.15 μ M

1a+1b reagent mixture 1.00x

Thermal cycle conditions:

The activation: 95 ℃ 10 minutes

55 circulations: 95 ℃ 10 seconds (20 ℃/s)

56 ℃ 30 seconds (20 ℃/s) detect

72 ℃ 10 seconds (20 ℃/s)

Melting curve: 95 ℃ 10 seconds 20

40 ℃ 10 seconds 20

70 ℃ 0 second 0,1

The cooling: 40 ℃ 5 seconds

Data interpretation

The calculating of DNA concentration

The Cp (intersection point value) that the Lightcycler instrument software calculates is used to determine DNA concentration.Measure for methylation assay and C3, all calculate DNA concentration by the CP value reference standard curve that makes every hole

As a rule, every kind of mensuration all will obtain a plurality of measuring results to every kind of sample to every kind of sample operation twice.

Per-cent methylates

Adopt no longer further considering less than all samples of 4ng DNA of C3 mensuration through measuring.For every kind of sample, the per-cent that methylates that is detected is calculated as the DNA concentration of employing methylation assay quantitative measurment with respect to DNA concentration in the sample of measuring quantitative measurment by C3.

On a plurality of different threshold levels (referring to table) and on all methylation level, (promptly detect methylated any sample and all be regarded as the positive) and determine methylated detection.

The sensitivity of every kind of mensuration determines that from colorectal carcinoma sample positive rate its medium sensitivity is defined as methylating and is detected the sample % of (being true positives) by the positive.

The specificity of every kind of mensuration picks rate (being the true negative recall rate) from the whole blood sample feminine gender to be determined, wherein deducts false positive from the total number of samples of being analyzed.

The result

Each assay method is measured, and the methylate ratio or the quantity of the sample by analysis that is arranged in given threshold value is presented at table 15 (sample sets 1) and 16 (sample sets 2).Wherein at least twice multiple is once positive at given threshold value build-in test, and then this sample is considered to positive.Be measured as ratio with the methylated analyzed sample in the given threshold value or quantity this group data that collect by at least a mensuration that determine to use this group.When in two repetitions at least one was tested as positive in the given threshold value, then this sample was considered to positive.

Further test SEQ ID NO:1 measures 2 in 14 mammary cancer samples, 12 colorectal carcinoma samples and 10 whole blood samples (sample sets 3).Each assay method is measured, and the methylate ratio or the quantity of the sample by analysis that is arranged in given threshold value is presented at table 18.

Embodiment 4: other cancer

Carry out following analysis, to confirm that gene 9 (comprising its transcript variant Q9HC74) of Septin and group thereof are the mark that is fit to that is used for examination and/or diagnoses other cancer, it is based on the dna methylation analysis in whole blood, by the performance of checking mensuration in a large amount of sample sets.

The SEQ ID NO:1 HeavyMethyl of employing table 2 measures the performance of 7 analysis mark things, and reaction conditions is according to embodiment 2.

Table 20 has shown the sample size of testing in every class, and the methylate quantity of positive sample of twice replication.Fig. 3 has shown the methylation level of measuring in other cancer, can see that this gene is methylated in polytype cancer.But, have only liver cancer to methylate with the ratio that is equal to or higher than colorectal carcinoma.Fig. 4 has shown the methylation level of measuring in other non-cancer disease, have only pyelonephritis to be methylated with the ratio that is equal to or higher than colorectal carcinoma as can be seen.

Embodiment 5: the hydrosulphite order-checking

The order-checking of Septin 9 genes

By inference Septin 9 have 4 (referring to before about the discussion of Ensembl database) at least 6 different transcript variants (at 5 ' end, referring to Russell, Oncogene.2001 Sep13; 20 (41): 5930-9).For the mentioned variant of people such as Russell, amplicon is designed to cover the CpG island of four kinds of variants (α, β, γ and ε) or be rich in the CpG zone.Two overlapping 2 variants in CpG island are arranged, ε and γ.The β variant seems to be regulated by γ CPG island.

Analyzed the sample from 12 patients, Septin 9 methylated levels are analyzed by quantitative, as mentioned above by HeavyMethyl.Two samples have methylate (the sample C group) greater than 20%, and 4 samples have 10% to 20% and methylate (sample B group) and 6 samples have shown at the most 10% methylate (sample A group) before having.

In addition, the DNA from 3 whole blood samples of the individuality that does not have obvious disease also is used for α and β amplicon (sample N group).

DNA extraction and bisulf iotate-treated

Adopt QIAGEN Genomic-Tip 500/G or 100/G, according to the specification sheets DNA isolation of manufacturers.Transform purified genomic dna according to following bisulfite reaction subsequently.

2 μ l DNA among the 100 μ l and the bisulfite solution of 354 μ l (10.36g sodium bisulfite and 2.49g S-WAT in the 22ml nuclease free water) and contain free-radical scavengers (6-hydroxyl-2,5,7,8-tetramethyl-chromanane 2-carboxylic acid, 323mg in the 8.2ml diox) 146 μ l dioxs mix.This bisulfite reaction is as follows:

Time	Speed	Effect
				3 minutes		99.9 ℃ of water-baths
30 minutes	1000rpm	Thermomixer 60℃
			3 minutes		99.9 ℃ of water-baths
1.5 hour	1000rpm	Thermomixer 60℃
			3 minutes		99.9 ℃ of water-baths
3 hours	1000rpm	Thermomixer 60℃

Reaction mixture adopts Millipore Microcon subsequently ^TMPost passes through ultrafiltration purification.This purifying carries out according to the specification sheets of manufacturers.More specifically, with desulfonation and washing:

Time	Volume	Speed	Effect
					200μl		Sterilized water is to bisulfite reaction; Mix whirling motion and rotation
	400μl		The bisulfite salt mixture is to the Microcon post
				20 minutes		14,000g	Remove test tube with liquid stream; Replace with new test tube
	400μl		Make the bisulfite salt mixture remain to identical Microcon filter
				20 minutes		14,000g	Remove test tube with liquid stream; Replace with new test tube
	400μl		0.2M NaOH
				12 minutes		14,000g	Remove test tube with liquid stream; Replace with new test tube
	400μl		0.1M NaOH
				12 minutes		14,000g	Remove test tube with liquid stream; Replace with new test tube

	400μl		ddH 2O
				12 minutes		14,000g	Remove test tube with liquid stream; Replace with new test tube
	400μl		ddH 2O
				12 minutes		14,000g	Remove test tube with liquid stream; Replace with new test tube

Then, the hydrosulphite TE damping fluid with 50 μ l (is preheated to 50 ℃; 0.1mM EDTA among the 10mM Tris) add to film, and (1000rpm) hatched 10 minutes under stirring.With this post oppositely put into 1.7ml low hold back pipe and with 1000g rotation 7 minutes with eluted dna.Adopt the PCR in real time of control sequence (HB14) to measure definite DNA concentration.

Amplification

Amplicon and PCR primer are referring to table 21.The amplicon that has " rc " in its title is from the amplification of Bis2 chain, and other increases from the Bis1 chain.

The purpose fragment adopts the amplification in 25 μ l reaction of following condition.

The PCR reaction:

1 * volume (μ l) final concentration

10 * DyNAzyme EXT damping fluid w/MgCl ₂2.5 1X

2mM dNTPs 2.5 every kind 200 μ M

Rev/For combination of primers (10 μ M storing solution) 1.25 every kind 0.5 μ M

DyNAzyme EXT polysaccharase 1U/ μ l 0.5 is 0.5 unit altogether

Through the DNA of bisulf iotate-treated (@10ng/ μ l) 2.5-5 25-50ng altogether

DMSO 100％ 0-0.5 0-2％

Cycling condition:

94 ℃ of 3min; 94 ℃ of 20s; 54 ℃ of 30s; 72 ℃ of 45s (38-42 circulation); 72 ℃ of 10min

The purifying of PCR product

Adopt Montage ^TMDna gel extracts test kit, according to the specification sheets purified pcr product of manufacturers.In brief, the PCR reactant runs glue on the TAE (contain 0.1mM EDTA, rather than among the standard TAE 1.0mM EDTA) of 1% improvement sepharose.Cutting-out target DNA band also shreds.Blob of viscose as in the Montage gel extraction equipment, and was collected dna solution in 10 minutes with 5000g rotation.The DNA of purifying is further concentrated to 10 μ l.

The TA clone

Adopt Invitrogen TOPO ^_TA clones test kit, according to the explanation clone of manufacturers and the described PCR product that increases.In brief, 2 μ l purifying and spissated PCR product are used in the TOPO cloning reaction it is cloned into carrier pCR ^_2.1-TOPO.Transform and adopt chemically competent E.coli strain TOP10 to carry out.

Order-checking

The single clone of picking and in LB (50 μ g Anabacty/ml LB be used for select) cultivation.The overnight culture of 1 μ l is used to the bacterium colony PCR in 20 μ l volumes:

The PCR mixture

2.5 μ l 10 * DyNAzyme damping fluid

2.5μl 2mM dNTPs

1.25 μ l M13F primer (10 μ M)

1.25 μ l M13R primer (10 μ M)

0.25 μ l DyNAzyme polysaccharase

12.25μl ddH20

Cycling condition:

94 ℃ of 3min; 94 ℃ of 1min; 55 ℃ of 1min; 72 ℃ of 1min (36 circulation); 10min72 ℃

Adopt standard operation to carry out sub-purifying of colony PCR amplification and sequence reading.Used sequencing primer is the M13 reverse primer or produces one of amplicon special primer of initial PCR product.

The result

Fig. 5 to 29 provides the matrix that produces from the hydrosulphite sequencing data of the γ amplicon of analyzing by applicant's intellectual property software (further information is referring to WO 2004/000463).The every row representative of matrix is used for a sample multiple sequencing data, and every kind of sample used repeats to be divided in the piece.Every row of matrix is represented the single CpG site in the fragment.The CpG number of amplified production is presented at the left side of matrix.

