CN111549008B

CN111549008B - Amine transaminase AcATA mutant and application thereof in preparation of sitagliptin intermediate

Info

Publication number: CN111549008B
Application number: CN202010275136.9A
Authority: CN
Inventors: 柳志强; 程峰; 李明友; 张晓健; 贾东旭; 郑裕国; 何人宝; 金逸中; 林娇华
Original assignee: Zhejiang Yongtai Pharmaceutical Co ltd; ZHEJIANG YONGTAI TECHNOLOGY CO LTD; Zhejiang University of Technology ZJUT
Current assignee: Zhejiang Yongtai Pharmaceutical Co ltd; ZHEJIANG YONGTAI TECHNOLOGY CO LTD; Zhejiang University of Technology ZJUT
Priority date: 2020-04-09
Filing date: 2020-04-09
Publication date: 2021-07-23
Anticipated expiration: 2040-04-09
Also published as: CN111549008A

Abstract

The invention discloses an amine transaminase AcATA mutant and application thereof in preparation of a sitagliptin intermediate, wherein the amine transaminase AcATA mutant is obtained by performing single mutation on the 122 th site of an amino acid sequence shown in SEQ ID No. 2; wherein the methionine at position 122 is mutated to histidine, valine or phenylalanine. According to the invention, sites which may influence the catalytic activity of the amino transaminase AcATA are obtained by methods such as molecular docking, homologous modeling and the like, and site-directed mutagenesis is carried out, so that the finally obtained amino transaminase AcATA mutant has high enzyme activity which is higher than 460U/g and is more than 4 times of that of a wild type; and the sitagliptin intermediate (R) -3-amino-1-piperidine-4- (2,4,5-trifluorophenyl) -1-butanone can be synthesized by efficiently catalyzing sitagliptin intermediate precursor ketone 1-piperidine-4- (2,4,5-trifluorophenyl) -1, 3-dibutyrrone, and the conversion rate is up to 90% in 24 h.

Description

Amine transaminase AcATA mutant and application thereof in preparation of sitagliptin intermediate

Technical Field

The invention relates to the technical field of biochemical engineering, in particular to an amine transaminase AcATA mutant and application thereof in preparation of a sitagliptin intermediate.

Background

Sitagliptin Phosphate (Sitagliptin Phosphate) was developed and developed by Merck and Codexis, usa, and was the first dipeptidyl peptidase-4 (DPP-4) inhibitor to obtain FDA approval for the treatment of type ii diabetes (2016, 10 months). The sitagliptin phosphate is an active ingredient of oral medicine, namely, sitagliptin hydrochloride tablets (JANUVIA), for treating the type II diabetes, and achieves the aim of treatment by mainly inhibiting the degradation of glucagon-like peptide-1 (GLP-1) and glucose-dependent insulin-releasing peptide (GIP) by DPP-4, slightly increasing the content of GLP-1 and weakening the antagonistic action of GLP-1 metabolites. The sitagliptin hydrochloride can effectively exert the hypoglycemic effect and simultaneously can not cause the side effects of nausea, vomiting and the like caused by overhigh GLP-1 content. Meanwhile, GIP can promote insulin secretion and has blood sugar dependence, so that the incidence rate of hypoglycemic side effects caused by oral hypoglycemic drugs can be greatly reduced. The composition has obvious blood sugar reducing effect when being used singly or used together with metformin and pioglitazone, and has the advantages of safe taking, good tolerance and few adverse reactions.

The preparation of the optically pure sitagliptin and the intermediate thereof mainly comprises a chemical synthesis method and a biological enzyme method.

The chemical synthesis method of sitagliptin mainly comprises the following 4 routes:

the first route is the first generation of sitagliptin synthesis published by Kim D, Wang L, Beconi M, Eiermann GJ, Fisher MH, He H, et al, ((2R) -4-Oxo-4- [3- (trifluoromethylphenyl) -5, 6-dihydo [1,2,4] triazolo [4,3-a ] pyrazin-7(8H) -yl ] -1- (2,4, 5-triflorophynyl) butan-2-amine A patent, organic Active Dipeptidyl Peptidase IV Inhibitor for the Treatment of Type 2 diabetes of journal of Medicinal chemistry 2005; 48(1) 141-51) which induces chiral isopropyl-2, 5-dimethoxy-3, 6-dimethoxy-2-pyrazine, then diazotization reaction is carried out to generate beta-amino acid to construct a chiral center.

The second route is a Process published by Hansen K B (First Generation Process for the Preparation of the DPP-IV Inhibitor Sitagliptin [ J ]. org. Process Res. dev,2005,9(5):634-639), chiral ruthenium phosphide is used as a catalyst to asymmetrically hydrogenate beta-keto ester to construct chiral secondary alcohol, and the chiral secondary alcohol is converted into chiral secondary amine.

The third route is a third generation synthetic method of American Moshadong company, and the method takes (S) -phenylglycinamide as a chiral auxiliary agent to induce hydrogenation to generate chiral amine.

The fourth route is the latest generation chemical synthesis of sitagliptin published by the company mosahto in patents WO2004085378 and WO 2005020920. The method is a main method for chemically synthesizing sitagliptin industrially at present.

US6699871 discloses a chemical synthesis method of sitagliptin intermediate, which adopts chiral source to induce chiral alpha-amino acid, and then generates beta-amino acid through diazotization reaction to construct the required chiral center. The raw material cost required by the route is relatively high, the reaction is troublesome, and the technical process and the product quality are difficult to control in the industrialization process.

The merck company patent W02005003135 discloses a synthesis of chiral amines by catalytic hydrogenation induced by S-phenylglycinamide. The route needs two times of catalytic hydrogenation, the platinum catalyst used in the first time is expensive, a large amount of Pd (OH)2-C catalyst is needed in the second deprotection, the cost is high, the ee value is 96%, and further recrystallization is needed.

Zhejiang Haixiang pharmaceutical industry patent application document CN102838511A discloses a production method of sitagliptin intermediate, which adopts Grignard reagent to carry out nucleophilic substitution on chiral epichlorohydrin, and then carries out substitution hydrolysis by cyanide to synthesize beta-hydroxy acid, wherein the total yield of the method is only 40%, and the application is limited by adopting virulent cyanide.

