CN111549071A - Construction method and application of drug toxicity tolerance production cell strain for producing protein drug conjugate - Google Patents
Construction method and application of drug toxicity tolerance production cell strain for producing protein drug conjugate Download PDFInfo
- Publication number
- CN111549071A CN111549071A CN202010410275.8A CN202010410275A CN111549071A CN 111549071 A CN111549071 A CN 111549071A CN 202010410275 A CN202010410275 A CN 202010410275A CN 111549071 A CN111549071 A CN 111549071A
- Authority
- CN
- China
- Prior art keywords
- drug
- protein
- vector
- constructing
- producing
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/87—Introduction of foreign genetic material using processes not otherwise provided for, e.g. co-transformation
- C12N15/90—Stable introduction of foreign DNA into chromosome
- C12N15/902—Stable introduction of foreign DNA into chromosome using homologous recombination
- C12N15/907—Stable introduction of foreign DNA into chromosome using homologous recombination in mammalian cells
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K47/00—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient
- A61K47/50—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates
- A61K47/51—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent
- A61K47/62—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being a protein, peptide or polyamino acid
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/85—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/14—Hydrolases (3)
- C12N9/16—Hydrolases (3) acting on ester bonds (3.1)
- C12N9/18—Carboxylic ester hydrolases (3.1.1)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2800/00—Nucleic acids vectors
- C12N2800/10—Plasmid DNA
- C12N2800/106—Plasmid DNA for vertebrates
- C12N2800/107—Plasmid DNA for vertebrates for mammalian
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Genetics & Genomics (AREA)
- Engineering & Computer Science (AREA)
- Chemical & Material Sciences (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Organic Chemistry (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- General Engineering & Computer Science (AREA)
- Biomedical Technology (AREA)
- Biotechnology (AREA)
- Molecular Biology (AREA)
- General Health & Medical Sciences (AREA)
- Microbiology (AREA)
- Biochemistry (AREA)
- Medicinal Chemistry (AREA)
- Plant Pathology (AREA)
- Physics & Mathematics (AREA)
- Biophysics (AREA)
- Mycology (AREA)
- Epidemiology (AREA)
- Public Health (AREA)
- Veterinary Medicine (AREA)
- Pharmacology & Pharmacy (AREA)
- Cell Biology (AREA)
- Animal Behavior & Ethology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Peptides Or Proteins (AREA)
Abstract
The invention discloses a construction method of a drug toxicity tolerance production cell strain for producing protein drug conjugates and application thereof, and the invention modifies the prior protein production cell strain by means of genetic engineering to make the protein drug conjugate tolerant to the toxicity of the conjugate drug, and can directly produce the protein drug conjugate which is linked by a stable covalent bond, thereby avoiding the side effect generated by the instability of the protein drug conjugate, therefore, the invention has good application prospect in the research and development and production of the protein drug conjugate.
Description
Technical Field
The invention belongs to the technical field of biology, and particularly relates to construction of cell strains, production of protein drug conjugates and production of antibody drug conjugates.
Technical Field
Protein-drug conjugates (PDC) are molecules that attach biologically active molecular drugs to proteins via a chemical linkage, and currently mainly include antibody-drug conjugates (ADC). The protein or the monoclonal antibody part of the polypeptide is used as a carrier to target and transport the small molecule drug to target cells, and the drug has an active effect in the cells, such as killing the target cells and the like.
However, due to the limitations of coupling technology, targeting, effectiveness, etc., the complete protein-coupled drug is unstable in blood, and is liable to cause side effects such as lethal toxicity.
Disclosure of Invention
The invention aims to modify the existing protein production cell strain by means of genetic engineering to enable the protein production cell strain to be tolerant to the toxicity of coupling drugs, and directly produce protein drug conjugates which are linked by stable covalent bonds, thereby avoiding side effects caused by the instability of the protein drug conjugates.
In order to achieve the purpose, the technical scheme provided by the invention is as follows:
the construction method of the drug toxicity tolerance production cell strain for producing the protein drug conjugate is characterized by comprising the following steps:
s1, constructing a recombinant protein production vector, wherein the vector comprises Cas9 and a gRNA sequence targeting any Dph of Dph 1-7; the Dph Gene is a Gene related to diphtheria amide synthesis in human body and is highly conserved at Dph1-7, wherein the Gene ID of Dph7 at NCBI is Gene ID: 92715.
S2, transfecting the production vector into cells to construct a drug toxicity tolerance production cell strain;
and S3, detecting the constructed drug toxicity tolerance production cell strain.
The principle of the scheme is that a protein translation mechanism in the eukaryotic cell depends on an elongation factor 2 (EF-2), and a functional core region of the EF-2 comprises a modified amino acid: diphtheria amide (dipthamide). Diphtheria toxin (diphtheria toxin) disables EF-2, blocks protein translation processes, and induces apoptosis in cells by modifying diphtheria amide. The production process of diphtheria amide needs the participation of dph1-7, after the dph7 is knocked out, the diphtheria amide modification process is interrupted, the cytotoxicity of diphtheria toxin is also eliminated, and the functional performance of EF2 is not influenced after the diphtheria amide modification process is interrupted.
Further, in the method for constructing the drug toxicity tolerance production cell line for producing the protein drug conjugate, the recombinant protein production vector further comprises a GFP sequence.
Furthermore, the recombinant protein production vector is pX260a-GFP-Dph7, and the sequence of the vector is shown as SEQ ID NO. 3.
Further, the method for constructing the drug toxicity tolerance producer cell line for producing the protein drug conjugate, wherein the method for constructing the recombinant protein production vector pX260a-GFP-Dph7 comprises the following steps:
(1) a forward primer with a sequence shown as SEQ ID NO.1 and a reverse primer with a sequence shown as SEQ ID NO.2 are combined to form a targeted gRNA of Dph 7;
(2) the synthesized Dph7 targeted gRNA is cloned to a vector pX260a-GFP by utilizing a restriction enzyme site BbsI to obtain a gene modification vector pX260a-GFP-Dph7 shown as SEQ ID No. 3.
Further, in the above method for constructing a drug toxicity tolerance-producing cell line for producing a protein-drug conjugate, the construction of the drug toxicity tolerance-producing cell line in step S2 specifically includes the following steps:
(1) culturing the cells;
(2) transfecting the production vector obtained in the step S1 into cells;
(3) the transfected cells were screened.
Further, the method for constructing the drug toxicity tolerance production cell strain for producing the protein drug conjugate is a prokaryotic or eukaryotic cell, including but not limited to FreeStyle 293-F.
Further, in the above method for constructing a drug toxicity tolerance-producing cell line for producing a protein-drug conjugate, the step S3 includes the specific steps of:
(1) constructing a detection vector containing diphtheria toxin DTA and GFP showing infection efficiency;
(2) transfecting a drug toxicity-tolerant producer cell line;
(3) GFP expression, i.e. DTA expression, was detected using flow cytometry.
Furthermore, in the method for constructing the drug toxicity tolerance production cell strain for producing the protein drug conjugate, the detection vector is pMyc-DTA-IRES-GFP, and the sequence of the detection vector is shown as SEQ ID.10.
Furthermore, the construction method of the drug toxicity tolerance production cell line for producing the protein drug conjugate is applied to the development and production of the protein drug conjugate.
By combining the scheme, the invention provides a construction method and application of a drug toxicity tolerance production cell strain for producing a protein drug conjugate, and the construction method has the following beneficial effects: according to the invention, the existing protein production cell strain is modified by means of genetic engineering, so that the protein drug conjugate has tolerance to the produced protein drug conjugate and the production efficiency is improved; on the other hand, the protein coupling drug produced by the cell strain is firmly connected by a covalent bond, has good stability, and can not release the drug prematurely in body fluid or blood to cause unnecessary side effects when being used in animals or human bodies, so the invention has good application prospect in the research and development and production of protein drug conjugates; furthermore, the invention also discloses a method for culturing and identifying the drug toxicity tolerance production cell strain.