The methylated amount of each CpG position measurement by from light grey (0% methylates), to ash (50% methylates), represent to grey black (100% methylates).Correctly do not checked order in some amplified productions, sample or CpG position, they are shown as white,

Fig. 5 to 29 provides the matrix of the hydrosulphite sequencing data of embodiment 5.Every row of this matrix are represented the repetition sequencing data of a sample, and all of each sample repeat to be in the piece.Every row of matrix is represented the single CpG site in the fragment.The CpG digital display of amplified production is shown in the left side of matrix.

The methylated amount of each CpG position measurement by from light grey (0% methylates), to ash (50% methylates), represent to grey black (100% methylates).Successfully do not checked order in some amplified productions, sample or CpG position, they are shown as white.

Fig. 5 to 12 provided before 4 quantitatively (to be analyzed by HeavyMethyl) to have in 10% to the 20% methylated sample, transforms the order-checking overview of amplified production according to the hydrosulphite of the genome sequence of table 21.

Figure 13 to 20 provided before 2 quantitatively (to be analyzed by HeavyMethyl) to have and has been higher than in the 20% methylated sample, transformed the order-checking overview of amplified production according to the hydrosulphite of the genome sequence of table 21.

Figure 21 to 22 provides in 3 healthy individual blood samples the order-checking overview that transforms amplified production according to the hydrosulphite of the genome sequence of table 21.

Figure 23 to 29 provided before 6 quantitatively (to be analyzed by HeavyMethyl) to have and has been lower than 10% and methylates in the sample of (but being higher than 0%), transformed the order-checking overview of amplified production according to the hydrosulphite of the genome sequence of table 21.

Embodiment 6

Other mensuration through the variant of bisulf iotate-treated that is suitable for analyzing the genome sequence of SEQ ID NO:159 to SEQ ID NO:163 is presented in the table 22.The bisulf iotate-treated of genomic dna can be by scheme well known in the prior art (people such as Olek A for example, A modifiedand improved method for bisulfite based cytosine methylation analysis (methods of the changes and improvements of analyzing based on the cytosine methylation of hydrosulphite), Nucleic Acids Res.24:5064-6,1996) carry out.The cycling condition that is fit to is known to those skilled in the art, and can draw from the melting temperature (Tm) of oligomer, and is as shown in Table 22.

Table 1: according to the genome sequence of sequence table

SEQ IDNO：	Ensembl database * position	Ensembl database * genome position	Relevant gene transcripts *	The sequence (justice is arranged) that methylated hydrosulphite transforms	The sequence (antisense) that methylated hydrosulphite transforms	The sequence (justice is arranged) that unmethylated hydrosulphite transforms	The sequence (antisense) that unmethylated hydrosulphite transforms
								1	AC068594.15.1.168501 150580 to 151086 (+) is to AC111170.11.1.158988 137268 to 1138151 (+)	1772789082 to 73008258 (+)	Septin 9&Q9HC74	10	11	28	29
2	AC068594.15.1.168501 150580 to 151255 (+)	1772789082 to 72789757 (+)	Septin 9	12	13	30	31
								3	AC111182.20.1.171898 127830 to 129168 (+)	1772881422 to 72882760 (+)	Q9HC74	14	15	32	33
24	AC092947.12.1.72207 58709 to 60723 (+)	3140138862 to 140140876 (+)	FOXL2	30	31	42	43
								25	AC015656.9.1.147775 12130 to 12961 (+)	1744929475 to 44930306 (-)	NGFR	32	33	44	45
26	AC092644.3.1.171099 148656 to 149604 (+)	2192884909 to 192885857 (+)	TMEFF2	34	35	46	47
								27	AL049874.3.1.193047183 to 2782	Karyomit(e) 1460045491	SIX6	36	37	48	49

	(+)	To 60048090 (+)
								28	AC002094.1.1.167101 27574 to 28353 (+)	Karyomit(e) 1723723867 to 23724646 (-)	SARM1&VTN	38	39	50	51
29	AC007375.6.1.180331:23232 to 24323 (+)	Karyomit(e) 1476676531 to 76677622 (+)	ZDHHC22	40	41	52	53
								159	AC107050.3.1.167699 73453 to 74793 (+)	4188021715 to 188023055 (+)	FAT	168	169	186	187
160		1853498722 to 53498782 (+)	ATP8B1/Q96N33	170	171	188	189
								161		2030533783 to 30537106 (+)	CT112	172	173	190	191
162		42384588 to 2389018 (+)	Q726J3/ZFYVE28	174	175	192	193
								163		1846060107 to 46063463 (+)	MBD1/CXXC1	176	177	194	195
164		2216223947 to 16226116 (+)	Inapplicable (n.a.)	178	179	196	197
								165			PROSTAGLANDIN	180	181	198	199

			The E2 acceptor
								166			PRDM6	182	183	200	201
167			NR2E1	184	185	202	203
								376			ONE CUT structural domain family member 2; ONC2	379	380	385	386
377			NM_003299	381	382	387	388
								378			NM_000484	383	384	390	391

^*The Ensembl database

Table 2

Genome SEQ IDNO:	Measure	Primer	Primer	Blocker	Probe	Probe
							SEQ IDNO:26 (measuring 2)	HM	Gtagtagtagtagggtagagag(SEQ ID NO：301)	Catccccctacaacctaaa(SEQ ID NO：302)	Caacctaaacaacacactcccacacactaaaacac(SEQ IDNO：303)	Cgcgggagagggcgtt(SEQID NO：304)	Tgttggcgatcggcgtttt(SEQID NO：306)
SEQ IDNO:376 (measuring 2)	MSP	GCGGTTTCGGAGTGGTT(SEQ IDNO：306)	CCTCCCGAACCTAAAACGA(SEQID NO：307)	Inapplicable	ACGCCCGACGAACGCCAA(SEQ IDNO：308)	Inapplicable
							SEQ IDNO:378 (measuring 21)	MSP	TTTATGTTTTTCGTTTTTCGTTCG(SEQ ID NO：309)	GAATCCTCACACCTCCAACCG(SEQ ID NO：310)	Inapplicable	CGCCCACTACACCGCAAACAAATC(SEQ ID NO：311)	Inapplicable
SEQ IDNO:378 (measuring 1)	MSP	TTACGTGTGAGGGGTTCG(SEQ IDNO：312)	ACGAAAATCCACCAATCGAAAC(SEQ ID NO：313)	Inapplicable	TCCAAATACGATAACCGATACCCGAAACG(SEQID NO：314)	Inapplicable
							SEQ IDNO:163 (measuring 1)	MSP	Ggtattaggtcggtatttttcgt(SEQ ID NO：315)	Ctattaaaaacacgcgacatcga(SEQ ID NO：316)	Inapplicable	Tcgttttcgcggttgttcgttgt(SEQ ID NO：317)	Ttcggaatcggaagttcgtt9tttg(SEQ ID NO：318)
SEQ IDNO:378 (measuring 1)	MSP	gcgatttcgacgtcggt(SEQ IDNO：319)	Ctacgttctccgcctcgtt(SEQID NO：320)	Inapplicable	Agggtcgtatttaggttgtcgtcgtta(SEQ ID NO：321)	Tagtcgcgaaaagaggttggagtaag(SEQ IDNO：322)

SEQ IDNO:27 (measuring 1)	MSP	Gggtttcgggcgggta(SEQ IDNO：323)	Atatcgcactcgctatcgcta(SEQ ID NO：324)	Inapplicable	gagggcgacggtacgttagaggt(SEQ ID NO：325)	ttgggcgtcgttattagttcggtc(SEQ ID NO：326)
							SEQ IDNO:27 (measuring 2)	MSP	gtcgggttggagggacgta(SEQID NO：327)	atatcgcactcgctatcgcta(SEQ ID NO：328)	Inapplicable	gagggcgacggtacgttagaggt(SEQ ID NO：329)	ttgggcgtcgttattagttcggtc(SEQ ID NO：330)
SEQ IDNO:28 (measuring 2)	HM	GttTttTttAttAGTTGGAAGAttT(SEQ IDNO：331)	aAaCTaCAaCAaaCCTTaTC(SEQ IDNO：332)	CCTTaTCCACACTaAAaCAaaCAaaCAaCACACAaaC(SEQ IDNO：333)	CGtttACGGttCGCGCG(SEQ ID NO：334)	CGttCGttTGtTTtAGCGCG(SEQ ID NO：335)
							SEQ IDNO:26 (measuring 2)	HM	gaggtgttagaggagtagtag(SEQ ID NO：336)	tccccctacaacctaaa(SEQID NO：337)	Acctaaacaacacactcccacacactaaaacaccaat(SEQ IDNO：338)	Cgagtcggcgcggga(SEQ IDNO：339)	agggcgttttgttggcgatc(SEQID NO：340)
SEQ IDNO:26 (measuring 6)	HM	aaaaaaaaaaaactcctctacatac(SEQ IDNO：341)	ggttattgtttgggttaataaatg(SEQ ID NO：342)	Acatacaccacaaataaattaccaaaaacatcaaccaa(SEQID NO：343)	ttttttttttcggacgtcgtt(SEQ IDNO：344)	tcggtcgatgttttcggtaa(SEQID NO：345)
							SEQ IDNO:25 (measuring 3)	HM	tgagagagagagggttgaaa(SEQ ID NO：346)	Tctaaataacaaaatacctccatt(SEQ ID NO：347)	Ccattaccaacacaacccaccaaccaa(SEQID NO：348)	CgaccCGccaacCGac(SEQ ID NO：349)	CGcCGaaaCGCGctc(SEQ ID NO：350)
SEQ IDNO:165 (measuring 1)	HM	Tggttattaattatgtttatttttatag(SEQ ID NO：351)	AccaaatatctaaatactacaaccSEQ ID NO：352)	Tacaaccacaaactaccaaaacccatattaaacaacacac(SEQID NO：353)	tatgcgtttaacgtgtttttttgcg(SEQ ID NO：354)	tggcgggttttacgttttttgtagt(SEQ ID NO：355)
							SEQ IDNO:1 (measuring 7)	HM	GtAGtAGttAGtttAGtAtttAttTT(SEQ IDNO：356)	CCCACCAaCCATCATaT(SEQ ID NO：357)	CATCATaTCAaACCCCACAaTCAACACACAaC(SEQ ID NO：358)	GaACCCCGCGaTCAACGCG(SEQ IDNO：35g)	Inapplicable
SEQ IDNO:1 (measuring 7)	HM	GtAGtAGttAGtttAGtAtttAttTT(SEQ IDNO：360)	CCCACCAaCCATCATaT(SEQ ID NO：361)	CATCATaTCAaACCCCACAaTCAACACACAaC(SEQ ID NO：362)	GTtCGAAATGATtttATttAGtTGC(SEQID NO：14844363	CGTTGAtCGCGGGGTtC(SEQ ID NO：364)
							SEQ IDNO:24 (measuring 5)	HM	ccaaaacctaaacttacaac(SEQ ID NO：365)	Ggaaatttgaggggtaa(SEQID NO：366)	Tacaacaccaccaacaaacccaaaaacacaa(SEQ ID NO：367)	GTtAATTGCGGGCGAtCGA(SEQ IDNO：368)	CGtCGttAGCGGGTGGG(SEQ ID NO：369)
SEQ IDNO:28 (measuring 1)	MSP	cggttgttgtaggcgtc(SEQ IDNO：370)	gcaaaacacacgaaaacg(SEQ ID NO：371)	Inapplicable	Cgcgtgtgtaggtcgcgcgt(SEQ ID NO：372)	Inapplicable
							SEQ IDNO:1 (measuring 2)	MSP	aaaatcctctccaacacgtc(SEQ ID NO：373)	cgcgattcgttgtttattag(SEQID NO：374)	Inapplicable	CGgatttCGCGgttaaCGCGtagtt(SEQ IDNO：375)	Inapplicable