Patent document CN105018440B of Nanjing Boyou kang remote biomedical science and technology Co., Ltd discloses the conversion of 3-carbonyl-4- (2,4,5-trifluorophenyl) -methyl butyrate into (R) -3-amino-4- (2,4,5-trifluorophenyl) -methyl butyrate by utilizing a mutant of mycobacterium transaminase, and the final product sitagliptin is obtained by removing the protecting group with the yield of 87%.

Although chemical synthesis is widely applied to industrial production of sitagliptin intermediates, the method still has the defects of multiple process steps, expensive price of required synthetic reagents, high cost investment, certain toxic action of partial reagents on the environment and human bodies, incapability of meeting the current green and environment-friendly requirements and the like.

In recent years, the biological enzyme method has the advantages of high selectivity and environmental optimization, and gradually becomes a preferred scheme for synthesizing chiral medicinal chemicals and intermediates thereof. Omega-transaminases (e.g., the amine transaminases therein) are key enzymes in the production of sitagliptin intermediates. Many omega-aminotransferase genes have been cloned, and some of them have been expressed in different hosts (colibacillus, pichia pastoris, etc.), and genetic engineering bacteria with high enzyme activity and selectivity have been obtained.

Nevertheless, few natural ω -transaminases have been reported for R-type selective transamination, and the substrates catalyzed by these ω -transaminases have a narrow spectrum and are often the most suitable biocatalysts to be screened for a particular reaction, thus greatly limiting their range of applications. With the development of directed evolution technology, protein engineering is increasingly used for modifying substrate specificity of enzyme, screening novel transaminase with wider substrate spectrum, researching chiral drugs and intermediates thereof which can be efficiently and selectively catalyzed, widening the application range, improving the application potential and laying a foundation for realizing industrial production.

Disclosure of Invention

The invention provides an amine transaminase AcATA mutant and application thereof in preparation of a sitagliptin intermediate, in particular application in preparation of a sitagliptin intermediate 1-piperidine-4- (2,4,5-trifluorophenyl) -1, 3-dibutyrrone, wherein the mutant not only has high enzyme activity, but also can efficiently catalyze a sitagliptin intermediate precursor ketone 1-piperidine-4- (2,4,5-trifluorophenyl) -1, 3-dibutyrrone to synthesize a sitagliptin intermediate (R) -3-amino-1-piperidine-4- (2,4,5-trifluorophenyl) -1-butanone, and the conversion rate is as high as 90%.

The specific technical scheme is as follows:

an amine transaminase AcATA mutant which is obtained by performing single mutation on the 122 th position of an amino acid sequence shown in SEQ ID No. 2; wherein the methionine at position 122 is mutated to histidine, valine or phenylalanine.

The amino acid sequence shown in SEQ ID No.2 is the amino acid sequence of amine transaminase AcATA from Arthrobacter calmette guensis (Arthrobacter cumminsii), and the nucleotide sequence is shown in SEQ ID No. 1.

According to the invention, the docking result with the lowest energy is selected through modes of homologous modeling, substrate docking and the like, so that a site influencing the catalytic activity of the modified enzyme is found, and the mutant with high enzyme activity is obtained through single mutation.

The invention also provides a coding gene of the amine transaminase AcATA mutant.

The amino transaminase AcATA mutant is obtained by mutating methionine (codon ATG) at position 122 of the amino acid sequence shown in SEQ ID No.2 into histidine (codon CAT), valine (codon GTG) or phenylalanine (codon TTT), respectively. Wherein, the optimal mutant is mutant M122H, the nucleotide sequence is shown as SEQ ID No.23, the amino acid sequence is shown as SEQ ID No.24, the enzyme activity is up to 610U/g, and the conversion rate is 90%.

The invention also provides a recombinant vector containing the coding gene.

The invention also provides a genetic engineering bacterium containing the coding gene.

The invention also provides application of the amine transaminase AcATA mutant in biocatalysis of sitagliptin intermediate precursor ketone 1-piperidine-4- (2,4,5-trifluorophenyl) -1, 3-dibutyrrone to synthesis of sitagliptin intermediate (R) -3-amino-1-piperidine-4- (2,4,5-trifluorophenyl) -1-butanone.

The invention also provides application of the genetic engineering bacteria in catalyzing sitagliptin intermediate precursor ketone 1-piperidine-4- (2,4,5-trifluorophenyl) -1, 3-dibutyrrone to synthesize sitagliptin intermediate (R) -3-amino-1-piperidine-4- (2,4,5-trifluorophenyl) -1-butanone.

The invention also provides a method for synthesizing a sitagliptin intermediate (R) -3-amino-1-piperidine-4- (2,4,5-trifluorophenyl) -1-butanone by biocatalyzing a sitagliptin intermediate precursor ketone 1-piperidine-4- (2,4,5-trifluorophenyl) -1, 3-dibutbutanone, which comprises the following steps: taking 1-piperidine-4- (2,4,5-trifluorophenyl) -1, 3-dibutyrone as a substrate, the amine transaminase AcATA mutant or the genetically engineered bacterium as a biocatalyst, isopropylamine as an amino donor, pyridoxal phosphate as a coenzyme, and carrying out a biocatalytic synthesis reaction in a buffer solution to obtain the (R) -3-amino-1-piperidine-4- (2,4,5-trifluorophenyl) -1-butanone.

Further, in the reaction system, the reaction temperature is 45-50 ℃, the stirring speed is 500-600rpm, and the reaction time is 12-36 h; the molar ratio of the substrate to the amino donor is 1: 7-12; the molar ratio of the substrate to the biocatalyst is 1: 1-3.

Further, based on the total volume of buffer solution in the reaction system, the final concentration of the substrate is 2-100g/L, the final concentration of the amino donor is 25-95g/L, the final concentration of the coenzyme is 0.3-0.5g/L, and the addition amount of the biocatalyst is 10-50 g/L.

Furthermore, the reaction system also comprises a cosolvent of the substrate; the cosolvent is dimethyl sulfoxide or methyl tert-butyl ether; carrying out biocatalysis reaction at the temperature of 45-50 ℃ and the stirring speed of 500-; in the reaction system, the final concentration of wet thalli of the genetic engineering bacteria is 25g/L, the final concentration of a substrate is 25g/L or 10g/L, the final volume concentration of dimethyl sulfoxide or methyl tert-butyl ether is 20%, pyridoxal phosphate is 0.5g/L, and isopropylamine is 80 g/L.