Drawings
FIG. 1: the invention constructs the flow schematic diagram of the genetic modification carrier plasmid;
FIG. 2: plasmid structure schematic diagram of pX260a-GFP empty vector;
FIG. 3: the plasmid structure schematic diagram of the genetically modified vector pX260a-GFP-Dph 7;
FIG. 4: pMyc-IRES-GFP empty plasmid schematic;
FIG. 5: pMyc-DTA-IRES-GFP schematic;
FIG. 6: identification result of TR cell line:
FIG. 7: TR cell strain detection result chart.
Detailed Description
Reference will now be made in detail to embodiments of the present invention, examples of which are illustrated in the accompanying drawings, wherein like or similar reference numerals refer to the same or similar elements or elements having the same or similar function throughout. The embodiments described below with reference to the drawings are illustrative and intended to be illustrative of the invention and are not to be construed as limiting the invention.
Example 1
The whole process for constructing the genetically engineered vector pX260a-GFP-Dph7 is shown in figure 1.
A forward primer Dph7-gRNA-F-TGTTGATGCTTCTCTTTCTCCA (SEQ ID NO.1) and a reverse primer Dph7-gRNA-R-TCTGAACCAGTGTCCAGCAC (SEQ ID NO.2) are designed and annealed to form Dph7 gRNA.
The analing reaction system is as follows:
the analing reaction conditions were as follows:
dph7 gRNA was cloned into the empty vector pX260a-GFP (vector structure shown in FIG. 2): the empty vector pX260a-GFP BbsI (NEB) was digested. The digested plasmid vector was separated by agarose Gel electrophoresis, and the desired band was excised and recovered using AxyPrep DNA Gel Extraction Kit (Axygen). The vector is connected with Dph7 by utilizing T4 DNAlgase (NEB), then escherichia coli DH5 alpha is transformed, a single colony is selected for culture, plasmid DNA is extracted, and the plasmid DNA is sent to a commercial company for sequencing after enzyme digestion preliminary identification. Sequencing results show that Dph7 gRNA is successfully inserted and named as a gene modification vector pX260a-GPF-Dph 7(SEQ ID NO.3), and the sequence is shown in the attached figure 2.
Example 2
The construction method of the drug toxicity tolerance production cell line (Toxin resistant, TR) is as follows:
(1) using FreeStyle 293-F cells with FreeStyleTM293 Medium adjusted to 106cells/mL, 1mL in total, were cultured in 6-well plates;
(2) 5 micrograms of the pX260a-GFP-Dph7 gene modification vector obtained in example 1 and 125 microliters of P3000 were takenTMReagent (thermofisher) blending;
(3) get
125. mu.l of Medium (thermofisher) and
3000 Reagent7.5. mu.l mix;
(4) uniformly mixing the culture medium obtained in the step 2 and the step 3 with DNA, and standing for 5 minutes;
(5) adding the mixture obtained in step 4 to cells;
(6) cells were cultured for 3 days after transfection;
(7) sorting GFP positive cells into 96-well plates using FACS Aria III, each well containing one single cell;
(8) after 3 days of culture, digesting by using pancreatin, and amplifying to a 24-well plate;
(9) after 3 days of culture, half of the cells were used to extract DNA using a dnasy-blood-and-tissue-kit, and the other half of the cells were expanded in a 6-well plate.
And (3) subsequently, detecting the DNA extracted in the step (9) to verify whether the transformation is successful, wherein the method comprises the following steps:
using the DNA obtained in step (9) as a template, the forward primer Dph7-Screen-F-
CTTCCTCACAGACAGAGTCACCCAG (SEQ ID NO.4), reverse primer Dph7-Screen-R-
CGAGAAGGGCCCGAGAGCCTCC (SEQ ID NO.5) was subjected to PCR amplification to obtain a Dph7 Screen gene fragment (SEQ ID NO. 6).
The PCR reaction system is as follows:
the PCR amplification conditions were as follows:
after the target gene fragment Dph7 Screen PCR product was separated by agarose Gel electrophoresis, the target band was excised and recovered with AxyPrep DNA Gel Extraction Kit (Axygen), and digested with Surveyor Enzyme (NEB). The cleaved PCR products were separated by agarose gel electrophoresis and photographed as shown in FIG. 6.
Example 3
Detecting drug toxicity tolerance producing cell line (Toxin resistant, TR)
pIRES-proHB EGF WT plasmid (adddge) was used as template, using forward primer DTA-F-BamHI-ACCAC
GGATCCATGGGCGCTGATGATGTTGTTGATTCTTC (SEQ ID NO.7), reverse primer DTA-R (EcoRI) -ACCACGAATTCTTAGTGGGAATTAGTCATGCCC (SEQ ID NO.8) was used for PCR amplification of the DTA gene fragment (SEQ ID NO. 9). Underlined sequences are the restriction sites. The PCR reaction system was the same as in example 2, and the PCR amplification conditions were the same as in example 2.
Cloning the target gene fragment DTA into an empty vector pMyc-IRES-GFP (the vector structure is shown in the attached figure 4): after the PCR products were separated by agarose Gel electrophoresis, the desired bands were excised and recovered using AxyPrep DNA Gel Extraction Kit (Axygen). The purified DTA and the empty vector pMyc-IRES-GFP were digested simultaneously with EcoRI and BamHI (NEB), respectively, and Alkaline phosphatase (NEB) was added to the empty vector pMyc-IRES-GFP during digestion. The PCR digestion product is purified and recovered by AxyPrep PCRClean-Up Kit (Axygen), and the digestion plasmid vector is separated by agarose Gel electrophoresis, and then the target band is cut out and recovered by AxyPrep DNA Gel Extraction Kit (Axygen). The vector is connected with a target fragment by using T4 DNA ligase (NEB), then escherichia coli DH5 alpha is transformed, a single colony is selected for culture, plasmid DNA is extracted, and the plasmid DNA is sent to a commercial company for sequencing after enzyme digestion preliminary identification. The sequencing result shows that the DTA is successfully inserted and is named as a detection vector pMyc-DTA-IRES-GFP (SEQ ID NO.10), and the structure of the vector is shown in the attached figure 5.
(1) The drug toxicity tolerance producing cell line obtained in example 2 was used as FreeStyleTM293 Medium adjusted to 106cells/mL, 1mL in total, were cultured in 6-well plates;
(2) taking pMyc-DTA-IRES-GFP to detect 5 micrograms of vector and 125 microliters of P3000TMReagent (thermofisher) blending;
(3) get
125. mu.l of Medium (thermofisher) and
3000 Reagent7.5. mu.l mix;
(4) uniformly mixing the culture medium obtained in the steps 2 and 3 with DNA, and standing for 5 minutes;
(5) adding the mixture obtained in step 4 to cells;
(6) cells were cultured for 3 days after transfection;
(7) the Cyto Flex assay was used to find GFP positive, as shown in FIG. 7, i.e., DTA expression, and successful DTA expression by the TR cell line, indicating that the TR cell line is resistant to toxicity.
The foregoing is only a preferred embodiment of the present invention, and it should be noted that modifications can be made by those skilled in the art without departing from the principle of the present invention, and these modifications should also be construed as the protection scope of the present invention.