Table 3: the sample of being analyzed according to embodiment 2

Measure	The gross sample number	Colorectal carcinoma	Normal adjacent tissue	Blood
					SEQ ID NO:165 (measuring 1)	33	26	0	7
SEQ ID NO:24 (measuring 5)	106	79	0	27
					SEQ ID NO:25 (measuring 3)	109	82	0	27
SEQ ID NO:26 (measuring 6)	113	86	0	27
					SEQ ID NO:1 (measuring 2)	115	87	0	28
MSP SEQ ID NO:376 (measuring 2)	127	91	16	20
					SEQ ID NO:378 (measuring 1)	118	78	16	24
SEQ ID NO:378 (measuring 21)	118	78	16	24
					SEQ ID NO:378 (measuring 1)	118	78	16	24
SEQ ID NO:163 (measuring 1)	118	78	16	24
					SEQ ID NO:26 (measuring 2) HM	132	92	16	24
MSP SEQ ID NO:27 (measuring 2)	128	89	15	24

Table 4: have the ratio that is positioned at the methylated colorectal carcinoma sample of different threshold values

Measure	above 0.01	above 0.1	above 0.3	above 0.5
					SEQ ID NO:165 (measuring 1)	0,269	0,077	0	0
SEQ ID NO:24 (measuring 5)	0,911	0,557	0,152	0,076
					SEQ ID NO:25 (measuring 3)	0,573	0,402	0,232	0,073
SEQ ID NO:26 (measuring 6)	0,919	0,756	0,43	0,186
					SEQ ID NO:1 (measuring 2)	0,885	0,816	0,506	0,218
MSP SEQ ID NO:376 (measuring 2)	0,11	0	0	0
					SEQ ID NO:378 (measuring 1)	0	0	0	0
SEQ ID NO:378 (measuring 21)	0	0	0	0
					SEQ ID NO:378 (measuring 1)	0	0	0	0
SEQ ID NO:163 (measuring 1)	0	0	0	0

SEQ ID NO:26 (measuring 2) HM	0,924	0,739	0,446	0,228
					MSP SEQ ID NO:27 (measuring 2)	0,843	0,551	0,169	0,056

Table 5: have the ratio that is positioned at the methylated normal adjacent tissue sample of different threshold values

Measure	Be higher than 0.001	Be higher than 0.01	Be higher than 0.1	Be higher than 0.3
					MSP SEQ ID NO:376 (measuring 2)	0,938	0,25	0	0
SEQ ID NO:378 (measuring 1)	0	0	0	0
					SEQ ID NO:378 (measuring 21)	0	0	0	0
SEQ ID NO:378 (measuring 1)	0,25	0	0	0
					SEQ ID NO:163 (measuring 1)	0	0	0	0
SEQ ID NO:26 (measuring 2) HM	0,938	0,938	0	0
					MSP SEQ ID NO:27 (measuring 2)	0,933	0,533	0,067	0

Table 6: have the ratio that is positioned at the methylated whole blood sample of different threshold values

Measure	Be higher than 0.0001	Be higher than 0.001	Be higher than 0.01	Be higher than 0.1
					SEQ ID NO:165 (measuring 1)	0,286	0,143	0,143	0,143
SEQ ID NO:24 (measuring 5)	0,074	0	0	0
					SEQ ID NO:25 (measuring 3)	0	0	0	0
SEQ ID NO:26 (measuring 6)	0,148	0,037	0	0
					SEQ ID NO:1 (measuring 2)	0,071	0	0	0
MSPSEQ ID NO:376 (measuring 2)	0,4	0,2	0	0
					SEQ ID NO:378 (measuring 1)	0	0	0	0
SEQ ID NO:378 (measuring 21)	0	0	0	0
					SEQ ID NO:378 (measuring 1)	0	0	0	0
SEQ ID NO:163 (measuring 1)	0	0	0	0
					SEQ ID NO:26 (measuring 2) HM	0,292	0,083	0	0
SEQ ID NO:27 (measuring 2 MSP)	0,083	0,042	0	0

Table 7: according to the methylate ratio of the colorectal carcinoma in the threshold value of the difference of disease stage

	The I phase		The II phase		The III phase		The IV phase
									Measure	＞10％	＞20％	＞10％	＞20％	＞10％	＞20％	＞10％	＞20％
SEQ ID NO:24 (measuring 5HM)	38.5	23.1	90	60	53.8	23.1	57.1	42.9
									SEQ ID NO:25 (measuring 3)	53.8	46.2	50	40	44.4	37	12.5	12.5
SEQ ID NO:26 (measuring 6)	64.3	64.3	90	70	86.2	62.1	66.7	66.7
									SEQ ID NO:1 (measuring 2 MSP)	71.4	64.3	100	80	79.3	58.6	88.9	88.9
SEQ ID NO:26 (measuring 2)	66.7	66.7	92.3	76.9	75	53.6	72.7	72.7
									SEQ ID NO:27 (measuring 2)	55.6	33.3	69.2	38.5	44.4	18.5	80	50

Table 8: detected 1% to 10% ratio of colorectal carcinoma sample that methylates threshold value that is positioned at

Group	Sample number	1% methylates	1% increase that methylates	5% methylates	5% increase that methylates	10% methylates	10% increase that methylates
								SEQ ID NO:24 (measuring 5)/SEQ ID NO:25 (measuring 3)	73	0,917808219	0,006415814	0,767123288	0,070920756	0,643835616	0,086873591
SEQ ID NO:24 (measuring 5)/SEQ ID NO:26 (measuring 6)	78	0,961538462	0,04293381	0,833333333	0,042635659	0,794871795	0,039057841
								SEQ ID NO:24 (measuring 5)/SEQ ID NO:1 (measuring 2)	78	0,987179487	0,075787082	0,884615385	0,045534925	0,884615385	0,068523431
SEQ ID NO:24 (measuring 5)/SEQ ID NO:26 (measuring 2HM)	72	0,986111111	0,062198068	0,847222222	0,042874396	0,805555556	0,066425121
								SEQ ID NO:24 (measuring 5)/MSP SEQID NO:27 (measuring 2)	69	0,956521739	0,045129334	0,855072464	0,15844325	0,710144928	0,153182902
SEQ ID NO:25 (measuring 3)/SEQ ID NO:26 (measuring 6)	80	0,9125	0,006104651	0,8	0,009302326	0,7625	0,006686047
								SEQ ID NO:25 (measuring 3)/SEQ ID NO:1 (measuring 2)	81	0,938271 605	0,053214134	0,901234568	0,062154108	0,888888889	0,072796935
SEQ ID NO：	74	0,945945946	0,022032902	0,837837838	0,033490012	0,797297297	0,058166863

25 (measuring 3)/SEQ ID NO:26 (measuring 2HM)
								SEQ ID NO:25 (measuring 3)/MSP SEQID NO:27 (measuring 2)	72	0,916666667	0,073970037	0,791666667	0,095037453	0,680555556	0,129993758
SEQ ID NO:26 (measuring 6)/SEQ ID NO:1 (measuring 2)	85	0,976470588	0,057865937	0,894117647	0,055037187	0,882352941	0,066260987
								SEQ ID NO:26 (measuring 6)/SEQ ID NO:26 (measuring 2HM)	78	0,974358974	0,050445931	0,871794872	0,067447046	0,833333333	0,07751938
SEQ ID NO:26 (measuring 6)/MSP SEQ IDNO:27.2)	75	1	0,081395349	0,893333333	0,102635659	0,853333333	0,09751938
								SEQ ID NO:1 (measuring 2)/SEQ ID NO:26 (measuring 2HM)	79	0,974683544	0,050770501	0,898734177	0,059653717	0,886075949	0,069983995
SEQ ID NO:1 (measuring 2)/MSPSEQ ID NO:27 (measuring 2)	76	0,960526316	0,075468845	0,921052632	0,081972172	0,881578947	0,065486993
								SEQ ID NO:26.2 HM)/MSPSEQ ID NO:27 (measuring 2)	87	0,954022989	0,030109945	0,850574713	0,046226887	0,793103448	0,053973013

Table 9 is detected to be positioned at 15% to 25% ratio of colorectal carcinoma sample that methylates threshold value