Compared with the prior art, the invention has the following beneficial effects:

(1) according to the invention, sites which may influence the catalytic activity of the amino transaminase AcATA are obtained by methods such as molecular docking, homologous modeling and the like, and site-directed mutagenesis is carried out, so that the finally obtained amino transaminase AcATA mutant has high enzyme activity which is higher than 460U/g and is more than 4 times of that of a wild type; and the sitagliptin intermediate (R) -3-amino-1-piperidine-4- (2,4,5-trifluorophenyl) -1-butanone can be synthesized by efficiently catalyzing sitagliptin intermediate precursor ketone 1-piperidine-4- (2,4,5-trifluorophenyl) -1, 3-dibutyrrone, and the conversion rate is up to 90% in 24 h.

(2) The enzyme activity of the amine transaminase AcATA mutant M122H obtained by the invention reaches 610U/g, which is 5.5 times of that of the wild type; M122H can efficiently catalyze sitagliptin intermediate precursor ketone 1-piperidine-4- (2,4,5-trifluorophenyl) -1, 3-dibutyrrone to synthesize sitagliptin intermediate (R) -3-amino-1-piperidine-4- (2,4,5-trifluorophenyl) -1-butanone, and the conversion rate of the mutant M122H in 24 hours of reaction is as high as 90% (50g/L substrate); compared with the wild type, M122H not only shortens the reaction time by half, but also greatly improves the overall conversion rate, and the result is the highest level in the currently known reports.

Drawings

FIG. 1 is a diagram showing the effect of a wild-type homology model after docking with a substrate by Autodock software;

wherein A is a docking model diagram of an enzyme-PLP complex and a substrate; b is a key site map obtained by the docking result.

FIG. 2 is a SDS-PAGE pattern after purification of the amine transaminase AcATA in example 5;

wherein, lane 1 is protein molecular weight Marker, and lane 2 is purified amine transaminase AcATA.

Detailed Description

The present invention will be further described with reference to the following specific examples, which are only illustrative of the present invention, but the scope of the present invention is not limited thereto.

Example 1: homology modeling and substrate docking of wild-type sequences

The crystal structure of AcATA (PDB-ID:3WWJ) is taken as a template, SWISS-MODEL is adopted for homologous modeling, a proprietary algorithm based on secondary structure element comparison is used for superposing the AcATA MODEL structure on the wild MODEL structure, and the optimization is carried out through FoldX software. The optimized homologous model is docked with a substrate through Autodock software, and the docking result with the lowest energy is selected for key site analysis (figure 1).

Example 2: alanine scanning mutation and recombinant escherichia coli cell culture

All amino acid positions obtained after substrate docking in example 1 were subjected to alanine scanning using QuikChange site-directed mutagenesis kit and Phanta Max super fidelity DNA polymerase (Vazyme, nanjing, china).

Part of primers are as follows:

primer 1: m122 Pr GAGCTGTCGTGAAGCGGTAACTGTTACCAC

M122 Pf GATGGTAACAGTTACCGCCGCTTCACGCAGCTC

Primer 2: g224 Pr CTGGCGGAAGGTCCGGCTTTCAACGTAGTAGTG

G224 Pf CACTACTACGTTGAAAGCCGGACCTTCCGCCAG

Primer 3: w192 Pr GTGAAAAACTTCCAGGCGGGTGATCTGATTCGT

W192 Pf ACGAATCAGATCACCCGCCTGGAAGTTTTTCAC

Primer 4: t126 Pr GCGATGGTAACTGTTGCCATCATCGTGTTAC

T126 Pf GTAACCACGAGTGATGGCAACAGTTACCATCGC

Primer 5: s150 Pr CCTCAGGTGTACATGGCTGCATGCGTACCGTACCCAG

S150 Pf CTGGTACGGACATGCAGCCATGTACACCTGAGG

Primer 6: f60 Pr ATCTTCGACCAGGGCGCTTATACTTCCGATGCG

F60 Pf CGCATCGGAAGTATAAGCGCCCTGGTCGAAGAT

Primer 7: f190 Pr CCGCAAGTGAAACGCCCAGTGGGTGATCTG

F190 Pf CAGATCACCCCACTGGGCGTTTTTCACTTGCGG

All primers were designed by the BioXM online service.

PCR reaction system (total volume 50. mu.L): 2X Phanta Max Buffer (Mg 2+) 25. mu.L, 10mM dNTP mix (2.5 mM each of dATP, dCTP, dGTP and dTTP) 1. mu.L, forward primer 1. mu.L, reverse primer 1. mu.L, template DNA 1. mu.L, Phanta Max Super-Fidelity DNA Polymerase 1. mu.L, and nucleic acid-free water was added to 50. mu.L.

And (3) PCR reaction conditions: pre-denaturation at 95 deg.C for 5min, denaturation at 95 deg.C for 20s, annealing at 65 deg.C for 20s, extension at 72 deg.C for 5.5min for 30 cycles, and final extension at 72 deg.C for 10 min.

Transferring 5 mu L of PCR product into competent cells of escherichia coli BL21(DE3), performing heat shock for 90 seconds under the condition of 42 ℃ of transformation, quickly placing on ice for cooling for 2 minutes, adding 600 mu L of LB liquid culture medium into a tube, culturing for 60 minutes at 37 ℃ and 200r/min, centrifuging for 1 minute at 12000rpm, discarding 600 mu L of supernatant, fully mixing the remaining 100 mu L of bacterial liquid, spreading the mixture on an ampicillin LB resistant plate, and performing inverted culture for 12 hours at 37 ℃ after the bacterial liquid is completely absorbed by the culture medium.

3-6 monoclonals are picked on an LB resistant plate containing 50 mu g/ml ampicillin, sent to Hangzhou Ongke sequencing company for sequence detection, and the sequencing result is analyzed by software, and the result shows that: the length of the nucleotide sequence amplified by the primers is 1008bp, and the sequence codes a complete open reading frame.