SEQUENCE LISTING
<110> Qianyuan kang' an (Suzhou) Biotechnology Co., Ltd
<120> construction method of drug toxicity tolerance production cell strain for producing protein drug conjugate and application thereof
<130>2020
<160>10
<170>PatentIn version 3.3
<210>1
<211>22
<212>DNA
<213> Artificial
<223> primer Dph7-gRNA-F
<400>1
tgttgatgct tctctttctc ca 22
<210>2
<211>20
<212>DNA
<213> Artificial
<223> primer Dph7-gRNA-R
<400>2
tctgaaccag tgtccagcac 20
<210>3
<211>10847
<212>DNA
<213> Artificial
<223> genetically engineered plasmid pX260a-GPF-Dph 7
<400>3
gagggcctat ttcccatgat tccttcatat ttgcatatac gatacaaggc tgttagagag 60
ataattggaa ttaatttgac tgtaaacaca aagatattag tacaaaatac gtgacgtaga 120
aagtaataat ttcttgggta gtttgcagtt ttaaaattat gttttaaaat ggactatcat 180
atgcttaccg taacttgaaa gtatttcgat ttcttggctt tatatatctt gtggaaagga 240
cgaaacaccg ggttttagag ctatgctgtt ttgaatggtc ccaaaactgt tgatgcttct 300
ctttctccag ttttagagct atgctgtttt gaatggtccc aaaacttttt ctagcgcgtg 360
cgccaattct gcagacaaat ggctctagag gtacccgtta cataacttac ggtaaatggc 420
ccgcctggct gaccgcccaa cgacccccgc ccattgacgt caatagtaac gccaataggg 480
actttccatt gacgtcaatg ggtggagtat ttacggtaaa ctgcccactt ggcagtacat 540
caagtgtatc atatgccaag tacgccccct attgacgtca atgacggtaa atggcccgcc 600
tggcattgtg cccagtacat gaccttatgg gactttccta cttggcagta catctacgta 660
ttagtcatcg ctattaccat ggtcgaggtg agccccacgt tctgcttcac tctccccatc 720
tcccccccct ccccaccccc aattttgtat ttatttattt tttaattatt ttgtgcagcg 780
atgggggcgg gggggggggg ggggcgcgcg ccaggcgggg cggggcgggg cgaggggcgg 840
ggcggggcga ggcggagagg tgcggcggca gccaatcaga gcggcgcgct ccgaaagttt 900
ccttttatgg cgaggcggcg gcggcggcgg ccctataaaa agcgaagcgc gcggcgggcg 960
ggagtcgctg cgacgctgcc ttcgccccgt gccccgctcc gccgccgcct cgcgccgccc 1020
gccccggctc tgactgaccg cgttactccc acaggtgagc gggcgggacg gcccttctcc 1080
tccgggctgt aattagctga gcaagaggta agggtttaag ggatggttgg ttggtggggt 1140
attaatgttt aattacctgg agcacctgcc tgaaatcact ttttttcagg ttggaccggt 1200
gccaccatgg actataagga ccacgacgga gactacaagg atcatgatat tgattacaaa 1260
gacgatgacg ataagatggc cccaaagaag aagcggaagg tcggtatcca cggagtccca 1320
gcagccgaca agaagtacag catcggcctg gacatcggca ccaactctgt gggctgggcc 1380
gtgatcaccg acgagtacaa ggtgcccagc aagaaattca aggtgctggg caacaccgac 1440
cggcacagca tcaagaagaa cctgatcgga gccctgctgt tcgacagcgg cgaaacagcc 1500
gaggccaccc ggctgaagag aaccgccaga agaagataca ccagacggaa gaaccggatc 1560
tgctatctgc aagagatctt cagcaacgag atggccaagg tggacgacag cttcttccac 1620
agactggaag agtccttcct ggtggaagag gataagaagc acgagcggca ccccatcttc 1680
ggcaacatcg tggacgaggt ggcctaccac gagaagtacc ccaccatcta ccacctgaga 1740
aagaaactgg tggacagcac cgacaaggcc gacctgcggc tgatctatct ggccctggcc 1800
cacatgatca agttccgggg ccacttcctg atcgagggcg acctgaaccc cgacaacagc 1860
gacgtggaca agctgttcat ccagctggtg cagacctaca accagctgtt cgaggaaaac 1920
cccatcaacg ccagcggcgt ggacgccaag gccatcctgt ctgccagact gagcaagagc 1980
agacggctgg aaaatctgat cgcccagctg cccggcgaga agaagaatgg cctgttcgga 2040
aacctgattg ccctgagcct gggcctgacc cccaacttca agagcaactt cgacctggcc 2100
gaggatgcca aactgcagct gagcaaggac acctacgacg acgacctgga caacctgctg 2160
gcccagatcg gcgaccagta cgccgacctg tttctggccg ccaagaacct gtccgacgcc 2220
atcctgctga gcgacatcct gagagtgaac accgagatca ccaaggcccc cctgagcgcc 2280
tctatgatca agagatacga cgagcaccac caggacctga ccctgctgaa agctctcgtg 2340
cggcagcagc tgcctgagaa gtacaaagag attttcttcg accagagcaa gaacggctac 2400
gccggctaca ttgacggcgg agccagccag gaagagttct acaagttcat caagcccatc 2460
ctggaaaaga tggacggcac cgaggaactg ctcgtgaagc tgaacagaga ggacctgctg 2520
cggaagcagc ggaccttcga caacggcagc atcccccacc agatccacct gggagagctg 2580
cacgccattc tgcggcggca ggaagatttt tacccattcc tgaaggacaa ccgggaaaag 2640
atcgagaaga tcctgacctt ccgcatcccc tactacgtgg gccctctggc caggggaaac 2700
agcagattcg cctggatgac cagaaagagc gaggaaacca tcaccccctg gaacttcgag 2760
gaagtggtgg acaagggcgc ttccgcccag agcttcatcg agcggatgac caacttcgat 2820
aagaacctgc ccaacgagaa ggtgctgccc aagcacagcc tgctgtacga gtacttcacc 2880
gtgtataacg agctgaccaa agtgaaatac gtgaccgagg gaatgagaaa gcccgccttc 2940
ctgagcggcg agcagaaaaa ggccatcgtg gacctgctgt tcaagaccaa ccggaaagtg 3000
accgtgaagc agctgaaaga ggactacttc aagaaaatcg agtgcttcga ctccgtggaa 3060
atctccggcg tggaagatcg gttcaacgcc tccctgggca cataccacga tctgctgaaa 3120
attatcaagg acaaggactt cctggacaat gaggaaaacg aggacattct ggaagatatc 3180
gtgctgaccc tgacactgtt tgaggacaga gagatgatcg aggaacggct gaaaacctat 3240
gcccacctgt tcgacgacaa agtgatgaag cagctgaagc ggcggagata caccggctgg 3300
ggcaggctga gccggaagct gatcaacggc atccgggaca agcagtccgg caagacaatc 3360
ctggatttcc tgaagtccga cggcttcgcc aacagaaact tcatgcagct gatccacgac 3420
gacagcctga cctttaaaga ggacatccag aaagcccagg tgtccggcca gggcgatagc 3480
ctgcacgagc acattgccaa tctggccggc agccccgcca ttaagaaggg catcctgcag 3540
acagtgaagg tggtggacga gctcgtgaaa gtgatgggcc ggcacaagcc cgagaacatc 3600
gtgatcgaaa tggccagaga gaaccagacc acccagaagg gacagaagaa cagccgcgag 3660
agaatgaagc ggatcgaaga gggcatcaaa gagctgggca gccagatcct gaaagaacac 3720
cccgtggaaa acacccagct gcagaacgag aagctgtacc tgtactacct gcagaatggg 3780
cgggatatgt acgtggacca ggaactggac atcaaccggc tgtccgacta cgatgtggac 3840
catatcgtgc ctcagagctt tctgaaggac gactccatcg acaacaaggt gctgaccaga 3900