Group	Sample number		15% methylates	15% increase that methylates	20% methylates	20% increase that methylates	25% methylates	25% increase that methylates
									SEQ ID NO:24 (measuring 5)/SEQ ID NO:25 (measuring 3)	73	0,589041096	0,146003121	0,493150685	0,163882392	0,410958904	0,130471099
SEQ ID NO:24 (measuring 5)/SEQ ID NO:26 (measuring 6)	78	0.730769231	0,07960644	0,679487179	0,051580203	0,58974359	0,043231962
								SEQ ID NO:24 (measuring 5)/SEQ ID NO:1 (measuring 2)	78	0,820512821	0,061892131	0,717948718	0,039787798	0,602564103	0,027851459
SEQ ID NO:24 (measuring 5)/SEQ ID NO:26 (measuring 2HM)	72	0,75	0,065217391	0,666666667	0,036231884	0,583333333	0,050724638

SEQ ID NO:24 (measuring 5)/MSP SEQID NO:27 (measuring 2)	69	0,652173913	0,180263801	0,492753623	0,176297927	0,362318841	0,134470739
								SEQ ID NO:25 (measuring 3)/SEQ ID NO:26 (measuring 6)	80	0,6875	0,036337209	0,6625	0,034593023	0,575	0,028488372
SEQ ID NO:25 (measuring 3)/SEQ ID NO:1 (measuring 2)	81	0,839506173	0,080885483	0,740740741	0,062579821	0,62962963	0,054916986
								SEQ ID NO:25 (measuring 3)/SEQ ID NO:26 (measuring 2HM)	74	0.743243243	0,058460635	0,702702703	0,07226792	0,594594595	0,061985899
SEQ ID NO:25 (measuring 3)/MSP SEQID NO:27 (measuring 2)	72	0,611111111	0,139200999	0,5	0,170731707	0,402777778	0,122289973
								SEQ ID NO:26 (measuring 6)/SEQ ID NO:1 (measuring 2)	85	0,835294118	0,076673428	0,776470588	0,098309669	0,729411765	0,154699121
SEQ ID NO:26 (measuring 6)/SEQ ID NO:26 (measuring 2HM)	78	0,756410256	0,071627648	0,730769231	0,100334448	0,653846154	0,107334526
								SEQ ID NO:26 (measuring 6)/MSP SEQ IDNO:27.2)	75	0,72	0,068837209	0,693333333	0,065426357	0,586666667	0,040155039
SEQ ID NO:1 (measuring 2)/SEQ ID NO:26 (measuring 2HM)	79	0,835443038	0,076822348	0,797468354	0,119307435	0,696202532	0,121489888
								SEQ ID NO:1 (measuring 2)/MSPSEQ ID NO:27 (measuring 2)	76	0,815789474	0,057168784	0,684210526	0,006049607	0,605263158	0,030550514
SEQ ID NO:26.2 HM)/MSPSEQ ID NO:27 (measuring 2)	87	0,954022989	0,030109945	0,850574713	0,046226887	0.793103448	0,053973013

Table 10 is detected to be positioned at 30% to 50% ratio of colorectal carcinoma sample that methylates threshold value

Group	Sample number		30% methylates	30% increase that methylates	50% methylates
						SEQ ID NO:24 (measuring 5)/SEQID NO:25 (measuring 3)	73	0,315068493	0,083361176	0,123287671
SEQ ID NO:24 (measuring 5)/SEQID NO:26 (measuring 6)	78	0,474358974	0,044126416	0,217948718
					SEQ ID NO:24 (measuring 5)/SEQ	78	0,538461538	0,032714412	0,269230769

ID NO:1 (measuring 2)
					SEQ ID NO:24 (measuring 5)/SEQID NO:26 (measuring 2 HM)	72	0,486111111	0,040458937	0,263888889
SEQ ID NO:24 (measuring 5)/MSPSEQ ID NO:27 (measuring 2)	69	0,260869565	0,092330239	0,115942029
					SEQ ID NO:25 (measuring 3)/SEQID NO:26 (measuring 6)	80	0,475	0,044767442	0,2
SEQ ID NO:25 (measuring 3)/SEQID NO:1 (measuring 2)	81	0,580246914	0,074499787	0,259259259
					SEQ ID NO:25 (measuring 3)/SEQID NO:26 (measuring 2 HM)	74	0,5	0,054347826	0,243243243
SEQ ID NO:25 (measuring 3)/MSPSEQ ID NO:27 (measuring 2)	72	0,333333333	0,101626016	0,097222222
					SEQ ID NO:26 (measuring 6)/SEQID NO:1 (measuring 2)	85	0,635294118	0,129546991	0,305882353
SEQ ID NO:26 (measuring 6)/SEQID NO:26 (measuring 2 HM)	78	0,551282051	0,105629877	0,269230769
					SEQ ID NO:26 (measuring 6)/MSP SEQ ID NO:27.2)	75	0,48	0,049767442	0,186666667
SEQ ID NO:1 (measuring 2)/SEQID NO:26 (measuring 2 HM)	79	0,620253165	0,114506038	0,303797468
					SEQ ID NO:1 (measuring 2)/MSPSEQ ID NO:27 (measuring 2)	76	0,539473684	0,033726558	0,263157895
SEQ ID NO:26.2 HM)/MSPSEQ ID NO:27 (measuring 2)	87	0,471264368	0,025612194	0,252873563

Table 11 is positioned at 0.01% to the 0.1% whole blood sample ratio that methylates threshold value after testing

Group	Sample number	0.01% methylates	0.1% methylates
				SEQ ID NO:24 (measuring 5)/SEQ ID NO:25 (measuring 3)	26	0,076923077	0
SEQ ID NO:24 (measuring 5)/SEQ ID NO:26 (measuring 6)	26	0,192307692	0,038461538
				SEQ ID NO:24 (measuring 5)/SEQ ID NO:1 (measuring 2)	27	0,111111111	0
SEQ ID NO:24 (measuring 5)/SEQ ID NO:26 (measuring 2HM)	21	0,285714286	0,095238095
				SEQ ID NO:24 (measuring 5)/MSP SEQ IDNO:27 (measuring 2)	21	0,095238095	0,047619048
SEQ ID NO:25 (measuring 3)/SEQ ID NO:26 (measuring 6)	26	0,153846154	0,038461538
				SEQ ID NO:25 (measuring 3)/SEQ ID NO:1 (measuring 2)	27	0,074074074	0
SEQ ID NO:25 (measuring 3)/SEQ ID NO:26 (measuring 2HM)	21	0,285714286	0,095238095
				SEQ ID NO:25 (measuring 3)/MSP SEQ IDNO:27 (measuring 2)	21	0,095238095	0,047619048
SEQ ID NO:26 (measuring 6)/SEQ ID NO:1 (measuring 2)	27	0,185185185	0,037037037
				SEQ ID NO:26 (measuring 6)/SEQ ID NO:26 (measuring 2HM)	21	0,333333333	0,095238095
SEQ ID NO:26 (measuring 6)/MSP SEQ IDNO:27 (measuring 2)	21	0,142857143	0,047619048
				SEQ ID NO:1 (measuring 2)/SEQ ID NO:26 (measuring 2HM)	22	0,272727273	0,090909091
SEQ ID NO:1 (measuring 2)/MSP SEQ ID NO:27 (measuring 2)	22	0,136363636	0,045454545

SEQ ID NO:26 (measuring 2HM)/MSP SEQ IDNO:27 (measuring 2)

24

0,291666667

0,083333333

Table 12: as the blood of explanation among Figure 30-37 and the difference * between the colorectal carcinoma sample

Figure	Measure	The AUC of ROC	Susceptibility/specificity	The WilcoxonP-value
					30	SEQ ID NO:165 (measuring 1)	0.76(0.58，0.89)	0.62/0.86	0.371
31	SEQ ID NO:24 (measuring 5)	0.98(0.93，1)	0.96/0.93	0
					32	SEQ ID NO:25 (measuring 3)	0.89(0.82，0.94)	0.78/1	0
33	SEQ ID NO:26 (measuring 6)	0.99(0.95，1)	0.99/0.85	0
					34	SEQ ID NO:1 (measuring 2)	0.99(0.95/1)	0.98/0.93	0
35	SEQ ID NO:376 (measuring 2 MSP)	0.57(0.48，0.65)	0.14/0.86	0.2399
					36	SEQ ID NO:26 (measuring 2HM)	0.94(0.87，0.97)	0.86/0.88	0
37	SEQ ID NO:27 (measuring 2 MSP)	0.89(0.82，0.94)	0.81/0.87	0

* fiducial interval is presented in the bracket

The sample sets 1 of table 13: embodiment 3

Sample type	Sex	Age	Phase	T	N	M	The position
								CRC	F
	39	III	4	1	0	Sigmoid colon
							CRC	F
	65	III	3	2	0	Ileocecum
							CRC	M
	58	IV				Rectum
							CRC	M	63	III	3	1	0	Rectum
CRC	M	71	II												The ascending colon
							CRC	F	69	I	2	0	0	Caecum
CRC	F
			54	III	3	2	0	Caecum
CRC	M
			44	IV
CRC	F								75	IV				Transverse colon
		CRC	F	60	II										Rectum
CRC	M								76	I				Descending colon
		CRC	M
	69			IV				Sigmoid colon
		CRC	M						73	I	1	0	0	Rectum

CRC	M		II		3	0	0	The ascending colon
									CRC	M
	62	III	3	1
							CRC	F	49	IV				The ascending colon
CRC	F
			58	III	3	1	X	The ascending colon
CRC	M
			42	IV	3	0	1
CRC	M								64	I	2	0	0	Sigmoid colon
		CRC	F
	64			III				Rectum
		CRC	F
	70			III	3	1	0	Whole last ileum
		CRC	M
	67
		CRC	M							80	III	3	1	0	Proctosigmoid
CRC	F
			72	IV				Sigmoid colon
CRC	M									III				Rectum
		CRC	M	56	I	2	0	0							Sigmoid colon
CRC	M
			72	III	2	1	0	Rectum
CRC	M								45	IV	4	2	1	Caecum
		CRC	F		II		3	0							0
CRC	M								74	III	3	1	0	Proctosigmoid
		CRC	F	75	III	4	2	0							The caecum wall
CRC	M									III		3	1	0
		CRC	M		I	2	0	0							The ascending colon
CRC	F								74	I	2	0	0	Caecum
		CRC	M	62	I	2	0	0							Proctosigmoid
CRC	F								60	II	3	0	0	Rectum
		CRC	F
	80			II				The ascending colon
		CRC	F
	70			III	4	2	0	Rectum
		CRC	M							III		3	1	0
CRC	F			75	III	3	1	0								The ascending colon
		CRC	F						49	IV	4	X	1	Rectum
CRC	F			47	I										Anus
		CRC	M
	81			IV			1
		CRC	F						89	III	3	1	0	Rectum
CRC	M			85	III	3	1	0							Caecum