Example 3: inducible expression of the amine transaminase AcATA

The omega-transaminase mutant containing the complete open reading frame is cultured in the mode of obtaining wet thalli in the example 2, and the obtained wet thalli can be directly used as a biocatalyst for subsequent enzyme activity determination or protein purification.

The preparation method of the wet thallus (namely, the genetic engineering bacteria) comprises the following steps: inoculating recombinant Escherichia coli containing omega-transaminase mutant encoding gene into LB liquid culture medium containing 50 ug/ml ampicillin, culturing at 37 deg.C and 200rpm for 8-10 hr to obtain seed solution; inoculating the seed solution into fresh LB liquid culture medium containing 50. mu.g/ml ampicillin resistance at a volume concentration of 1-2%, and culturing at 37 deg.C and 150rpm until the bacterial body OD₆₀₀Up to 0.6-0.8, addAdding IPTG with final concentration of 0.1mM, performing induction culture at 28 deg.C for 12h, centrifuging at 4 deg.C and 8000rpm for 10min, discarding supernatant, and collecting wet thallus; the LB medium composition: 10g/L of tryptone, 5g/L of yeast powder, 10g/L of NaCl and distilled water as a solvent, and the pH value is natural.

Example 4: enzyme activity determination of amine transaminase AcATA

After obtaining escherichia coli containing protein, carrying out biotransformation and screening on sitagliptin intermediate precursor ketone with the final concentration of 25g/L, wherein the final concentration composition and the catalytic conditions of a catalytic system (10ml) are as follows: 15g/L of triethanolamine, 8.5-9.0 pH buffer solution of triethanolamine, 25g/L of substrate sitagliptin intermediate precursor ketone 1-piperidine-4- (2,4,5-trifluorophenyl) -1, 3-dibutbutanone, 50% (v/v) of DMSO final concentration, 0.5g/L of pyridoxal phosphate and 40g/L of isopropylamine.

Reaction conditions are as follows: the temperature is 50 ℃, the stirring speed is 600r/min, and the reaction time is 2 h. Under the same conditions, the reaction solution containing non-mutated wet cells was used as a blank. After the reaction, a sample was taken and subjected to HPLC (high performance liquid chromatography) detection.

The HPLC detection conditions are as follows: mobile phase A: 10mM ammonium acetate; mobile phase B: pure acetonitrile; according to the mobile phase A: mobile phase B1: 1; flow rate: 1 ml/min; detection wavelength: 205 nm. The enzyme activities of the alanine scanning partial mutant are shown in the following table:

mutants	Enzyme activity (U/mg)
		Wild type	110
M122A	440
		G224A	20
W192A	80
		T126A	60
S150A	115
		F60A	60
F190A	70

Example 5: separation and purification of amine transaminase AcATA

After the wet cell obtained in example 3 was resuspended in triethanolamine-conjugated buffer (0.015g/mL, pH 9.0), sonicated (70% power disruption for 15min under ice bath conditions, working 1s pause for 1s), centrifuged at 8000rpm for 10min, the supernatant was incubated with Ni affinity chromatography resin equilibrated with the above conjugated solution, washed with washing buffer (50mM, pH8.0 sodium phosphate buffer containing 300mM NaCl, 50mM imidazole) until substantially free of contaminating proteins, followed by elution with elution buffer (50mM, pH8.0 sodium phosphate buffer containing 300mM NaCl, 500mM imidazole) and collection of the target protein, and after electrophoretic identification of purity (fig. 2), the target protein was combined and dialyzed with dialysis buffer (0.015g/mL, pH 9.0 ethanolamine buffer) for 10h (dialysis bag molecular cut-off 14 KDa).

The protein content was 2.2mg/mL as determined by Coomassie Brilliant blue method, the enzyme solution was diluted to a final concentration of 0.5mg/mL with 50mM, pH 9.0 sodium phosphate buffer and dispensed, frozen at-80 ℃.

Example 6: construction of amine transaminase AcATA mutant and enzyme activity determination

According to the 122 sites with the highest enzyme activity obtained by alanine scanning results, a rapid PCR technology is utilized, a recombinant vector pETDuet-AcATA is taken as a template, single mutation is introduced, and a primer is as follows:

primer 1: M122H Pr GAGCTGTGAAGCGCATGTAACTGTTACCATC

M122H Pf GATGGTAACAGTTACATGCGCTTCACGCAGCTC

Primer 2: M122V Pr GAGCTGTGAAGCGGTGGTAACTGTTACCATC

M122V Pf GATGGTAACAGTTACCACCGCTTCACGCAGCTC

Primer 3: M122F Pr GAGCTGTCGTGAAGCGTTTGTTACCATC

M122F Pf GATGGTAACAGTTACAAACGCTTCACGCAGCTC

The enzyme activity of each mutation point was measured by the method of example 4: some of the superior mutant enzymes were as shown in the following table:

	final substrate concentration	Enzyme activity (U/g)
			Wild type	25g/L	110
Mutant M122H	25g/L	610
			Mutant M122V	25g/L	505
Mutant M122F	25g/L	460

The mutants are respectively prepared by the following steps of: 2 into histidine, valine or phenylalanine.

Example 7: application of wild type amine transaminase AcATA in preparation of sitagliptin intermediate (R) -3-amino-1-piperidine-4- (2,4,5-trifluorophenyl) -1-butanone

The sitagliptin intermediate (R) -3-amino-1-piperidine-4- (2,4,5-trifluorophenyl) -1-butanone is synthesized by a biocatalytic reaction by using the recombinant Escherichia coli BL21/pETDuet-AcATA wet bacteria containing the expression recombinant plasmid obtained in the example 3 or the pure enzyme obtained by the method in the example 5 as a biocatalyst and using sitagliptin intermediate precursor ketone [ 1-piperidine-4- (2,4,5-trifluorophenyl) -1, 3-dibutyryl ketone ] as a substrate, wherein the formula is shown in (1).

The final concentration composition of the catalytic system (100ml) and the catalytic conditions were as follows: 0.75g of wet thallus, a triethanolamine buffer solution with the pH value of 8-8.5, 50g/L of sitagliptin precursor ketone serving as a substrate, 20% (v/v) of DMSO final concentration, 2mmol/L of pyridoxal phosphate and 80g/L of isopropylamine.