agcgacaaga accggggcaa gagcgacaac gtgccctccg aagaggtcgt gaagaagatg 3960
aagaactact ggcggcagct gctgaacgcc aagctgatta cccagagaaa gttcgacaat 4020
ctgaccaagg ccgagagagg cggcctgagc gaactggata aggccggctt catcaagaga 4080
cagctggtgg aaacccggca gatcacaaag cacgtggcac agatcctgga ctcccggatg 4140
aacactaagt acgacgagaa tgacaagctg atccgggaag tgaaagtgat caccctgaag 4200
tccaagctgg tgtccgattt ccggaaggat ttccagtttt acaaagtgcg cgagatcaac 4260
aactaccacc acgcccacga cgcctacctg aacgccgtcg tgggaaccgc cctgatcaaa 4320
aagtacccta agctggaaag cgagttcgtg tacggcgact acaaggtgta cgacgtgcgg 4380
aagatgatcg ccaagagcga gcaggaaatc ggcaaggcta ccgccaagta cttcttctac 4440
agcaacatca tgaacttttt caagaccgag attaccctgg ccaacggcga gatccggaag 4500
cggcctctga tcgagacaaa cggcgaaacc ggggagatcg tgtgggataa gggccgggat 4560
tttgccaccg tgcggaaagt gctgagcatg ccccaagtga atatcgtgaa aaagaccgag 4620
gtgcagacag gcggcttcag caaagagtct atcctgccca agaggaacag cgataagctg 4680
atcgccagaa agaaggactg ggaccctaag aagtacggcg gcttcgacag ccccaccgtg 4740
gcctattctg tgctggtggt ggccaaagtg gaaaagggca agtccaagaa actgaagagt 4800
gtgaaagagc tgctggggat caccatcatg gaaagaagca gcttcgagaa gaatcccatc 4860
gactttctgg aagccaaggg ctacaaagaa gtgaaaaagg acctgatcat caagctgcct 4920
aagtactccc tgttcgagct ggaaaacggc cggaagagaa tgctggcctc tgccggcgaa 4980
ctgcagaagg gaaacgaact ggccctgccc tccaaatatg tgaacttcct gtacctggcc 5040
agccactatg agaagctgaa gggctccccc gaggataatg agcagaaaca gctgtttgtg 5100
gaacagcaca agcactacct ggacgagatc atcgagcaga tcagcgagtt ctccaagaga 5160
gtgatcctgg ccgacgctaa tctggacaaa gtgctgtccg cctacaacaa gcaccgggat 5220
aagcccatca gagagcaggc cgagaatatc atccacctgt ttaccctgac caatctggga 5280
gcccctgccg ccttcaagta ctttgacacc accatcgacc ggaagaggta caccagcacc 5340
aaagaggtgc tggacgccac cctgatccac cagagcatca ccggcctgta cgagacacgg 5400
atcgacctgt ctcagctggg aggcgacaaa aggccggcgg ccacgaaaaa ggccggccag 5460
gcaaaaaaga aaaagtaaga attcgcccct ctccctcccc cccccctaac gttactggcc 5520
gaagccgctt ggaataaggc cggtgtgcgt ttgtctatat gttattttcc accatattgc 5580
cgtcttttgg caatgtgagg gcccggaaac ctggccctgt cttcttgacg agcattccta 5640
ggggtctttc ccctctcgcc aaaggaatgc aaggtctgtt gaatgtcgtg aaggaagcag 5700
ttcctctgga agcttcttga agacaaacaa cgtctgtagc gaccctttgc aggcagcgga 5760
accccccacc tggcgacagg tgcctctgcg gccaaaagcc acgtgtataa gatacacctg 5820
caaaggcggc acaaccccag tgccacgttg tgagttggat agttgtggaa agagtcaaat 5880
ggctctcctc aagcgtattc aacaaggggc tgaaggatgc ccagaaggta ccccattgta 5940
tgggatctga tctggggcct cggtgcacat gctttacatg tgtttagtcg aggttaaaaa 6000
acgtctaggc cccccgaacc acggggacgt ggttttcctt tgaaaaacac gatgataata 6060
tggccacaac catggtgagc aagggcgagg agctgttcac cggggtggtg cccatcctgg 6120
tcgagctgga cggcgacgta aacggccaca agttcagcgt gtccggcgag ggcgagggcg 6180
atgccaccta cggcaagctg accctgaagt tcatctgcac caccggcaag ctgcccgtgc 6240
cctggcccac cctcgtgacc accctgacct acggcgtgca gtgcttcagc cgctaccccg 6300
accacatgaa gcagcacgac ttcttcaagt ccgccatgcc cgaaggctac gtccaggagc 6360
gcaccatctt cttcaaggac gacggcaact acaagacccg cgccgaggtg aagttcgagg 6420
gcgacaccct ggtgaaccgc atcgagctga agggcatcga cttcaaggag gacggcaaca 6480
tcctggggca caagctggag tacaactaca acagccacaa cgtctatatc atggccgaca 6540
agcagaagaa cggcatcaag gtgaacttca agatccgcca caacatcgag gacggcagcg 6600
tgcagctcgc cgaccactac cagcagaaca cccccatcgg cgacggcccc gtgctgctgc 6660
ccgacaacca ctacctgagc acccagtccg ccctgagcaa agaccccaac gagaagcgcg 6720
atcacatggt cctgctggag ttcgtgaccg ccgccgggat cactctcggc atggacgagc 6780
tgtacaagta agaattccga tcatattcaa taacccttaa tataacttcg tataatgtat 6840
gctatacgaa gttattaggt ctgaagagga gtttacgtcc agccaagctt aggatctcga 6900
cctcgaaatt ctaccgggta ggggaggcgc ttttcccaag gcagtctgga gcatgcgctt 6960
tagcagcccc gctgggcact tggcgctaca caagtggcct ctggcctcgc acacattcca 7020
catccaccgg tagcgccaac cggctccgtt ctttggtggc cccttcgcgc caccttctac 7080
tcctccccta gtcaggaagt tcccccccgc cccgcagctc gcgtcgtgca ggacgtgaca 7140
aatggaagta gcacgtctca ctagtctcgt gcagatggac agcaccgctg agcaatggaa 7200
gcgggtaggc ctttggggca gcggccaata gcagctttgc tccttcgctt tctgggctca 7260
gcagctggga agggtgggtc cgggggcggg ctcaggggcg ggctcagggg cggggcgggc 7320
gcccgaaggt cctccggagg cccggcattc tgcacgcttc aaaagcgcac gtctgccgcg 7380
ctgttctcct cttcctcatc tccgggcctt tcgacctgca tccatctaga tctcgagcag 7440
ctgaagctta ccatgaccga gtacaagccc acggtgcgcc tcgccacccg cgacgacgtc 7500
cccagggccg tacgcaccct cgccgccgcg ttcgccgact accccgccac gcgccacacc 7560
gtcgatccgg accgccacat cgagcgggtc accgagctgc aagaactctt cctcacgcgc 7620
gtcgggctcg acatcggcaa ggtgtgggtc gcggacgacg gcgccgcggt ggcggtctgg 7680
accacgccgg agagcgtcga agcgggggcg gtgttcgccg agatcggccc gcgcatggcc 7740
gagttgagcg gttcccggct ggccgcgcag caacagatgg aaggcctcct ggcgccgcac 7800
cggcccaagg agcccgcgtg gttcctggcc accgtcggcg tctcgcccga ccaccagggc 7860
aagggtctgg gcagcgccgt cgtgctcccc ggagtggagg cggccgagcg cgccggggtg 7920
cccgccttcc tggagacctc cgcgccccgc aacctcccct tctacgagcg gctcggcttc 7980
accgtcaccg ccgacgtcga ggtgcccgaa ggaccgcgca cctggtgcat gacccgcaag 8040
cccggtgcct gacgcccgcc ccacgacccg cagcgcccga ccgaaaggag cgcacgaccc 8100
catgcatcga tgatatcaga tccccgggat gcagaaattg atgatctatt aaacaataaa 8160
gatgtccact aaaatggaag tttttcctgt catactttgt taagaagggt gagaacagag 8220
tacctacatt ttgaatggaa ggattggagc ggcgcctgat gcggtatttt ctccttacgc 8280