CRC	M		52	III	2	1	0
									CRC	M	75	II				Sigmoid colon
CRC	M
								CRC	F	71
CRC	M		III				Rectum
								CRC	M
	61		3	X	0	Descending colon
							CRC	F	56	Unknown				Sigmoid colon
CRC	F
			68	IV	3	2	1	Sigmoid colon
CRC	F
			65	III	3	2	0	Ileocecum
CRC	M
			88	II	3	0	0	Tune
CRC	F
			72	III				Caecum
CRC	M
			61	IV	3	2	1	Rectum
CRC	M									III		3	2
		CRC	M		52	II	3	0								0	Transverse colon
CRC	M								66	IV	2	0	1	Rectum
		CRC	M
	64			III				The ascending colon
		CRC	F
	65			II	3	0	0
		CRC	M							61	IV	3	2	1	Sigmoid colon
CRC	M
			64	III	3	1	0	The ascending colon
CRC	M
			76	0	0			Sigmoid colon
CRC	M								64	I	2	0	0	The ascending colon
		CRC	M	56	I	2	0	0							Transverse colon
CRC	F
			67	II	3	0	0	Sigmoid colon
CRC	M									II		3	0	0	The ascending colon
		CRC	M	66	III	4	1	0
CRC	M									II		3	0	0
		CRC	F		III
CRC	F								65	I	2	0	X	Rectum
		CRC	M		II		3	0							0
CRC	M								40	I				FAP
		CRC	M	77	I	2	0	0							Proctosigmoid
CRC	M
			65	III	4	2	0	Descending colon
CRC	M
			68	IV				Sigmoid colon

CRC	M		67	II				Rectum
									CRC	M		unk				Rectum
CRC	F	63		3	X	0
								CRC	M		68	unk				Descending colon
CRC	F
			53	III	3	1	0	The ascending colon
CRC	M									II		3	0	0
		CRC	M	68	I	2	0	0								Rectum
CRC	M
			84	III				Rectum
CRC	F								53	I	1	0	0	Descending colon
		CRC	M
	72			III	4	1	0
		CRC	F						69	I	1	0	0	Sigmoid colon
CRC	M				II		3	0							0	Descending colon
		CRC	M							II		3	0	0			Caecum
Normal blood	F				62	n.a.	n.a.	n.a.							n.a.	n.a.
		Normal blood	M							62	n.a.	n.a.	n.a.	n.a.			n.a.
Normal blood	F				44	n.a.	n.a.	n.a.							n.a.	n.a.
		Normal blood	F							57	n.a.	n.a.	n.a.	n.a.			n.a.
Normal blood	F				51	n.a.	n.a.	n.a.							n.a.	n.a.
		Normal blood	M						66	n.a.	n.a.	n.a.	n.a.	n.a.
Normal blood	M				65	n.a.	n.a.	n.a.							n.a.	n.a.
		Normal blood	M							55	n.a.	n.a.	n.a.	n.a.			n.a.
Normal blood	F				70	n.a.	n.a.	n.a.							n.a.	n.a.
		Normal blood	M							40	n.a.	n.a.	n.a.	n.a.			n.a.

Normal blood	F		42	n.a.	n.a.	n.a.	n.a.	n.a.
									Normal blood	F		68	n.a.	n.a.	n.a.	n.a.	n.a.
Normal blood	F		67	n.a.	n.a.	n.a.	n.a.	n.a.
									Normal blood	F		53	n.a.	n.a.	n.a.	n.a.	n.a.
Normal blood	F		n.a.	n.a.	n.a.	n.a.	n.a.
								Normal blood	F		50	n.a.	n.a.	n.a.	n.a.	n.a.
Normal blood	M		50	n.a.	n.a.	n.a.	n.a.										n.a.
								Normal blood	M		51	n.a.	n.a.	n.a.	n.a.	n.a.
Normal blood	M	56	n.a.	n.a.	n.a.	n.a.	n.a.
								Normal blood	M		58	n.a.	n.a.	n.a.	n.a.	n.a.
Normal blood	M		67	n.a.	n.a.	n.a.	n.a.										n.a.
								Normal blood	M		55	n.a.	n.a.	n.a.	n.a.	n.a.
Normal blood	M		62	n.a.	n.a.	n.a.	n.a.										n.a.
								Normal blood	M	66	n.a.	n.a.	n.a.	n.a.	n.a.
Normal blood	F	56	n.a.	n.a.	n.a.	n.a.	n.a.
								Normal blood	M	56	n.a.	n.a.	n.a.	n.a.	n.a.
Normal blood	F		69	n.a.	n.a.	n.a.	n.a.									n.a.

The sample sets 2 of table 14: embodiment 3

Sample type	Sex	Age	Phase	T	N	M	The position
								CRC	F	49	IV				The ascending colon
CRC	F
			72	IV				Sigmoid colon
CRC	M
			69	IV				Sigmoid colon
CRC	F
			58	III	3	1	X	The ascending colon
CRC	F								60	II				Rectum
		CRC	F	74	I	2	0	0							Caecum
CRC	F
			70	III	3	1	0	Whole last ileum
CRC	F								69	I	2	0	0	Caecum
		CRC	F
	39			III	4	1	0	Sigmoid colon
		CRC	M						56	I	2	0	0	Sigmoid colon
CRC	F				II		3	0							0
		CRC	M						64	I	2	0	0	Sigmoid colon
CRC	M			45	IV	4	2	1							Caecum
		CRC	F
	54			III	3	2	0	Caecum
		CRC	M
	42			IV	3	0	1
		CRC	M						73	I	1	0	0	Rectum
CRC	M
			62	III	3	1
CRC	M									I	2	0	0	The ascending colon
		CRC	F	75	III	3	1	0							The ascending colon
CRC	M								74	III	3	1	0	Proctosigmoid
		CRC	F
	68			IV	3	2	1	Sigmoid colon
		CRC	F						75	IV				Transverse colon
CRC	M			85	III	3	1	0							Caecum
		CRC	M
	80			III	3	1	0	Proctosigmoid
		CRC	M						66	III	4	1	0
CRC	F				70	III	4	2							0	Rectum
		CRC	F						89	III	3	1	0	Rectum

CRC	M		67
									CRC	F		67	II	3	0	0	Sigmoid colon
CRC	M	66	IV	2	0	1	Rectum
								CRC	F	56	unk				Sigmoid colon
CRC	M
			72	III	2	1	0	Rectum
CRC	F
			80	II				The ascending colon
CRC	M								75	II				Sigmoid colon
		CRC	F	49	IV	4	X	1							Rectum
CRC	M									III				Rectum
		CRC	F	60	II	3	0	0							Rectum
CRC	M								62	I	2	0	0	Proctosigmoid
		CRC	M
	88			II	3	0	0	Tune
		CRC	M
	61			IV	3	2	1	Sigmoid colon
		CRC	M
	61				3	X	0	Descending colon
		CRC	F
	64			III				Rectum
		CRC	M							III				Rectum
CRC	M
			52	II	3	0	0	Transverse colon
CRC	F								71
		CRC	M		81	IV									1
CRC	F									65	III	3	2	0			Ileocecum
		CRC	M
CRC	F
			65	II	3	0	0
CRC	F									72	III				Caecum
		CRC	M
	61			IV	3	2	1	Rectum
		CRC	M
	52			III	2	1	0
		CRC	M							II		3	0	0
CRC	F			47	I											Anus
		CRC	M							II		3	0	0	The ascending colon
CRC	M
			64	III	3	1	0	The ascending colon
CRC	M								64	I	2	0	0	The ascending colon
		CRC	M
	76			0	0			Sigmoid colon
		CRC	M						56	I	2	0	0	Transverse colon
CRC	M
			65	III	4	2	0	Descending colon

CRC	M	40	I				FAP
								CRC	F	53	I	1	0	0	Descending colon
CRC	M		II		3	0	0
								CRC	M		III		3	2
CRC	M		Unknown				Rectum
								CRC	M	68	I	2	0	0	Rectum
CRC	F	63		3	X	0
								CRC	F		III
CRC	M
			67	II				Rectum
CRC	F								65	I	2	0	X	Rectum
		CRC	M
	64			III				The ascending colon
		CRC	M
	68			IV				Sigmoid colon
		CRC	M							II		3	0	0
CRC	M				72	III	4	1								0
		CRC	M						77	I	2	0	0	Proctosigmoid
CRC	F
			53	III	3	1	0	The ascending colon
CRC	F								69	I	1	0	0	Sigmoid colon
		CRC	M
	84			III				Rectum
		CRC	M							II		3	0	0	Descending colon
CRC	M
			68	Unknown				Descending colon
CRC	M									II		3	0	0	Caecum
		Normal blood	M		55	n.a.	n.a.	n.a.								n.a.	n.a.
Normal blood	M									62	n.a.	n.a.	n.a.	n.a.	n.a.
		Normal blood	F		57	n.a.	n.a.	n.a.								n.a.	n.a.
Normal blood	F									62	n.a.	n.a.	n.a.	n.a.	n.a.
		Normal blood	M		65	n.a.	n.a.	n.a.								n.a.	n.a.
Normal blood	F									n.a.	n.a.	n.a.	n.a.	n.a.