Reaction conditions are as follows: the temperature is 45 ℃, the stirring speed is 300r/min, and the reaction time is 48 h. Under the same conditions, the reaction solution added with sterile bodies is used as a blank control, and the recombinant Escherichia coli BL21/pETDuet-AcATA is replaced by the wet thalli of Escherichia coli BL21/pETDuet to be used as a negative control.

After the reaction, a sample was taken and subjected to HPLC analysis (conditions were the same as in example 1), and the conversion of the substrate in the reaction system for 48 hours was 50%, ee > 99%.

Example 8: application of amine transaminase AcATA mutant in preparation of sitagliptin intermediate (R) -3-amino-1-piperidine-4- (2,4,5-trifluorophenyl) -1-butanone

The transaminase mutant with the highest enzyme activity obtained by the method of example 1 was designated as mutant 1. Recombinant escherichia coli BL21/pETDuet-AcATA wet bacteria obtained after induction expression of mutant 1 or AcATA pure enzyme obtained by the method of example 5 is used as a biocatalyst, sitagliptin intermediate precursor ketone [ 1-piperidine-4- (2,4,5-trifluorophenyl) -1, 3-dibutyrrone ] is used as a substrate, and the sitagliptin intermediate (R) -3-amino-1-piperidine-4- (2,4,5-trifluorophenyl) -1-butanone is synthesized through a biocatalytic reaction.

The final concentration composition of the catalytic system (100ml) and the catalytic conditions were as follows: 5g of wet thallus, triethanolamine buffer solution with the pH value of 8-8.5, 5g (50g/L) of sitagliptin precursor ketone serving as a substrate, 20% (v/v) of DMSO final concentration, 2mmol/L of pyridoxal phosphate and 80g/L of isopropylamine. Reaction conditions are as follows: the temperature is 50 ℃, the stirring speed is 300r/min, and the reaction time is 24 h. Under the same conditions, the reaction solution added with sterile bodies is used as a blank control, and the recombinant Escherichia coli BL21/pETDuet-AcATA is replaced by the wet thalli of Escherichia coli BL21/pETDuet to be used as a negative control.

After the reaction, a sample was taken and subjected to HPLC analysis (conditions were the same as in example 1), and the conversion of the substrate in the reaction system for 24 hours was 90%, ee was > 99%.

The method of this example was used to perform the conversion rate determination experiment on two other mutants, and the results of HPLC detection after 24h reaction were as follows:

	final substrate concentration	Conversion rate
			Mutant 1(M122H)	50g/L	90％
Mutant 2(M122V)	50g/L	85％
			Mutant 3(M122F)	50g/L	83％

Example 9: separating and purifying the reaction system to obtain the high-purity sitagliptin intermediate (R) -3-amino-1-piperidine-4- (2,4,5-trifluorophenyl) -1-butanone

400mL of the reaction solution obtained in example 6 was taken, the pH was adjusted to 1.5 with concentrated hydrochloric acid (36 to 38% by mass), and 72g of diatomaceous earth (median diameter 19.6 μm) was added to adsorb the cells, followed by stirring for 20 min. Performing suction filtration to obtain filtrate a and filter residue a, adding 600ml of 1M hydrochloric acid into the filter residue a, stirring for 20min, and performing suction filtration to obtain filtrate b and filter residue b; combining the filtrate a and the filtrate b to total about 1.0L, extracting once with 500mL of dichloromethane (purity > 99.5%) to obtain an aqueous phase a and an organic phase a, extracting the organic phase a with 100mL of 1M hydrochloric acid to obtain an aqueous phase b and an organic phase b, combining the aqueous phase a and the aqueous phase b, adjusting the pH value to 12 with sodium hydroxide, adding 1.2L of dichloromethane for extraction to obtain an organic phase c and an aqueous phase c, adding 800mL of dichloromethane for extraction to obtain an aqueous phase d and an organic phase d, washing the combined organic phase c and the organic phase d with saturated sodium chloride (36g/L) twice, adding anhydrous sodium sulfate for drying, removing the sodium sulfate by suction filtration, performing rotary evaporation at 45 ℃ to obtain 20.5g of white powder, and detecting by a liquid phase, wherein the yield is 94% and the purity of a sitagliptin intermediate is 99.7%. The overall yield of sitagliptin intermediate was 90%.

Example 10: solubility of substrate sitagliptin intermediate precursor ketone 1-piperidine-4- (2,4,5-trifluorophenyl) -1, 3-dibutbutanone in different organic solvents (25 ℃):

organic solvent	Substrate solubility (g/L)
		Methanol	250
Isopropanol (I-propanol)	35
		Ethyl acetate	220
Acetic acid isopropyl ester	180
		Methyl tert-butyl ether	60
N-hexane	Is substantially insoluble

Example 11: preparation of reaction system when DMSO is used as cosolvent

Mutant 1(M122H) stored in 30% glycerol was inoculated into a test tube containing 10mL of a liquid LB medium containing 50. mu.g/mL ampicillin resistance, cultured at 37 ℃ for 12 hours at 200rpm, further inoculated into a fresh 100mL shake flask containing 50. mu.g/mL kanamycin resistance in an inoculum size of 1% (v/v), cultured at 37 ℃ for 2 hours at 150rpm, added with IPTG at a final concentration of 0.1mM, induced at 28 ℃ for 12 hours, centrifuged at 4 ℃ and 8000rpm for 10 minutes, the supernatant was discarded, and the precipitate was collected to obtain M122H wet cells.

0.75g triethanolamine, 2g isopropylamine, 0.025g PLP were weighed to 25mL and the pH was adjusted to 8.5-9.0 with concentrated HCl. Weighing 1g of wet thallus, adding 20mL of the buffer solution, and uniformly mixing by using a 5mL syringe to obtain the thallus buffer solution. 20g, 10g, 5g and 2g of substrates are weighed respectively, and DMSO is used for metering the volume to 100mL respectively, so that 2 different substrate solutions can be obtained.