atctgtgcgg tatttcacac cgcatacgtc aaagcaacca tagtacgcgc cctgtagcgg 8340
cgcattaagc gcggcgggtg tggtggttac gcgcagcgtg accgctacac ttgccagcgc 8400
cctagcgccc gctcctttcg ctttcttccc ttcctttctc gccacgttcg ccggctttcc 8460
ccgtcaagct ctaaatcggg ggctcccttt agggttccga tttagtgctt tacggcacct 8520
cgaccccaaa aaacttgatt tgggtgatgg ttcacgtagt gggccatcgc cctgatagac 8580
ggtttttcgc cctttgacgt tggagtccac gttctttaat agtggactct tgttccaaac 8640
tggaacaaca ctcaacccta tctcgggcta ttcttttgat ttataaggga ttttgccgat 8700
ttcggcctat tggttaaaaa atgagctgat ttaacaaaaa tttaacgcga attttaacaa 8760
aatattaacg tttacaattt tatggtgcac tctcagtaca atctgctctg atgccgcata 8820
gttaagccag ccccgacacc cgccaacacc cgctgacgcg ccctgacggg cttgtctgct 8880
cccggcatcc gcttacagac aagctgtgac cgtctccggg agctgcatgt gtcagaggtt 8940
ttcaccgtca tcaccgaaac gcgcgagacg aaagggcctc gtgatacgcc tatttttata 9000
ggttaatgtc atgataataa tggtttctta gacgtcaggt ggcacttttc ggggaaatgt 9060
gcgcggaacc cctatttgtt tatttttcta aatacattca aatatgtatc cgctcatgag 9120
acaataaccc tgataaatgc ttcaataata ttgaaaaagg aagagtatga gtattcaaca 9180
tttccgtgtc gcccttattc ccttttttgc ggcattttgc cttcctgttt ttgctcaccc 9240
agaaacgctg gtgaaagtaa aagatgctga agatcagttg ggtgcacgag tgggttacat 9300
cgaactggat ctcaacagcg gtaagatcct tgagagtttt cgccccgaag aacgttttcc 9360
aatgatgagc acttttaaag ttctgctatg tggcgcggta ttatcccgta ttgacgccgg 9420
gcaagagcaa ctcggtcgcc gcatacacta ttctcagaat gacttggttg agtactcacc 9480
agtcacagaa aagcatctta cggatggcat gacagtaaga gaattatgca gtgctgccat 9540
aaccatgagt gataacactg cggccaactt acttctgaca acgatcggag gaccgaagga 9600
gctaaccgct tttttgcaca acatggggga tcatgtaact cgccttgatc gttgggaacc 9660
ggagctgaat gaagccatac caaacgacga gcgtgacacc acgatgcctg tagcaatggc 9720
aacaacgttg cgcaaactat taactggcga actacttact ctagcttccc ggcaacaatt 9780
aatagactgg atggaggcgg ataaagttgc aggaccactt ctgcgctcgg cccttccggc 9840
tggctggttt attgctgata aatctggagc cggtgagcgt ggaagccgcg gtatcattgc 9900
agcactgggg ccagatggta agccctcccg tatcgtagtt atctacacga cggggagtca 9960
ggcaactatg gatgaacgaa atagacagat cgctgagata ggtgcctcac tgattaagca 10020
ttggtaactg tcagaccaag tttactcata tatactttag attgatttaa aacttcattt 10080
ttaatttaaa aggatctagg tgaagatcct ttttgataat ctcatgacca aaatccctta 10140
acgtgagttt tcgttccact gagcgtcaga ccccgtagaa aagatcaaag gatcttcttg 10200
agatcctttt tttctgcgcg taatctgctg cttgcaaaca aaaaaaccac cgctaccagc 10260
ggtggtttgt ttgccggatc aagagctacc aactcttttt ccgaaggtaa ctggcttcag 10320
cagagcgcag ataccaaata ctgtccttct agtgtagccg tagttaggcc accacttcaa 10380
gaactctgta gcaccgccta catacctcgc tctgctaatc ctgttaccag tggctgctgc 10440
cagtggcgat aagtcgtgtc ttaccgggtt ggactcaaga cgatagttac cggataaggc 10500
gcagcggtcg ggctgaacgg ggggttcgtg cacacagccc agcttggagc gaacgaccta 10560
caccgaactg agatacctac agcgtgagct atgagaaagc gccacgcttc ccgaagggag 10620
aaaggcggac aggtatccgg taagcggcag ggtcggaaca ggagagcgca cgagggagct 10680
tccaggggga aacgcctggt atctttatag tcctgtcggg tttcgccacc tctgacttga 10740
gcgtcgattt ttgtgatgct cgtcaggggg gcggagccta tggaaaaacg ccagcaacgc 10800
ggccttttta cggttcctgg ccttttgctg gccttttgct cacatgt 10847
<210>4
<211>25
<212>DNA
<213> Artificial
<223> primer Dph7-Screen-F
<400>4
cttcctcaca gacagagtca cccag 25
<210>5
<211>22
<212>DNA
<213> Artificial
<223> primer Dph7-Screen-R
<400>5
cgagaagggc ccgagagcct cc 22
<210>6
<211>908
<212>DNA
<213> human
<223> Gene fragment Dph7 screen
<400>6
cttcctcaca gacagagtca cccaggggag cttcctcaca gacagagtca cccaggggag 60
cttcctcaca gacagagtca tccaggggag cttcctcaca gacagagtca cccaggggag 120
cttcctcaca gacagagtca cccaggggag cttcctcaca gacagagtca cccaggggag 180
cttcctcaca gacagagtca cccaggggag cttcctcaca gacagagtca cccaggggag 240
cttcctcaca gacagagtca ccccggggag cttcctcaca gacagtcacc caggggagct 300
tcctcacaga cagtcaccca ggggagcttc ctcacagaca gagtcatcca ggggagcttc 360
ctcacagaca gagtcaccca ggggagcttc ctcacagaca gagtcaccca ggggagcttc 420
ctcacagaca gtcaccccgg ggagcttcct cacagacagt cacccagggg agcttcctca 480
cagacagagt caccccgggg agcttcctca cagacagtca ccccggggag cttcctcaca 540
gacatcaacg gcctaactga gaacactcat ttcctgtcat tagtggtgtt gatgcttctc 600
tttctccaca cagggggcga cgatggcctt ctgaggggct gggacaccag ggtacccggc 660
aaatttctct tcaccagcaa aaggtaactg cccaagggcc agcactcggt gcccacacca 720
gcccccgcgt tccctgggtc accagccctc ccgttccctg ggtgggtctg tgtgctggac 780
actggttcag aagccgcctc tgcttgcaga cacaccatgg gtgtgtgcag catccagagc 840
agccctcatc gggagcacat cctggccacg ggaaggtgag tccccaggag gctctcgggc 900
ccttctcg 908
<210>7
<211>41
<212>DNA
<213> Artificial
<223> primer DTA-F-BamHI
<400>7
accaccggat ccatgggcgc tgatgatgtt gttgattctt c 41
<210>8
<211>34
<212>DNA
<213> Artificial
<223> primer DTA-R (EcoRI)
<400>8
accaccgaat tcttagtggg aattagtcat gccc 34
<210>9
<211>1200
<212>DNA
<213> Corynebacterium diphtheriae
<223> Gene fragment DTA
<400>9
accaccggat ccatgggcgc tgatgatgtt gttgattctt ctaaatcttt tgtgatggaa 60
aacttttctt cgtaccacgg gactaaacct ggttatgtag attccattca aaaaggtata 120
caaaagccaa aatctggtac acaaggaaat tatgacgatg attggaaagg gttttatagt 180
accgacaata aatacgacgc tgcgggatac tctgtagata atgaaaaccc gctctctgga 240
aaagctggag gcgtggtcaa agtgacgtat ccaggactga cgaaggttct cgcactaaaa 300
gtggataatg ccgaaactat taagaaagag ttaggtttaa gtctcactga accgttgatg 360