Normal blood	F		44	n.a.	n.a.	n.a.	n.a.	n.a.
									Normal blood	F		68	n.a.	n.a.	n.a.	n.a.	n.a.
Normal blood	F		70	n.a.	n.a.	n.a.	n.a.	n.a.
									Normal blood	M		58	n.a.	n.a.	n.a.	n.a.	n.a.
Normal blood	M		62	n.a.	n.a.	n.a.	n.a.	n.a.
									Normal blood	F		53	n.a.	n.a.	n.a.	n.a.	n.a.
Normal blood	F		42	n.a.	n.a.	n.a.	n.a.	n.a.
									Normal blood	F		51	n.a.	n.a.	n.a.	n.a.	n.a.
Normal blood	M	66	n.a.	n.a.	n.a.	n.a.	n.a.
								Normal blood	M		51	n.a.	n.a.	n.a.	n.a.	n.a.
Normal blood	M		40	n.a.	n.a.	n.a.	n.a.										n.a.
								Normal blood	M	56	n.a.	n.a.	n.a.	n.a.	n.a.
Normal blood	F	56	n.a.	n.a.	n.a.	n.a.	n.a.
								Normal blood	F		50	n.a.	n.a.	n.a.	n.a.	n.a.
Normal blood	M		50	n.a.	n.a.	n.a.	n.a.										n.a.
								Normal blood	F		67	n.a.	n.a.	n.a.	n.a.	n.a.
Normal blood	M		67	n.a.	n.a.	n.a.	n.a.										n.a.

Normal blood	M		55	n.a.	n.a.	n.a.	n.a.	n.a.
									Normal blood	M	66	n.a.	n.a.	n.a.	n.a.	n.a.
Normal blood	M	56	n.a.	n.a.	n.a.	n.a.	n.a.

Table 15: have the methylated sample ratio of different threshold values that is positioned at from embodiment 3 sample sets 1

Measure	CRC	CRC	CRC	Blood	Blood	Blood
								＞10％ **	＞20％ **	＞30％ **	2 of 2+ *	1 of 2+ **	＞1％
SEQ ID NO:1 (measuring 2)	75	62	46	1	1	0
							％	82,41758	68,13187	50,54945	3,703704	3,703704	0
SEQ ID NO:6 (measuring 6)/SEQID NO:1.2	79	69	59	2	11	5
							％	86,81319	75,82418	64,83516	7,407407	40,74074	18,51852
SEQ ID NO:1 (measuring 2)/SEQID NO:4 (measuring 5)/SEQ IDNO:15174 (measuring 3)	78	62	45	1	1	0
							％	85,71429	68,13187	49,45055	3.703704	3,703704	0
SEQ ID NO:1 (measuring 2)/SEQID NO:5 (measuring 3)	77	66	51	1	1	0
							％	84,61538	72,52747	56,04396	3,703704	3,703704	0
SEQ ID NO:6 (measuring 6)/SEQID NO:1 (measuring 2)/SEQ IDNO:4 (measuring 5)	79	69	58	2	11	5
							％	86,81319	75,82418	63,73626	7,407407	40,74074	18,51852
SEQ ID NO:1 (measuring 2)/SEQID NO:4 (measuring 5)/SEQ IDNO:15174 (measuring 3)	78	66	51	1	1	0
							％	85,71429	72,52747	56,04396	3,703704	3,703704	0
SEQ ID NO:1 (measuring 2)/SEQ	79	69	59	2	11	0

ID NO:6 (measuring 6)/SEQ IDNO:15174 (measuring 3)
							％	86,81319	75,82418	64,83516	7,407407	40,74074	0

* twice repeated test positive

One of twice repeated test of * is positive or be positioned at threshold value through measurement

Table 16 has the methylated sample ratio from embodiment 3 sample sets 2 of different threshold values that is positioned at

	CRC	CRC	CRC	Blood	Blood	NAT	NAT	NAT
										＞10％ *	＞20％ *	＞30％ *	Positive *	＞1％ *	＜5％ *	5-10％ *	＞10％ *
SEQ ID NO:1 (measuring 7) LC	66	54	37	2	1	15	6	1
									％	81,48148	66,66667	45,67901	7,692308	3,846154	68,18182	27,27273	4,545455
SEQ ID NO:1 (measuring 7)-LC/SEQ ID NO:28 (measuring 2)	69	57	42	3	2
									％	85,18519	70,37037	51,85185	11,53846	7,692308
SEQ ID NO:1 (measuring 7)-LC/SEQ ID NO:24 (measuring 5b)	68	55	39	2	1
									％	83,95062	67,90123	48,14815	7,692308	3,846154
SEQ ID NO:1 (measuring 7)-Taqman	68	58	46	6	5
									％	83,95062	71,60494	56,79012	23,07692	19,23077

* one of twice repeated test is positive or be positioned at threshold value through measurement

Table 17 is according to the mensuration of embodiment 3

Genome SEQID NO:	Measure	Primer	Primer	Blocker	Probe	Probe
							SEQ IDNO:24 (measuring 5)	HM	ccaaaaccta aacttacaac (SEQ ID NO：102)	tctaaataac aaaatacctc catt(SEQ ID NO：	Tacaacacc accaacaaa cccaaaaac acaa(SEQ	GTtAATTG CGGGCG AtCGA(SE Q ID NO：	CGtCGttA GCGGGT GGG(SEQ ID NO：

			110)	ID NO： 104)	105)	106)
							SEQ IDNO:28 (measuring 2)	HM	GttTttTttAttAGTTGGAAGAttT(SEQ IDNO：111)	aAaCTaCAaCAaaCCTTaTC(SEQ IDNO：112)	CCTTaTCCACACTaAAaCAaaCAaaCAaCACACAaaC(SEQID NO：113)	CGtttACGGttCGCGCG(SEQ IDNO：114)	CGttCGttTGtTTtAGCGCG(SEQID NO：115)
SEQ IDNO:29 (measuring 2b)	HM	ggtgttgtttattttagagagtt(SEQ IDNO：116)	CTCCCCTAaCCCCTaTC(SEQID NO：117)	CTaTCCTTCACCACCTTCCCAaCACTaCA(SEQ IDNO：118)	ttaggggggCGCGgga(SEQ IDNO：119)	gttagatgCGtCGtagCGttg(SEQID NO：120)

Table 18: have the methylated sample ratio that is positioned at different threshold values from embodiment 3 sample sets 1

	CRC	CRC	CRC	Blood	Blood	Blood	BC	BC	BC
											＞10％	＞20％	＞30％	＞0.1	＞1	＞10	＞10％	＞20％	＞30％
SEQ ID NO:1 (measuring 2)	6	5	5	0	0	0	4	2	2
										％	50	41,66667	41,66667	0	0	0	28,57143	14,28571	14,28571

The sample sets 3 of table 19: embodiment 3

Sample type	Year of birth	Sex	The race	Diagnosis
					CRC	1938	F	The Asia ethnic group	M0, N0, T3, gland cancer, is distinguished well the II phase

CRC	1941	F	The Asia ethnic group	M0, N1, T3, gland cancer is distinguished mediumly, III phase, sigmoid colon
					CRC	1956	F	The Asia ethnic group	M0, N1, T2, gland cancer, is distinguished well the III phase
CRC	1945	F	The Asia ethnic group	M0, T2, gland cancer, 2 grades, N0
					CRC	1961	F	The Asia ethnic group	M0, N1, T3, gland cancer, is distinguished sigmoid colon well at the III phase
CRC	1945	F	Unknown	M0, N0, T2, gland cancer, is distinguished descending colon well at the I phase
					CRC	1970	F	The Asia ethnic group	M0, N0, T3, gland cancer is distinguished mediumly, II phase, the ascending colon
CRC	1941	F	The Asia ethnic group	M0, N0, T3, gland cancer is distinguished mediumly, II phase, sigmoid colon
					CRC	1952	F	The white race	M1, T3, ulcer, rudimentary, cancer, sigmoid colon, stromal
CRC	1948	F	The Asia ethnic group	M0, N1, T3, gland cancer, III phase, the ascending colon, 1 grade

CRC	1947	F	The Asia ethnic group	M0, N0, T3, gland cancer, is distinguished 1 grade well at the II phase
					CRC	1955	F	The Asia ethnic group	M0, N0, T3, gland cancer, the II phase, distinguish well, 1 grade, rectum
Sample type	Age	Sex
					Blood	16	F
Blood	33	F
					Blood	33	F
Blood	35	F
					Blood	23	F
Blood	35	F
					Blood	19	F
Blood	36	F
					Blood	24	F
Blood	37	F
					Sample type	Age	Sex	It during diagnosis climacterium	BC stage N Stage Value
Mammary cancer	63	F	Postclimacteric	N1
					Mammary cancer	59	F	Postclimacteric	N0

Mammary cancer	56	F	Postclimacteric	N0
					Mammary cancer	45	F	Premenopausal	N2
Mammary cancer	85	F	Postclimacteric	N0
					Mammary cancer	65	F	Postclimacteric	N0
Mammary cancer	32	F	Premenopausal	N2
					Mammary cancer	47	F	Premenopausal	N1
Mammary cancer	44	F	Premenopausal	N0
					Mammary cancer	29	F	Premenopausal	N1

Mammary cancer	37	F	Premenopausal	N0
					Mammary cancer	44	F	Premenopausal	N0
Mammary cancer	52	F	Postclimacteric	N0
					Mammary cancer	54	F	Premenopausal	N0

The result of table 20: embodiment 4

Disease type	Total+sample number	Gross sample is counted #
			Other cancer
Bladder
		4	10
Breast				5	29
	Liver	7	9
Lung				10	26
	Prostate gland	5	29
Stomach				2	7
	Pancreas	1	8
Other disease
			Ecphyaditis
	1	6
			Cholecystitis	3	10
IBD	4	17
			Diabetes	3	10
Esophagitis	2	10
			Gastritis	3	11
Morbus cardiacus	5	10
			Pancreatitis	3	10
Pyelonephritis	5	10
			Respiratory tract infection	3	10
Serious irritated	4	11
			Diverticulosis/diverticulitis	0	5
Rheumatoid arthritis	0	9
			Chronic renal disease	0	9
Non-rheumatoid arthritis	0	10

Table 21 is according to the primer of embodiment 5 and the genome Equivalent of amplified production

The amplicon title	The amplicon size	Amplicon title among the figure	The sub-Equivalent SEQ of genome amplification IDNO:	PCR primer 1	Primer 1 SEQ ID NO:	The PCR primer 2	Primer 2 SEQID NO:
								gamma-rc1	493	1	129	gamma-rc1F	130	gamma-rc1R	131
gamma-rc2	428	2	132	gamma-rc2F	133	gamma-rc2R	134
								gamma-3-2	557	3	135	gamma-3F_2	136	gamma-3R	137
gamma-4	556	4	138	gamma-4F	139	gamma-4R	140
								epsilon-1	529	5	141	epsilon-1F	142	epsilon-1R	143
epsilon-rc2	550	6	144	epsilon-rc2F	145	epsilon-rc2R	146
								epsilon-rc3	423	7	147	epsilon-rc3F	148	epsilon-rc3R	149
beta-rc1	282	8	150	beta-rc1F	151	beta-rc1R	152
								alpha-1	459	9	153	alpha-1F	154	alpha-1R	155
alpha	260	10	156	alpha-F	157	alpha-R	158

Attention: the amplicon that has " rc " in title increases from the Bis2 chain,

And other increases from Bis1.