Example 12: conversion of substrate sitagliptin intermediate precursor ketone 1-piperidine-4- (2,4,5-trifluorophenyl) -1, 3-dibutbutanone in DMSO

5mL of the cell buffer solution of example 11 and 5mL of 4 substrate solutions (wet cell final concentration: 25 g/L; substrate final concentrations of 100g/L, 50g/L, 25g/L and 10g/L) were added to a 25mL reaction flask, respectively, and 3 of each group were placed in parallel and reacted at 45 ℃ and 1000 rpm. Samples were taken at 12h, 24h, 36h, and 48h, respectively, and diluted 100-fold with 50% acetonitrile for liquid phase analysis.

By liquid phase detection, when DMSO is used as a cosolvent, the 12-hour conversion rate can reach 70%, the 24-hour conversion rate is 95%, and the 36-hour conversion rate reaches 99% under the concentration of 10g/L substrate; under the substrate concentration of 25g/L, the conversion rate can reach more than 90% in 24h and 99% after 36 h; under the substrate concentration of 50g/L, the conversion rate can reach 90% in 24h, more than 95% in 36h and 99% in 48 h; under the substrate concentration of 100g/L, the conversion rate can reach 80% in 24h, more than 85% in 36h and 95% in 48 h; .

Example 13: preparation of reaction system with MTBE (methyl tert-butyl ether) as cosolvent

M122H stored in 30% glycerol was inoculated into a test tube containing 10mL of a liquid LB medium containing 50. mu.g/mL ampicillin resistance, cultured at 37 ℃ for 12 hours at 200rpm, further inoculated into a fresh 100mL shake flask containing 50. mu.g/mL kanamycin resistance with an inoculum size of 1% (v/v), cultured at 37 ℃ for 2 hours at 150rpm, added with IPTG at a final concentration of 0.1mM, induced to culture at 28 ℃ for 12 hours, centrifuged at 4 ℃ and 8000rpm for 10 minutes, the supernatant was discarded, and the precipitate was collected to obtain M122H wet cells.

0.75g triethanolamine, 2g isopropylamine, 0.025g PLP were weighed to 25mL and the pH was adjusted to 8.5-9.0 with concentrated HCl. Weighing 1g of wet thallus, adding 20mL of the buffer solution, and uniformly mixing by using a 5mL syringe to obtain the thallus buffer solution. 5g and 2g of substrates were weighed and then made up to 100mL with MTBE (methyl tert-butyl ether) to give 2 different substrate solutions.

Example 14: conversion of substrate sitagliptin intermediate precursor ketone 1-piperidine-4- (2,4,5-trifluorophenyl) -1, 3-dibutbutanone in MTBE (methyl tert-butyl ether)

5mL of the cell buffer solution of example 13 and 5mL of 2 substrate solutions (wet cell final concentration: 25 g/L; substrate final concentrations of 25g/L and 10g/L) were added to a 25mL reaction flask, respectively, and 3 cells were set in parallel and reacted at 45 ℃ and 1000 rpm. Samples were taken at 12h, 24h, 36h, and 48h, respectively, and diluted 100-fold with 50% acetonitrile for liquid phase analysis. When MTBE is used as a cosolvent, the conversion rate reaches about 50% after 48 hours at the substrate concentration of 10 g/L; under the substrate concentration of 25g/L, the conversion rate of 24h reaches 60%, and the conversion rate of 48h reaches 85%.

It should be understood that various changes and modifications can be made by those skilled in the art after reading the above disclosure, and equivalents also fall within the scope of the invention as defined by the appended claims.

Sequence listing

<110> Zhejiang industrial university

ZHEJIANG YONGTAI TECHNOLOGY Co.,Ltd.

ZHEJIANG YONGTAI PHARMACEUTICAL Co.,Ltd.

<120> amine transaminase AcATA mutant and application thereof in preparation of sitagliptin intermediate

<160> 24

<170> SIPOSequenceListing 1.0

<210> 1

<211> 990

<212> DNA

<213> Arthrobacter camenii (Arthrobacter cumminsii)

<400> 1

atggctttta gcgctgatac tccggaaatc gtttacactc atgataccgg tctggactac 60

atcacctact ccgatcacga actggacccg gcgaaccctc tggctggcgg cgctgcgtgg 120

attgaaggtg cgttcgtacc gccgtctgaa gcgcgcattt ccatcttcga ccagggcttt 180

tatacttccg atgcgactta caccaccttc catgtttgga acggcaacgc tttccgcctg 240

ggcgatcata tcgagcgtct gttctctaac gcagagtcta tccgtctgat tccaccgctg 300

acccaggatg aagtaaaaga aatcgcgctg gaactggtgg cgaaaaccga gctgcgtgaa 360

gcgatggtaa ctgttaccat cactcgtggt tactcttcta ctccgttcac ccgtgatatc 420

accaaacatc gtcctcaggt gtacatgtct gcatgtccgt accagtggat cgttcctttc 480

gatcgtattc gtgacggcgt tcacctgatg gtcgcccaga gcgtgcgtcg ttctccgcgc 540

tccagcatcg acccgcaagt gaaaaacttc cagtggggtg atctgattcg tgctatccag 600

gaaacccacg accgcggctt cgaactgcct ctgctgctgg attgcgataa cctgctggcg 660

gaaggtccgg gtttcaacgt agtagtgatt aaagacggtg ttgtgcgttc tcctggtcgc 720

gctgcgctgc cgggtatcac ccgtaaaacg gttctggaaa ttgcagaatc cctgggccat 780

gaagcaatcc tggccgacat tacgccggct gaactgtacg atgctgacga agtactgggt 840

tgctccacgg gcggcggcgt ctggccgttt gtgtctgttg atggcaatag catctctgac 900

ggtgtaccgg gcccagttac ccagtccatt attcgtcgtt actgggagct gaacgtagaa 960

ccgagcagcc tgctgacgcc tgtgcactac 990

<210> 2

<211> 330

<212> PRT

<213> Arthrobacter camenii (Arthrobacter cumminsii)