gagcaagtcg gaacggaaga gtttatcaaa aggttcggtg atggtgcttc gcgtgtagtg 420
ctcagccttc ccttcgctga ggggagttct agcgtttcct atattaataa ctgggaacag 480
gcgaaagcgt taagcgtaga acttgagatt aattttgaaa cccgtggaaa acgtggccaa 540
gatgcgatgt atgagtatat ggctcaagcc tgtgcaggaa atcgtgtcag gcgatcagta 600
ggtagctcat tgtcatgcat aaatcttgat tgggatgtca taagggataa aactaagaca 660
aagatagagt ctttgaaaga gcatggccct atcaaaaata aaatgagcga aagtcccaat 720
aaaacagtat ctgaggaaaa agctaaacaa tacctagaag aatttcatca aacggcatta 780
gagcatcctg aattgtcaga acttaaaacc gttactggga ccaatcctgt attcgctggg 840
gctaactatg cggcgtgggc agtaaacgtt gcgcaagtta tagatctcga aacagctgat 900
aatttggaaa agacaactgc tgctctttcg atacttcctg gtatcggtag cgtaatgggc 960
attgcagacg gtgccgttca ccacaataca gaagagatag tggcacaatc aatagcttta 1020
tcgtctttaa tggttgctca agctattcca ttggtaggag agctagttga tattggtttc 1080
gctgcatata attttgtaga gagtattatc aatttatttc aagtagttca taattcgtat 1140
aatcgtcccg cgtattctcc ggggcataaa acgcaaccat ttctttaaga attcggtggt 1200
<210>10
<211>7185
<212>DNA
<213> Artificial
<223> TR cell line detection vector pMyc-DTA-IRES-GFP
<400>10
ctgcataatg aaagacccca cctgtaggtt tggcaagcta gcttaagtaa cgccattttg 60
caaggcatgg aaaaatacat aactgagaat agaaaagttc agatcaaggt caggaacaga 120
tggaacagct gaatatgggc caaagcggat atctgtggta agcagttcct gccccggctc 180
agggccaaga acagatggaa cagctgaata tgggccaaac aggatatctg tggtaagcag 240
ttcctgcccc ggctcagggc caagaacaga tggtccccag atgcggtcca gccctcagca 300
gtttctagag aaccatcaga tgtttccagg gtgccccaag gacctgaaat gaccctgtgc 360
cttatttgaa ctaaccaatc agttcgcttc tcgcttctgt tcgcgcgctt ctgctccccg 420
agctcaataa aagagcccac aacccctcac tcggggcgcc agtcctccga ttgactgagt 480
cgcccgggta cccgtattcc caataaagcc tcttgctgtt tgcatccgaa tcgtggactc 540
gctgatcctt gggagggtct cctcagattg attgactgcc cacctcgggg gtctttcatt 600
tggaggttcc accgagattt ggagacccca gcccagggac caccgacccc cccgccggga 660
ggtaagctgg ccagcggtcg tttcgtgtct gtctctgtct ttgtgcgtgt ttgtgccggc 720
atctaatgtt tgcgcctgcg tctgtactag ttagctaact agctctgtat ctggcggacc 780
cgtggtggaa ctgacgagtt cggaacaccc ggccgcaacc ctgggagacg tcccagggac 840
ttcgggggcc gtttttgtgg cccgacctga gtccaaaaat cccgatcgtt ttggactctt 900
tggtgcaccc cccttagagg agggatatgt ggttctggta ggagacgaga acctaaaaca 960
gttcccgcct ccgtctgaat ttttgctttc ggtttgggac cgaagccgcg ccgcgcgtct 1020
tgtctgctgc agcatcgttc tgtgttgtct ctgtctgact gtgtttctgt atttgtctga 1080
aaatatgggc ccgggccaga ctgttaccac tcccttaagt ttgaccttag gtcactggaa 1140
agatgtcgag cggatcgctc acaaccagtc ggtagatgtc aagaagagac gttgggttac 1200
cttctgctct gcagaatggc caacctttaa cgtcggatgg ccgcgagacg gcacctttaa 1260
ccgagacctc atcacccagg ttaagatcaa ggtcttttca cctggcccgc atggacaccc 1320
agaccaggtc ccctacatcg tgacctggga agccttggct tttgaccccc ctccctgggt 1380
caagcccttt gtacacccta agcctccgcc tcctcttcct ccatccgccc cgtctctccc 1440
ccttgaacct cctcgttcga ccccgcctcg atcctccctt tatccagccc tcactccttc 1500
tctaggcgcc cccatatggc catatgagat cttatatggg gcacccccgc cccttgtaaa 1560
cttccctgac cctgacatga caagagttac taacagcccc tctctccaag ctcacttaca 1620
ggctctctac ttagtccagc acgaagtctg gagacctctg gcggcagcct accaagaaca 1680
actggaccga ccggtggtac ctcaccctta ccgagtcggc gacacagtgt gggtccgccg 1740
acaccagact aagaacctag aacctcgctg gaaaggacct tacacagtcc tgctgaccac 1800
ccccaccgcc ctcaaagtag acggcatcgc agcttggata cacgccgccc acgtgaaggc 1860
tgccgacccc gggggtggac catcctctag actgccggat ccaccaccgg atccatgggc 1920
gctgatgatg ttgttgattc ttctaaatct tttgtgatgg aaaacttttc ttcgtaccac 1980
gggactaaac ctggttatgt agattccatt caaaaaggta tacaaaagcc aaaatctggt 2040
acacaaggaa attatgacga tgattggaaa gggttttata gtaccgacaa taaatacgac 2100
gctgcgggat actctgtaga taatgaaaac ccgctctctg gaaaagctgg aggcgtggtc 2160
aaagtgacgt atccaggact gacgaaggtt ctcgcactaa aagtggataa tgccgaaact 2220
attaagaaag agttaggttt aagtctcact gaaccgttga tggagcaagt cggaacggaa 2280
gagtttatca aaaggttcgg tgatggtgct tcgcgtgtag tgctcagcct tcccttcgct 2340
gaggggagtt ctagcgtttc ctatattaat aactgggaac aggcgaaagc gttaagcgta 2400
gaacttgaga ttaattttga aacccgtgga aaacgtggcc aagatgcgat gtatgagtat 2460
atggctcaag cctgtgcagg aaatcgtgtc aggcgatcag taggtagctc attgtcatgc 2520
ataaatcttg attgggatgt cataagggat aaaactaaga caaagataga gtctttgaaa 2580
gagcatggcc ctatcaaaaa taaaatgagc gaaagtccca ataaaacagt atctgaggaa 2640
aaagctaaac aatacctaga agaatttcat caaacggcat tagagcatcc tgaattgtca 2700
gaacttaaaa ccgttactgg gaccaatcct gtattcgctg gggctaacta tgcggcgtgg 2760
gcagtaaacg ttgcgcaagt tatagatctc gaaacagctg ataatttgga aaagacaact 2820
gctgctcttt cgatacttcc tggtatcggt agcgtaatgg gcattgcaga cggtgccgtt 2880
caccacaata cagaagagat agtggcacaa tcaatagctt tatcgtcttt aatggttgct 2940
caagctattc cattggtagg agagctagtt gatattggtt tcgctgcata taattttgta 3000
gagagtatta tcaatttatt tcaagtagtt cataattcgt ataatcgtcc cgcgtattct 3060
ccggggcata aaacgcaacc atttctttaa gaattcctgc aggcctcgag gcggccgcta 3120
cgtaaattcc gcccctctcc ctcccccccc cctaacgtta ctggccgaag ccgcttggaa 3180
taaggccggt gtgcgtttgt ctatatgtta ttttccacca tattgccgtc ttttggcaat 3240
gtgagggccc ggaaacctgg ccctgtcttc ttgacgagca ttcctagggg tctttcccct 3300
ctcgccaaag gaatgcaagg tctgttgaat gtcgtgaagg aagcagttcc tctggaagct 3360
tcttgaagac aaacaacgtc tgtagcgacc ctttgcaggc agcggaaccc cccacctggc 3420
gacaggtgcc tctgcggcca aaagccacgt gtataagata cacctgcaaa ggcggcacaa 3480