Table 22: according to the oligomer of embodiment 6

Genome target sequence SEQ ID NO:	Oligomer SEQ ID NO:	Sequence	The oligomer type	Melting temperature (Tm)
					159	204	ggtgggtggttagtgaa	Forward primer	44,3
	205	ttattataacaataatacctaaaaaaaa	Reverse primer	46,06
						206	ggtgagtaagcgtttacgtcg	Probe	54,26
	207	cgagcgtcggggagg	Probe	52,37
						208	aaaacacatcaaaaccacaaaatttacaaaaacacaaca	Blocker	59,78
						209	tttagtatgtttttaattagagtgttaa	Forward primer	49,12

Table 21 is according to the primer of embodiment 5 and the genome Equivalent of amplified production

The amplicon title	The amplicon size	Amplicon title among the figure	The sub-Equivalent SEQ of genome amplification IDNO:	PCR primer 1	Primer 1 SEQ ID NO:	The PCR primer 2	Primer 2 SEQ ID NO:
								γ-rc1	493	1	129	γ-rc1F	130	γ-rc1R	131
γ-rc2	428	2	132	γ-rc2F	133	γ-rc2R	134
								γ-3-2	557	3	135	γ-3F_2	136	γ-3R	137
γ-4	556	4	138	γ-4F	139	γ-4R	140
								ε-1	529	5	141	ε-1F	142	ε-1R	143
ε-rc2	550	6	144	ε-rc2F	145	ε-rc2R	146
								ε-rc3	423	7	147	ε-rc3F	148	ε-rc3R	149
β-rc1	282	8	150	β-rc1F	151	β-rc1R	152
								α-1	459	9	153	α-1F	154	α-1R	155
α	260	10	156	α-F	157	α-R	158

Attention: the amplicon that has " rc " in title increases from the Bis2 chain,

And other increases from Bis1.

Table 22: according to the oligomer of embodiment 6

Genome target sequence SEQ ID NO:	Oligomer SEQ IDNO:	Sequence	The oligomer type	Melting temperature (Tm)
					159	204	ggtgggtggttagtgaa	Forward primer	44,3
	205	ttattataacaataatacctaaaaaaaa	Reverse primer	46,06
						206	ggtgagtaagcgtttacgtcg	Probe	54,26
	207	cgagcgtcggggagg	Probe	52,37
						208	aaaacacatcaaaaccacaaaatttacaaaaacacaaca	Blocker	59,78
						209	tttagtatgtttttaattagagtgttaa	Forward primer	49,12

	210	cctaacaaacttaactactccc	Reverse primer	48,61
						211	cgggatttaggcggtcg	Probe	51,86
	212	attttcggaggttttcgattagg	Probe	52,71
						213	ctcccaaaccctcattccaacccca	Blocker	58,58
						214	ccccaaaccctccc	Forward primer	41,62
	215	tttgtttaggaatttgtagttgt	Reverse primer	47,21
						216	cgggttaggaagttcgcg	Probe	52,98
	217	gacgtcgcgattgttttttg	Probe	51,64
						218	ccccaccacaaacacctaacctcccc	Blocker	59,6
					160	219	ccctctacctccctact	Forward primer	46,15
	220	ggagagaatagggggt	Reverse primer	42,66
						221	ggtggggcgtcgtcg	Probe		51,26
	222	cgttacggtttttggtgtcg	Probe								51,77
						223	caaactaaacctatcaaaaatcttttacaatcaacaaccc	Blocker	60,64
					161	224	ctaaaccaaataaaaaaaaataaaaac	Forward primer	46,6
	225	gatgggtaggtatagattttag	Reverse primer	46,36
						226	ggatttttttcgaagcgttttttt	Probe	51,89
	227	taagagcgcgttttttatcgaa	Probe	53,76
						228	aaataaaaacacactaaacacaccaccatacact	Blocker	58,53
					162	229	ttttgagtgagtttttaaatttt	Forward primer	45,08

	230	cctcctccctccactaac	Reverse primer	48,57
						231	tcgtttttttggaatgggcg	Probe	51,75
	232	acgcgaggtacggattttagg	Probe	55,05
						233	taaccacctttctccatccaacatccca	Blocker	58,99
						234	agtggagggaaggatgt	Forward primer	45,98
	235	aactctacaaacccaaaataaa	Reverse primer	46,17
						236	gagttcgttttgtagggcgg	Probe	53,18
	237	cgggcggttttggg	Probe	46,11
						238	taaacaaccccactcaaaccaaacaccc	Blocker	57,79
						239	ctatatattataaaaattataatccacc	Forward primer	46,43
	240	gggttaaggtgttggtagt	Reverse primer	46,11
						241	cgttagttttcggtaggtaggacg	Probe	56,41
	242	cgcggttgtttggcg	Probe	49,99
						243	ccacccaataacaacaaaacataccaccaattactaa	Blocker	60,46
					163	244	tacccttaataaaaaaactcc	Forward primer	43,53
	245	ttaggttgaggttggaaag	Reverse primer	46,08
						246	cgaaggggttagttgtcgttga	Probe	54,56
	247	cgttagtacgtagatgtaattggttttcg	Probe	57,45
						248	ctcccacacctacaaaccaacactccacaa	Blocker	61,25

Claims (31)

1. detect and/or the classification individuality in the method for cell proliferative disorders, comprise and determine to separate at least a Septin of being selected from 9 (comprising the transcript variant that they are all), FOXL2, SARM1, VTN, PRDM6, NR2E1, FAT and the gene of SEQ ID NO:160 to SEQ ID NO:165 or the expression level of genome sequence in the biological sample of described individuality, wherein owe to express and/or CpG methylates and shows that described illness exists or its kind.

2. the method for claim 1, wherein the cancerous cells proliferative disorders is different from the benign cell proliferative disorders, described method feature is to owe to express and/or the methylated existence of CpG shows the existence of cancerous cells proliferative disorders, and there is not the existence that shows the benign cell proliferative disorders in it.

3. the method for claim 1, wherein said cell proliferative disorders is a cancer.

4. method as claimed in claim 3, wherein said cell proliferative disorders are liver cell or colorectal carcinoma.

5. as each described method of claim 1-4, wherein said expression level by detect from the existence of the mRNA of described genetic transcription whether or level determine.

6. as each described method of claim 1-4, wherein said expression level by detect by the existence of the polypeptide of described gene or its sequence encoding whether or level determine.

7. method as claimed in claim 6, wherein said polypeptide is selected from western engram analysis, chromatography, immunoassay, ELISA immunoassay, radioimmunoassay, antibody act and combination thereof by one or more and detects.

8. as each described method of claim 1-4, whether the methylated existence of CpG comes to determine that wherein methylated existence shows the existence of cell proliferative disorders in the described gene by detecting in wherein said expression.

9. detect and/or the classification individuality in the method for cell proliferative disorders, comprise and make from described individual biological sample isolating genomic dna and at least a reagent or become group reagent to contact, described at least a reagent or in groups reagent area divide and methylate at least one target region of described genomic dna and methylated CpG dinucleotides not, wherein said target region comprises or hybridizes under stringent condition at least a SEQ ID NO:1 to the SEQ ID NO:3 that is selected from respectively, SEQ IDNO:24, SEQ ID NO:28, the sequence of at least 16 continuous nucleotides of the sequence of SEQ ID NO:159 to SEQ ID NO:167, wherein said continuous nucleotide comprises at least one CpG dinucleotides sequence, and the detection and/or the classification of on cell proliferation venereal disease disease are provided thus at least in part.

10. detect and/or the classification individuality in the method for cell proliferative disorders, comprising:

A. extract or otherwise from described individual biological sample isolation of genomic DNA;

B. use one or more agent treated described genomic dna or its fragment a), so that its 5 unmethylated cytosine(Cyt) bases are converted into uridylic or in other base that can be different from cytosine(Cyt) aspect the cross performance with detecting;

Described treated genomic dna or its treated fragment are contacted with at least a primer with the amplification enzyme, described primer comprises the continuous sequence of at least 9 Nucleotide, it is complementary to or hybridizes in being selected from SEQ ID NO:10 to SEQ IDNO:15 under medium tight or stringent condition, SEQ ID NO:28 to SEQ ID NO:33, SEQ ID NO:30 to SEQ IDNO:31, SEQ ID NO.42 to SEQ ID NO:43, SEQ ID NO:38 to SEQ IDNO:39, SEQ ID NO:50 to SEQ ID NO:51, the sequence of SEQ ID NO:168 to SEQ IDNO:203 and complementary sequence thereof, wherein said treated genomic dna or its fragment are amplified to produce at least a amplified production or not to be amplified; And

D. whether exist or its character based on described amplified material, determine to be selected from SEQ ID NO:1 to SEQ ID NO:3, SEQ ID NO:24, SEQ ID NO:28, the methylation state or the level of at least one CpG dinucleotides of the sequence of SEQ ID NO:159 to SEQ ID NO:167, perhaps reflection is selected from SEQ ID NO:1 to SEQ ID NO:3, SEQ ID NO:24, SEQID NO:28, the average methylation state of a plurality of CpG dinucleotides of the sequence of SEQ ID NO:159 to SEQ ID NO:167 or the average or the value of level provide at least in part thus and detect at least and one of the cell proliferative disorders of classifying.

11. method as claimed in claim 9, wherein b) in handle described genomic dna or its fragment and comprise and use the reagent that is selected from hydrosulphite, bisul-phite, disulfite and combination thereof.

12. method as claimed in claim 9, wherein c) in contact or amplification comprise and use at least a following method that is selected from: use hot resistant DNA polymerase as described amplification enzyme; Use the polysaccharase that lacks 5 '-3 ' 5 prime excision enzyme activity; Use polymerase chain reaction (PCR); Generation has the amplified production nucleic acid molecule of detectable label.

13. as each described method among the claim 1-11, wherein from the described individual described biological sample that obtains be selected from clone, Histological section, biopsy, paraffin-embedded tissue, body fluid, ight soil, colon effluent, urine, blood plasma, serum, whole blood, isolating hemocyte, from blood isolated cells, or its combination.

14. method as claimed in claim 10, also in step d), comprise and use at least a nucleic acid molecule or peptide nucleic acid(PNA) molecule, it all comprises in all cases and is complementary to or hybridizes in being selected from SEQ ID NO:10 to SEQ ID NO:15 under medium tight or stringent condition, SEQ IDNO:28 to SEQ ID NO:33, SEQ ID NO:30 to SEQ ID NO:31, SEQ IDNO:42 to SEQ ID NO:43, SEQ ID NO:38 to SEQ ID NO:39, SEQ IDNO:50 to SEQ ID NO:51, the continuous sequence of at least 9 length of nucleotides of SEQ ID NO:168 to SEQ ID NO:203 sequence and complementary sequence thereof, the amplification of wherein said nucleic acid molecule or its described nucleic acid of being hybridized of peptide nucleic acid(PNA) molecules in inhibiting.

15. method as claimed in claim 10, d wherein) hybridization of determining to comprise at least a nucleic acid molecule or peptide nucleic acid(PNA) molecule in, described at least a nucleic acid molecule or peptide nucleic acid(PNA) molecule comprise in all cases and are complementary to or hybridize in being selected from SEQID NO:10 to SEQ ID NO:15 under medium tight or stringent condition, SEQ ID NO:28 to SEQ ID NO:33, SEQ IDNO:30 to SEQ ID NO:31, SEQ ID NO:42 to SEQ ID NO:43, SEQ IDNO:38 to SEQ ID NO:39, SEQ ID NO:50 to SEQ ID NO:51, the continuous sequence of at least 9 length of nucleotides of SEQ IDNO:168 to SEQ ID NO:203 sequence and complementary sequence thereof.

16. method as claimed in claim 15, wherein at least a this hybrid nucleic acid molecule or peptide nucleic acid(PNA) molecule are connected to solid phase.

17. method as claimed in claim 15 also makes the nucleic acid molecule of at least a this hybridization extend at least one base.

18. method as claimed in claim 10, wherein d) in determine to comprise order-checking to described amplified production.

19. method as claimed in claim 10, wherein c) in contact or amplification comprise the primer that uses methylation specific.

20. the method for detection and/or classification cell proliferative disorders comprises:

A. extract or otherwise from deriving from the biological sample isolation of genomic DNA of described individuality;

B. with one or more responsive restriction enzymic digestion described genomic dna or its fragments a) that methylate;

Make b) DNA restriction enzyme digestion product with the amplification enzyme contact with at least two kinds of primers that are suitable for extension increasing sequence, described sequence comprises at least one CpG dinucleotides of the sequence that is selected from SEQ ID NO:1 to SEQ ID NO:3, SEQID NO:24, SEQ ID NO:28, SEQ ID NO:159 to SEQ ID NO:167; And

C. whether exist based on amplified production, determine to be selected from the methylation state or the level of at least one CpG dinucleotides of the sequence of SEQ ID NO:1 to SEQ IDNO:3, SEQ ID NO:24, SEQ ID NO:28, SEQ ID NO:159 to SEQ IDNO:167, provide at least in part thus and detect at least and one of the cell proliferative disorders of classifying.

21. method as claimed in claim 20, wherein by whether hybridizing existence that at least a nucleic acid or peptide nucleic acid(PNA) determine amplified production, described at least a nucleic acid or peptide nucleic acid(PNA) are equal to, are complementary to or hybridize at least 16 base long segment of the sequence that is selected from SEQ ID NO:1 to SEQID NO:3, SEQ ID NO:24, SEQ ID NO:28, SEQ ID NO:159 to SEQ IDNO:167 under tight or height stringent condition.

22. derived from the treated nucleic acid of genome SEQ ID NO:1 to SEQ ID NO:3, SEQ ID NO:24, SEQ ID NO:28, SEQ ID NO:159 to SEQ ID NO:167, wherein said processing is suitable for other base that at least one unmethylated cytosine(Cyt) base with described genomic dna sequence is converted into uridylic or can be different from cytosine(Cyt) with detecting in hybridization.

23. nucleic acid, it comprises and is selected from SEQ ID NO:10 to SEQ ID NO:15, SEQ IDNO:28 to SEQ ID NO:33, SEQ ID NO:30 to SEQ ID NO:31, SEQ IDNO:42 to SEQ ID NO:43, SEQ ID NO:38 to SEQ ID NO:39, SEQ IDNO:50 to SEQ ID NO:51, the treated genomic dna sequence of SEQ ID NO:168 to SEQ ID NO:203 and at least 16 continuous nucleotides of complementary sequence thereof, wherein said processing are appropriate to other base that at least one unmethylated cytosine(Cyt) base with described genomic dna sequence changes uridylic into or can be different from cytosine(Cyt) with detecting in hybridization.

24. nucleic acid comprises at least 50 continuous nucleotides of the dna sequence dna that is selected from SEQ ID NO:10 to SEQ ID NO:15, SEQ IDNO:28 to SEQ ID NO:33, SEQ ID NO:30 to SEQ ID NO:31, SEQ IDNO:42 to SEQ ID NO:43, SEQ ID NO:38 to SEQ ID NO:39, SEQ IDNO.50 to SEQ ID NO:51, SEQ ID NO:168 to SEQ ID NO:203 and complementary sequence thereof.

25. as each described nucleic acid among the claim 22-24, wherein said continuous base sequence comprises at least one CpG, TpG or CpA dinucleotides sequence.

26. nucleic acid comprises and is selected from SEQ ID NO:1 to SEQ IDNO:3 as diagnostic tool, SEQ ID NO:24, SEQ ID NO:28, SEQ ID NO:159 to SEQ IDNO:167, SEQ ID NO:10 to SEQ ID NO:15, SEQ ID NO:28 to SEQ IDNO:33, SEQ ID NO:30 to SEQ ID NO:31, SEQ ID NO:42 to SEQ IDNO:43, SEQ ID NO:38 to SEQ ID NO:39, SEQ ID NO:50 to SEQ IDNO:51, the nucleotide sequence of SEQ ID NO:168 to SEQ ID NO:203 and at least 16 continuous nucleotides of complementary sequence thereof.

27. be suitable for implementing the test kit of the described method of claim 3, comprise and a) multiplely can under tight or medium stringent condition, hybridize at least a Septin of being selected from 9 (comprising its all transcript variants), FOXL2, SARM1, VTN, PRDM6, NR2E1, FAT and the gene of SEQID NO:160 to SEQ ID NO:165 or the oligonucleotide or the polynucleotide of genome sequence transcription product; (b) be suitable for the container that holds described oligonucleotide or polynucleotide and comprise patient's biological sample of described transcription product, wherein said oligonucleotide or polynucleotide can be hybridized described transcription product under tight or medium stringent condition, (c) detect the instrument of the hybridization of (b); And randomly, (d) use and explain test kit result's specification sheets.

28. be suitable for implementing the test kit of the described method of claim 5, comprise that (a) detects the instrument of the polypeptide of the gene of at least a Septin of being selected from 9 (comprising its all transcript variants), FOXL2, SARM1, VTN, PRDM6, NR2E1, FAT and SEQ ID NO:160 to SEQ ID NO:165 or genome sequence; (b) container that is suitable for holding described instrument and comprises patient's biological sample of described polypeptide, wherein said instrument can form mixture with described polypeptide; (c) instrument of the mixture of detection (b).

29. be suitable for implementing the test kit of the method for claim 9, comprise (a) hydrosulphite reagent; (b) be suitable for holding the container of described hydrosulphite and patient's biological sample; (c) contain at least one cover oligonucleotide of two kinds of oligonucleotide, its sequence all is equal in all cases, is complementary to or hybridizes in 9 or more preferably 18 base long segment of the sequence that is selected from SEQ ID NO:10 to SEQID NO:15, SEQ ID NO:28 to SEQ ID NO:33, SEQ ID NO:30 to SEQ IDNO:31, SEQ ID NO:42 to SEQ ID NO:43, SEQ ID NO:38 to SEQ IDNO:39, SEQ ID NO:50 to SEQ ID NO:51, SEQ ID NO:168 to SEQ IDNO:203 under tight or height stringent condition.

30. be suitable for implementing the test kit of the method for claim 9, comprise (a) the responsive restriction enzyme reagent that methylates; (b) be suitable for holding the container of described reagent and patient's biological sample; (c) contain at least one cover oligonucleotide of one or more nucleic acid or peptide nucleic acid(PNA), it is equal to, is complementary to or hybridizes at least 9 base long segment of the sequence that is selected from SEQ ID NO:1 to SEQ IDNO:3, SEQ ID NO:24, SEQ ID NO:28, SEQ ID NO:159 to SEQ IDNO:167 under tight or height stringent condition; And randomly, (d) use and explain test kit result's specification sheets.

31. the test kit of the method for claim 1-21, the nucleic acid of claim 22-26 and/or claim 27-30 is in the diagnosis of cell proliferative disorders and/or the purposes in the classification.

Images