<400> 2

Met Ala Phe Ser Ala Asp Thr Pro Glu Ile Val Tyr Thr His Asp Thr

1 5 10 15

Gly Leu Asp Tyr Ile Thr Tyr Ser Asp His Glu Leu Asp Pro Ala Asn

20 25 30

Pro Leu Ala Gly Gly Ala Ala Trp Ile Glu Gly Ala Phe Val Pro Pro

35 40 45

Ser Glu Ala Arg Ile Ser Ile Phe Asp Gln Gly Phe Tyr Thr Ser Asp

50 55 60

Ala Thr Tyr Thr Thr Phe His Val Trp Asn Gly Asn Ala Phe Arg Leu

65 70 75 80

Gly Asp His Ile Glu Arg Leu Phe Ser Asn Ala Glu Ser Ile Arg Leu

85 90 95

Ile Pro Pro Leu Thr Gln Asp Glu Val Lys Glu Ile Ala Leu Glu Leu

100 105 110

Val Ala Lys Thr Glu Leu Arg Glu Ala Met Val Thr Val Thr Ile Thr

115 120 125

Arg Gly Tyr Ser Ser Thr Pro Phe Thr Arg Asp Ile Thr Lys His Arg

130 135 140

Pro Gln Val Tyr Met Ser Ala Cys Pro Tyr Gln Trp Ile Val Pro Phe

145 150 155 160

Asp Arg Ile Arg Asp Gly Val His Leu Met Val Ala Gln Ser Val Arg

165 170 175

Arg Ser Pro Arg Ser Ser Ile Asp Pro Gln Val Lys Asn Phe Gln Trp

180 185 190

Gly Asp Leu Ile Arg Ala Ile Gln Glu Thr His Asp Arg Gly Phe Glu

195 200 205

Leu Pro Leu Leu Leu Asp Cys Asp Asn Leu Leu Ala Glu Gly Pro Gly

210 215 220

Phe Asn Val Val Val Ile Lys Asp Gly Val Val Arg Ser Pro Gly Arg

225 230 235 240

Ala Ala Leu Pro Gly Ile Thr Arg Lys Thr Val Leu Glu Ile Ala Glu

245 250 255

Ser Leu Gly His Glu Ala Ile Leu Ala Asp Ile Thr Pro Ala Glu Leu

260 265 270

Tyr Asp Ala Asp Glu Val Leu Gly Cys Ser Thr Gly Gly Gly Val Trp

275 280 285

Pro Phe Val Ser Val Asp Gly Asn Ser Ile Ser Asp Gly Val Pro Gly

290 295 300

Pro Val Thr Gln Ser Ile Ile Arg Arg Tyr Trp Glu Leu Asn Val Glu

305 310 315 320

Pro Ser Ser Leu Leu Thr Pro Val His Tyr

325 330

<210> 3

<211> 33

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 3

gagctgcgtg aagcggcggt aactgttacc atc 33

<210> 4

<211> 33

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 4

gatggtaaca gttaccgccg cttcacgcag ctc 33

<210> 5

<211> 33

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 5

ctggcggaag gtccggcttt caacgtagta gtg 33

<210> 6

<211> 33

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 6

cactactacg ttgaaagccg gaccttccgc cag 33

<210> 7

<211> 33

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 7

gtgaaaaact tccaggcggg tgatctgatt cgt 33

<210> 8

<211> 33

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 8

acgaatcaga tcacccgcct ggaagttttt cac 33

<210> 9

<211> 33

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 9

gcgatggtaa ctgttgccat cactcgtggt tac 33

<210> 10

<211> 33

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 10

gtaaccacga gtgatggcaa cagttaccat cgc 33

<210> 11

<211> 33

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 11

cctcaggtgt acatggctgc atgtccgtac cag 33

<210> 12

<211> 33

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 12

ctggtacgga catgcagcca tgtacacctg agg 33

<210> 13

<211> 33

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 13

atcttcgacc agggcgctta tacttccgat gcg 33

<210> 14

<211> 33

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 14

cgcatcggaa gtataagcgc cctggtcgaa gat 33

<210> 15

<211> 33

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 15

ccgcaagtga aaaacgccca gtggggtgat ctg 33

<210> 16

<211> 33

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 16

cagatcaccc cactgggcgt ttttcacttg cgg 33

<210> 17

<211> 33

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 17

gagctgcgtg aagcgcatgt aactgttacc atc 33

<210> 18

<211> 33

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 18

gatggtaaca gttacatgcg cttcacgcag ctc 33

<210> 19

<211> 33

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 19

gagctgcgtg aagcggtggt aactgttacc atc 33

<210> 20

<211> 33

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 20

gatggtaaca gttaccaccg cttcacgcag ctc 33

<210> 21

<211> 33

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 21

gagctgcgtg aagcgtttgt aactgttacc atc 33

<210> 22

<211> 33

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 22

gatggtaaca gttacaaacg cttcacgcag ctc 33

<210> 23

<211> 990

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 23

atggctttta gcgctgatac tccggaaatc gtttacactc atgataccgg tctggactac 60

atcacctact ccgatcacga actggacccg gcgaaccctc tggctggcgg cgctgcgtgg 120

attgaaggtg cgttcgtacc gccgtctgaa gcgcgcattt ccatcttcga ccagggcttt 180

tatacttccg atgcgactta caccaccttc catgtttgga acggcaacgc tttccgcctg 240

ggcgatcata tcgagcgtct gttctctaac gcagagtcta tccgtctgat tccaccgctg 300

acccaggatg aagtaaaaga aatcgcgctg gaactggtgg cgaaaaccga gctgcgtgaa 360

gcgcatgtaa ctgttaccat cactcgtggt tactcttcta ctccgttcac ccgtgatatc 420

accaaacatc gtcctcaggt gtacatgtct gcatgtccgt accagtggat cgttcctttc 480

gatcgtattc gtgacggcgt tcacctgatg gtcgcccaga gcgtgcgtcg ttctccgcgc 540

tccagcatcg acccgcaagt gaaaaacttc cagtggggtg atctgattcg tgctatccag 600

gaaacccacg accgcggctt cgaactgcct ctgctgctgg attgcgataa cctgctggcg 660

gaaggtccgg gtttcaacgt agtagtgatt aaagacggtg ttgtgcgttc tcctggtcgc 720

gctgcgctgc cgggtatcac ccgtaaaacg gttctggaaa ttgcagaatc cctgggccat 780

gaagcaatcc tggccgacat tacgccggct gaactgtacg atgctgacga agtactgggt 840

tgctccacgg gcggcggcgt ctggccgttt gtgtctgttg atggcaatag catctctgac 900

ggtgtaccgg gcccagttac ccagtccatt attcgtcgtt actgggagct gaacgtagaa 960

ccgagcagcc tgctgacgcc tgtgcactac 990

<210> 24

<211> 330

<212> PRT

<213> Artificial Sequence (Artificial Sequence)

<400> 24

Met Ala Phe Ser Ala Asp Thr Pro Glu Ile Val Tyr Thr His Asp Thr

1 5 10 15

Gly Leu Asp Tyr Ile Thr Tyr Ser Asp His Glu Leu Asp Pro Ala Asn

20 25 30

Pro Leu Ala Gly Gly Ala Ala Trp Ile Glu Gly Ala Phe Val Pro Pro

35 40 45

Ser Glu Ala Arg Ile Ser Ile Phe Asp Gln Gly Phe Tyr Thr Ser Asp

50 55 60

Ala Thr Tyr Thr Thr Phe His Val Trp Asn Gly Asn Ala Phe Arg Leu

65 70 75 80

Gly Asp His Ile Glu Arg Leu Phe Ser Asn Ala Glu Ser Ile Arg Leu

85 90 95

Ile Pro Pro Leu Thr Gln Asp Glu Val Lys Glu Ile Ala Leu Glu Leu

100 105 110

Val Ala Lys Thr Glu Leu Arg Glu Ala His Val Thr Val Thr Ile Thr

115 120 125

Arg Gly Tyr Ser Ser Thr Pro Phe Thr Arg Asp Ile Thr Lys His Arg

130 135 140

Pro Gln Val Tyr Met Ser Ala Cys Pro Tyr Gln Trp Ile Val Pro Phe

145 150 155 160

Asp Arg Ile Arg Asp Gly Val His Leu Met Val Ala Gln Ser Val Arg

165 170 175

Arg Ser Pro Arg Ser Ser Ile Asp Pro Gln Val Lys Asn Phe Gln Trp

180 185 190

Gly Asp Leu Ile Arg Ala Ile Gln Glu Thr His Asp Arg Gly Phe Glu

195 200 205

Leu Pro Leu Leu Leu Asp Cys Asp Asn Leu Leu Ala Glu Gly Pro Gly

210 215 220

Phe Asn Val Val Val Ile Lys Asp Gly Val Val Arg Ser Pro Gly Arg

225 230 235 240

Ala Ala Leu Pro Gly Ile Thr Arg Lys Thr Val Leu Glu Ile Ala Glu

245 250 255

Ser Leu Gly His Glu Ala Ile Leu Ala Asp Ile Thr Pro Ala Glu Leu

260 265 270

Tyr Asp Ala Asp Glu Val Leu Gly Cys Ser Thr Gly Gly Gly Val Trp

275 280 285

Pro Phe Val Ser Val Asp Gly Asn Ser Ile Ser Asp Gly Val Pro Gly

290 295 300

Pro Val Thr Gln Ser Ile Ile Arg Arg Tyr Trp Glu Leu Asn Val Glu

305 310 315 320

Pro Ser Ser Leu Leu Thr Pro Val His Tyr

325 330

Claims

1. An amine transaminase AcATA mutant, which is obtained by performing single mutation on the 122 th position of an amino acid sequence shown in SEQ ID No. 2;

wherein the methionine at position 122 is mutated to histidine, valine or phenylalanine.

2. A gene encoding the amine transaminase AcATA mutant of claim 1.

3. A recombinant vector comprising the encoding gene of claim 2.

4. A genetically engineered bacterium comprising the coding gene of claim 2.

5. The use of the amine transaminase AcATA mutant as defined in claim 1 in biocatalysis of sitagliptin intermediate precursor ketone 1-piperidine-4- (2,4,5-trifluorophenyl) -1, 3-dibutbutanone to synthesize sitagliptin intermediate (R) -3-amino-1-piperidine-4- (2,4,5-trifluorophenyl) -1-butanone.

6. The use of the genetically engineered bacterium of claim 4 in catalyzing sitagliptin intermediate precursor ketone 1-piperidine-4- (2,4,5-trifluorophenyl) -1, 3-dibutyrrone to synthesize sitagliptin intermediate (R) -3-amino-1-piperidine-4- (2,4,5-trifluorophenyl) -1-butanone.

7. A method for synthesizing a sitagliptin intermediate (R) -3-amino-1-piperidine-4- (2,4,5-trifluorophenyl) -1-butanone by biocatalyzing a sitagliptin intermediate precursor ketone 1-piperidine-4- (2,4,5-trifluorophenyl) -1, 3-dibutbutanone is characterized by comprising the following steps: the (R) -3-amino-1-piperidine-4- (2,4,5-trifluorophenyl) -1-butanone is obtained by performing a biocatalytic synthesis reaction in a buffer solution by using 1-piperidine-4- (2,4,5-trifluorophenyl) -1, 3-dibutanone as a substrate, an amine transaminase AcATA mutant of claim 1 or a genetically engineered bacterium of claim 4 as a biocatalyst, isopropylamine as an amino donor, and pyridoxal phosphate as a coenzyme.

8. The method as claimed in claim 7, wherein in the reaction system, the reaction temperature is 45-50 ℃, the stirring speed is 500-600rpm, and the reaction time is 12-36 h; the molar ratio of the substrate to the amino donor is 1: 7-12; the molar ratio of the substrate to the biocatalyst is 1: 1-3.

9. The method of claim 7, wherein the final concentration of the substrate is 2 to 100g/L, the final concentration of the amino donor is 25 to 95g/L, the final concentration of the coenzyme is 0.3 to 0.5g/L, and the amount of the biocatalyst added is 10 to 50g/L, based on the total volume of the buffer solution in the reaction system.

10. The method of claim 7, wherein the reaction system further comprises a substrate cosolvent; the cosolvent is dimethyl sulfoxide or methyl tert-butyl ether;

carrying out biocatalysis reaction at the temperature of 45-50 ℃ and the stirring speed of 500-;

in the reaction system, the final concentration of wet thalli of the genetic engineering bacteria is 25g/L, the final concentration of a substrate is 25g/L or 10g/L, the final volume concentration of dimethyl sulfoxide or methyl tert-butyl ether is 20%, pyridoxal phosphate is 0.5g/L, and isopropylamine is 80 g/L.