ccccagtgcc acgttgtgag ttggatagtt gtggaaagag tcaaatggct ctcctcaagc 3540
gtattcaaca aggggctgaa ggatgcccag aaggtacccc attgtatggg atctgatctg 3600
gggcctcggt gcacatgctt tacatgtgtt tagtcgaggt taaaaaacgt ctaggccccc 3660
cgaaccacgg ggacgtggtt ttcctttgaa aaacacgatg ataatatggc cacaaccatg 3720
gtgagcaagg gcgaggagct gttcaccggg gtggtgccca tcctggtcga gctggacggc 3780
gacgtaaacg gccacaagtt cagcgtgtcc ggcgagggcg agggcgatgc cacctacggc 3840
aagctgaccc tgaagttcat ctgcaccacc ggcaagctgc ccgtgccctg gcccaccctc 3900
gtgaccaccc tgacctacgg cgtgcagtgc ttcagccgct accccgacca catgaagcag 3960
cacgacttct tcaagtccgc catgcccgaa ggctacgtcc aggagcgcac catcttcttc 4020
aaggacgacg gcaactacaa gacccgcgcc gaggtgaagt tcgagggcga caccctggtg 4080
aaccgcatcg agctgaaggg catcgacttc aaggaggacg gcaacatcct ggggcacaag 4140
ctggagtaca actacaacag ccacaacgtc tatatcatgg ccgacaagca gaagaacggc 4200
atcaaggtga acttcaagat ccgccacaac atcgaggacg gcagcgtgca gctcgccgac 4260
cactaccagc agaacacccc catcggcgac ggccccgtgc tgctgcccga caaccactac 4320
ctgagcaccc agtccgccct gagcaaagac cccaacgaga agcgcgatca catggtcctg 4380
ctggagttcg tgaccgccgc cgggatcact ctcggcatgg acgagctgta caagtaaagc 4440
ggcccagcca cagtggtcga ccgggccgcc agcacagtgg gggggggccc gcgattagtc 4500
caatttgtta aagacaggat atcagtggtc caggctctag ttttgactca acaatatcac 4560
cagctgaagc ctatagagta cgagccatag atagaataaa agattttatt tagtctccag 4620
aaaaaggggg gaatgaaaga ccccacctgt aggtttggca agctagctta agtaagccat 4680
tttgcaaggc atggaaaaat acataactga gaatagagaa gttcagatca aggttaggaa 4740
cagagagaca ggagaatatg ggccaaacag gatatctgtg gtaagcagtt cctgccccgg 4800
ctcagggcca agaacagttg gaacagcaga atatgggcca aacaggatat ctgtggtaag 4860
cagttcctgc cccggctcag ggccaagaac agatggtccc cagatgcggt cccgccctca 4920
gcagtttcta gagaaccatc agatgtttcc agggtgcccc aaggacctga aatgaccctg 4980
tgccttattt gaactaacca atcagttcgc ttctcgcttc tgttcgcgcg cttctgctcc 5040
ccgagctcaa taaaagagcc cacaacccct cactcggcgc gccagtcctc cgatagactg 5100
cgtcgcccgg gtacccgtgt atccaataaa ccctcttgca gttgcatccg acttgtggtc 5160
tcgctgttcc ttgggagggt ctcctctgag tgattgacta cccgtcagcg ggggtctttc 5220
attctgcatt aatgaatcgg ccaacgcgcg gggagaggcg gtttgcgtat tgggcgctct 5280
tccgcttcct cgctcactga ctcgctgcgc tcggtcgttc ggctgcggcg agcggtatca 5340
gctcactcaa aggcggtaat acggttatcc acagaatcag gggataacgc aggaaagaac 5400
atgtgagcaa aaggccagca aaaggccagg aaccgtaaaa aggccgcgtt gctggcgttt 5460
ttccataggc tccgcccccc tgacgagcat cacaaaaatc gacgctcaag tcagaggtgg 5520
cgaaacccga caggactata aagataccag gcgtttcccc ctggaagctc cctcgtgcgc 5580
tctcctgttc cgaccctgcc gcttaccgga tacctgtccg cctttctccc ttcgggaagc 5640
gtggcgcttt ctcatagctc acgctgtagg tatctcagtt cggtgtaggt cgttcgctcc 5700
aagctgggct gtgtgcacga accccccgtt cagcccgacc gctgcgcctt atccggtaac 5760
tatcgtcttg agtccaaccc ggtaagacac gacttatcgc cactggcagc agccactggt 5820
aacaggatta gcagagcgag gtatgtaggc ggtgctacag agttcttgaa gtggtggcct 5880
aactacggct acactagaag gacagtattt ggtatctgcg ctctgctgaa gccagttacc 5940
ttcggaaaaa gagttggtag ctcttgatcc ggcaaacaaa ccaccgctgg tagcggtggt 6000
ttttttgttt gcaagcagca gattacgcgc agaaaaaaag gatctcaaga agatcctttg 6060
atcttttcta cggggtctga cgctcagtgg aacgaaaact cacgttaagg gattttggtc 6120
atgagattat caaaaaggat cttcacctag atccttttgc ggccggccgc aaatcaatct 6180
aaagtatata tgagtaaact tggtctgaca gttaccaatg cttaatcagt gaggcaccta 6240
tctcagcgat ctgtctattt cgttcatcca tagttgcctg actccccgtc gtgtagataa 6300
ctacgatacg ggagggctta ccatctggcc ccagtgctgc aatgataccg cgagacccac 6360
gctcaccggc tccagattta tcagcaataa accagccagc cggaagggcc gagcgcagaa 6420
gtggtcctgc aactttatcc gcctccatcc agtctattaa ttgttgccgg gaagctagag 6480
taagtagttc gccagttaat agtttgcgca acgttgttgc cattgctaca ggcatcgtgg 6540
tgtcacgctc gtcgtttggt atggcttcat tcagctccgg ttcccaacga tcaaggcgag 6600
ttacatgatc ccccatgttg tgcaaaaaag cggttagctc cttcggtcct ccgatcgttg 6660
tcagaagtaa gttggccgca gtgttatcac tcatggttat ggcagcactg cataattctc 6720
ttactgtcat gccatccgta agatgctttt ctgtgactgg tgagtactca accaagtcat 6780
tctgagaata gtgtatgcgg cgaccgagtt gctcttgccc ggcgtcaaca cgggataata 6840
ccgcgccaca tagcagaact ttaaaagtgc tcatcattgg aaaacgttct tcggggcgaa 6900
aactctcaag gatcttaccg ctgttgagat ccagttcgat gtaacccact cgtgcaccca 6960
actgatcttc agcatctttt actttcacca gcgtttctgg gtgagcaaaa acaggaaggc 7020
aaaatgccgc aaaaaaggga ataagggcga cacggaaatg ttgaatactc atactcttcc 7080
tttttcaata ttattgaagc atttatcagg gttattgtct catgagcgga tacatatttg 7140
aatgtattta gaaaaataaa caaatagggg ttccgcgcac atttc 7185
Claims (9)
1. The construction method of the drug toxicity tolerance production cell strain for producing the protein drug conjugate is characterized by comprising the following steps:
s1, constructing a recombinant protein production vector, wherein the vector comprises Cas9 and a gRNA sequence targeting any Dph of Dph 1-7;
s2, transfecting the production vector into cells to construct a drug toxicity tolerance production cell strain;
and S3, detecting the constructed drug toxicity tolerance production cell strain.
2. The method for constructing a drug toxicity resistant producer cell line for producing a protein-drug conjugate according to claim 1, wherein the recombinant protein production vector further comprises a GFP sequence.
3. The method for constructing a drug toxicity tolerance-producing cell line for producing a protein-drug conjugate according to claim 1, wherein the recombinant protein production vector is pX260a-GFP-Dph7, and the sequence thereof is shown in SEQ ID NO. 3.
4. The method for constructing a drug toxicity-resistant producer cell line for producing protein-drug conjugates as claimed in claim 3, wherein the recombinant protein production vector pX260a-GFP-Dph7 is constructed by the following steps:
(1) a forward primer with a sequence shown as SEQ ID NO.1 and a reverse primer with a sequence shown as SEQ ID NO.2 are combined to form a targeted gRNA of Dph 7;
(2) the synthesized Dph7 targeted gRNA is cloned to a vector pX260a-GFP by utilizing a restriction enzyme site BbsI to obtain a gene modification vector pX260a-GFP-Dph7 shown as SEQ ID No. 3.
5. The method for constructing a drug toxicity-resistant producer cell line for producing a protein-drug conjugate according to claim 1, wherein the construction of the drug toxicity-resistant producer cell line in step S2 specifically comprises the following steps:
(1) culturing the cells;
(2) transfecting the production vector obtained in the step S1 into cells;
(3) the transfected cells were screened.
6. The method for constructing a drug toxicity tolerant producer cell line for protein-drug conjugates as claimed in claim 5, wherein the cell is prokaryotic or eukaryotic, including but not limited to FreeStyle 293-F.
7. The method for constructing a drug toxicity-resistant producer cell line for producing protein-drug conjugates according to claim 1, wherein the step S3 comprises the following steps:
(1) constructing a detection vector containing diphtheria toxin DTA and GFP showing infection efficiency;
(2) transfecting a drug toxicity-tolerant producer cell line;
(3) GFP expression, i.e. DTA expression, was detected using flow cytometry.
8. The method for constructing a drug toxicity tolerance production cell line for producing a protein-drug conjugate according to claim 7, wherein the detection vector is pMyc-DTA-IRES-GFP, and the sequence thereof is shown in SEQ ID.10.
9. The use of the method of any one of claims 1-8 for constructing a drug toxicity tolerant producer cell line for producing protein drug conjugates in the development and production of protein drug conjugates.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202010410275.8A CN111549071A (en) | 2020-05-15 | 2020-05-15 | Construction method and application of drug toxicity tolerance production cell strain for producing protein drug conjugate |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202010410275.8A CN111549071A (en) | 2020-05-15 | 2020-05-15 | Construction method and application of drug toxicity tolerance production cell strain for producing protein drug conjugate |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN111549071A true CN111549071A (en) | 2020-08-18 |
Family
ID=72002782
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202010410275.8A Pending CN111549071A (en) | 2020-05-15 | 2020-05-15 | Construction method and application of drug toxicity tolerance production cell strain for producing protein drug conjugate |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN111549071A (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN114410680A (en) * | 2022-01-25 | 2022-04-29 | 乾元康安(苏州)生物科技有限公司 | Application of DPH6 gene in preparation of cell line with toxin resistance |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2001013958A2 (en) * | 1999-08-26 | 2001-03-01 | Sydney Brenner | Drug conjugates and methods of designing the same |
| CN102399292A (en) * | 2011-09-14 | 2012-04-04 | 盛剑鹏 | Recombinant stem cell factor-immunoglobulin (rSCF-Ig) fusion protein and preparation thereof |
| CN111088280A (en) * | 2019-12-31 | 2020-05-01 | 浙江大学医学院附属第一医院 | Construction method and application of targeting vector and transgenic mouse for regulating and eliminating monocyte-derived dendritic cells by diphtheria toxin |
-
2020
- 2020-05-15 CN CN202010410275.8A patent/CN111549071A/en active Pending
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2001013958A2 (en) * | 1999-08-26 | 2001-03-01 | Sydney Brenner | Drug conjugates and methods of designing the same |
| CN102399292A (en) * | 2011-09-14 | 2012-04-04 | 盛剑鹏 | Recombinant stem cell factor-immunoglobulin (rSCF-Ig) fusion protein and preparation thereof |
| CN111088280A (en) * | 2019-12-31 | 2020-05-01 | 浙江大学医学院附属第一医院 | Construction method and application of targeting vector and transgenic mouse for regulating and eliminating monocyte-derived dendritic cells by diphtheria toxin |
Non-Patent Citations (3)
| Title |
|---|
| DIEGO S. D’ASTOLFO等: "Effcient Intracellular Delivery of Native Protein", 《CELL》 * |
| HONG-XIA WANG等: "CRISPR/Cas9-Based Genome Editing for Disease Modeling and Therapy：Challenges and Opportunities for Nonviral Delivery", 《CHEMICAL REVIEWS》 * |
| MARGARET J. LANGE等: "Diphtheria Toxin A-Resistant Cell Lines Enable Robust Production and Evaluation of DTA-Encoding Lentiviruses", 《SCIENTIFIC REPORTS》 * |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN114410680A (en) * | 2022-01-25 | 2022-04-29 | 乾元康安(苏州)生物科技有限公司 | Application of DPH6 gene in preparation of cell line with toxin resistance |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Heermann et al. | Immunogenicity of the gene S and Pre-S domains in hepatitis B virions and HBsAg filaments | |
| US4599230A (en) | Synthetic hepatitis B virus vaccine including both T cell and B cell determinants | |
| Dreesman et al. | Antibody to hepatitis B surface antigen after a single inoculation of uncoupled synthetic HBsAg peptides | |
| US4599231A (en) | Synthetic hepatitis B virus vaccine including both T cell and B cell determinants | |
| US5565548A (en) | Pre-S gene coded peptide hepatitis B immunogens and synthetic lipid vesicle carriers | |
| CA1250100A (en) | Pre-s gene coded peptide hepatitis b immunogens, vaccines, diagnostics, and synthetic lipid vesicle carriers | |
| EP0155146B1 (en) | Synthetic hepatitis b virus vaccine including both t cell and b cell determinants | |
| EP0198474B1 (en) | Hepatitis B surface antigen formed by recombinant DNA techniques, vaccines, diagnostics, cell lines and methods of forming same | |
| KR100788812B1 (en) | Novel hcv non-structural polypeptide | |
| CA1333358C (en) | Immunogens containing peptides with an attached hydrophobic tail for adsorption to hepatitis b virus surface antigen | |
| CN111549071A (en) | Construction method and application of drug toxicity tolerance production cell strain for producing protein drug conjugate | |
| JP2023051923A (en) | Tumor-targeting bead vectors and use methods thereof | |
| KR20150133753A (en) | Microvesicle, and manufacturing method for same | |
| EP0402088A2 (en) | Conjugate immunogen for aids | |
| US8501193B1 (en) | Stabilized Tat antigen and the use thereof for anti-HIV vaccination | |
| EP0469281B1 (en) | Amino acid residue sequence of hepatitis b core antigen | |
| CN111617261B (en) | CD 45-targeted antibody drug conjugate and preparation and application thereof | |
| JPH089636B2 (en) | HTLV-III / LAV virus-related peptide | |
| CN110305219A (en) | One kind preparing the purposes in cell drug comprising the T cell of Chimeric antigen receptor (CAR) modification | |
| CN111549001A (en) | Hybridoma cell strain secreting African swine fever virus p34 protein monoclonal antibody, monoclonal antibody and application | |
| CN110582295A (en) | Multiple malaria pre-erythroid antigens and their use to elicit a protective immune response in a host | |
| CN113072648B (en) | Liver cancer vaccine targeting AFP | |
| AU751646B2 (en) | Hepatitis B virus polypeptides | |
| KR20220145736A (en) | Administration and Dosage of vaccine for preventing coronavirus infection | |
| KR100258238B1 (en) | Process for purifying khcv e2c protein |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination |