CN111544434B - Application of enretinib in preparation of virus inhibitor - Google Patents

Abstract

The invention discloses application of enretinib in preparation of a virus inhibitor. The invention provides a formulaThe application of the compound shown as the formula (I) or the pharmaceutically acceptable salt thereof: the application in preparing virus inhibitor; the application in inhibiting virus. The invention provides a compound shown as a formula (I) or an application of a pharmaceutically acceptable salt thereof: the application of the product in preparing products for treating diseases caused by virus infection; the application in treating diseases caused by virus infection. The inventor of the invention finds that the compound shown in the formula (I) can be combined with hNV-RdRp and DENV-RdRp simultaneously, and further can inhibit hNV-RdRp and DENV-RdRp activities. The compounds of formula (I) have inhibitory effects on a variety of viruses and are therefore useful as broad-spectrum antiviral agents.

Description

Application of enretinib in preparation of virus inhibitor

Technical Field

The invention belongs to the technical field of medicines, relates to a new application of enrofloxacin, and particularly relates to an application of enrofloxacin in preparation of a virus inhibitor.

Background

The continuous emergence of various new viral pathogens poses a great threat and challenge to global public health safety. For example, both human norovirus (hNV) and dengue virus (DENV) are highly contagious and are prevalent worldwide each year. Norovirus is a single positive-strand RNA virus belonging to (+) ssRNA (IV), the family caliciviridae, and causes non-bacterial acute gastroenteritis, norovirus infection can cause severe diarrhea, vomiting, and stomachache, with up to 20 million deaths per year in developing countries due to norovirus infection. Dengue is a single-stranded positive-stranded RNA virus of the flavivirus genus of the Flaviviridae family; is a mosquito-borne infectious disease, which can cause fever, rash, arthralgia and severe hemorrhagic shock; approximately 3.9 million people worldwide infect dengue virus annually, with as many as 9600 million people suffering. To date, there are no effective drugs for treating human norovirus and dengue virus infectious diseases. Currently, most antiviral drugs are usually targeted to one specific virus and are not sufficient to cope with the outbreaks of the various emerging viruses. In order to quickly cope with pandemic threats, the development of broad-spectrum antiviral drugs is urgently required.

RNA-dependent RNA polymerase (RdRp) is a key protein factor involved in the replication of viral genomic RNA and an important target for the study of novel drugs against a broad spectrum of RNA viruses. Despite sequence differences between different virus families, the structure of viral RNA polymerases is relatively conserved. The shape of RNA polymerase is similar to the right hand of human, and is composed mainly of three domains, finger, palm and thumb. There are two major ligand binding sites in RNA polymerase: a catalytically active site and various allosteric binding sites. Nucleoside analogs (NIs), such as BCX4430, favipiravir, ribavirin and remdesivir, exert antiviral effects by targeting the active site of RNA polymerase. However, this inhibition mechanism often leads to side effects such as off-target. Non-nucleoside inhibitors (NNIs) bind to the allosteric site of RNA polymerase and exert antiviral activity by preventing conformational changes required for transcription, often with low toxicity and side effects, and have received extensive attention in drug development. To date, most of the NNIs in clinical use or in clinical trials have been developed against the Hepatitis C Virus (HCV) and are species specific. There is an urgent need to develop a broad spectrum of non-nucleoside inhibitors. HCV is an enveloped single-stranded positive-strand RNA virus, (+) ssRNA virus, belonging to the Flaviviridae family of the genus hepacivirus (Flaviviridae).

Disclosure of Invention

The technical problem to be solved by the invention is how to inhibit the virus and correspondingly how to treat diseases caused by virus infection.

In order to solve the technical problems, the invention provides a new application of the enretinib.

The structural formula of the enrotinib is shown in formula (I), and the CAS number of the enrotinib is 1108743-60-7.

The invention provides a compound shown in formula (I) or an application of a pharmaceutically acceptable salt thereof, which is (a) or (b) as follows:

(a) the application in preparing virus inhibitor;

(b) the application in inhibiting virus.

The invention provides a compound shown in formula (I) or an application of a pharmaceutically acceptable salt thereof, which is (c) or (d) as follows:

(c) the application in preparing products; the product is used for treating diseases caused by virus infection;

(d) the application in treating diseases caused by virus infection.

Illustratively, the product may be a medicament, vaccine or pharmaceutical formulation.

The product may contain, in addition to a compound of formula (I) or a pharmaceutically acceptable salt thereof, a suitable carrier or excipient. The carrier material herein includes, but is not limited to, water-soluble carrier materials (e.g., polyethylene glycol, polyvinylpyrrolidone, organic acids, etc.), poorly soluble carrier materials (e.g., ethyl cellulose, cholesterol stearate, etc.), enteric carrier materials (e.g., cellulose acetate phthalate, carboxymethyl cellulose, etc.). Among these, water-soluble carrier materials are preferred. The materials can be prepared into various dosage forms, including but not limited to tablets, capsules, dripping pills, aerosols, pills, powders, solutions, suspensions, emulsions, granules, liposomes, transdermal agents, buccal tablets, suppositories, freeze-dried powder injections and the like. Can be common preparation, sustained release preparation, controlled release preparation and various microparticle drug delivery systems. In order to prepare the unit dosage form into tablets, various carriers well known in the art can be widely used. Examples of the carrier are, for example, diluents and absorbents such as starch, dextrin, calcium sulfate, lactose, mannitol, sucrose, sodium chloride, glucose, urea, calcium carbonate, kaolin, microcrystalline cellulose, aluminum silicate and the like; wetting agents and binders such as water, glycerin, polyethylene glycol, ethanol, propanol, starch slurry, dextrin, syrup, honey, glucose solution, acacia slurry, gelatin slurry, sodium carboxymethylcellulose, shellac, methyl cellulose, potassium phosphate, polyvinylpyrrolidone and the like; disintegrating agents such as dried starch, alginate, agar powder, brown algae starch, sodium bicarbonate and citric acid, calcium carbonate, polyoxyethylene, sorbitol fatty acid ester, sodium dodecylsulfate, methyl cellulose, ethyl cellulose, etc.; disintegration inhibitors such as sucrose, glyceryl tristearate, cacao butter, hydrogenated oil and the like; absorption accelerators such as quaternary ammonium salts, sodium lauryl sulfate and the like; lubricants, for example, talc, silica, corn starch, stearate, boric acid, liquid paraffin, polyethylene glycol, and the like. The tablets may be further formulated into coated tablets, such as sugar-coated tablets, film-coated tablets, enteric-coated tablets, or double-layer and multi-layer tablets. In order to prepare the dosage form for unit administration into a pill, various carriers well known in the art can be widely used. Examples of the carrier are, for example, diluents and absorbents such as glucose, lactose, starch, cacao butter, hydrogenated vegetable oil, polyvinylpyrrolidone, Gelucire, kaolin, talc and the like; binders such as acacia, tragacanth, gelatin, ethanol, honey, liquid sugar, rice paste or batter, etc.; disintegrating agents, such as agar powder, dried starch, alginate, sodium dodecylsulfate, methylcellulose, ethylcellulose, etc. In order to prepare the unit dosage form into suppositories, various carriers known in the art can be widely used. As examples of the carrier, there may be mentioned, for example, polyethylene glycol, lecithin, cacao butter, higher alcohols, esters of higher alcohols, gelatin, semisynthetic glycerides and the like. In order to prepare the unit dosage form into preparations for injection, such as solutions, emulsions, lyophilized powders and suspensions, all diluents commonly used in the art, for example, water, ethanol, polyethylene glycol, 1, 3-propanediol, ethoxylated isostearyl alcohol, polyoxylated isostearyl alcohol, polyoxyethylene sorbitol fatty acid esters, etc., can be used. In addition, for the preparation of isotonic injection, sodium chloride, glucose or glycerol may be added in an appropriate amount to the preparation for injection, and conventional cosolvents, buffers, pH adjusters and the like may also be added. In addition, colorants, preservatives, flavors, flavorings, sweeteners or other materials may also be added to the pharmaceutical preparation, if desired. The preparation can be used for injection administration, including subcutaneous injection, intravenous injection, intramuscular injection, intracavity injection and the like; for luminal administration, such as rectally and vaginally; administration to the respiratory tract, e.g., nasally; administration to the mucosa.

The invention provides a compound shown in formula (I) or an application of a pharmaceutically acceptable salt thereof, which is (e) or (f) as follows:

(e) the application in preparing virus RdRp inhibitor;

(f) use in inhibiting the RdRp activity of a virus.

The present invention also provides a pharmaceutical compound characterized in that: the active ingredient of the medicinal compound is a compound shown as a formula (I) or a pharmaceutically acceptable salt thereof.

The pharmaceutical compounds are useful for inhibiting viruses and/or treating diseases caused by viral infections and/or inhibiting the RdRp activity of viruses.

The present invention also provides a method of inhibiting viral infection in an animal comprising the steps of: a compound represented by the formula (I) or a pharmaceutically acceptable salt thereof is administered to a recipient animal to inhibit viral infection of the animal.

The present invention also provides a method of treating a disease caused by a viral infection, comprising the steps of: a compound of formula (I) or a pharmaceutically acceptable salt thereof is administered to a recipient animal to treat a disease caused by a viral infection.

Any of the viruses described above is a single-stranded positive-stranded RNA virus.

Any of the viruses described above is a virus having an RdRp.

Any of the above viruses is a virus of the Caliciviridae family or a virus of the Flaviviridae family.

The virus of the Caliciviridae family is a norovirus, such as a human norovirus or a murine norovirus.

The virus of the Flaviviridae family is a virus of the genus Flaviviridae or a virus of the genus hepatitis C virus.

Any one of the above viruses is a norovirus (e.g., a human norovirus or a murine norovirus), a dengue virus, or a hepatitis c virus.

In the present invention, the inhibitory virus may also be referred to as an antiviral.

The totality of RdRp is known as RNA-dependent RNA polymerase.

hNV-RdRp is shown as a sequence 1 in the sequence table.

The DNEV-RdRp is shown as a sequence 3 in a sequence table.

Emtrictinib exerts a broad spectrum antiviral effect by targeting RNA-dependent RNA polymerase.

In the present invention, the animal may be a mammal, such as a human; the animal may also be other than a mammal, such as a mouse, infected with the virus.

In the present invention, the term "pharmaceutically acceptable salt" refers to salts which are, within the scope of sound medical judgment, suitable for use in contact with the tissues of humans and lower animals without excessive toxicity, irritation, allergic response, and the like, commensurate with a reasonable benefit/risk ratio. Pharmaceutically acceptable salts are well known in the art. Pharmaceutically acceptable salts are described in detail, for example, in s.m. berge, et al, j.pharmaceutical Sciences,1977,66: 1.

The inventors of the present invention found that a small molecule compound having both hNV-RdRp and DENV-RdRp binding to the compound of formula (I) (the binding site is located at hNV-RdRp and the common allosteric site of DENV-RdRp) can inhibit hNV-RdRp and DENV-RdRp activities. The compounds of formula (I) have inhibitory effects on a variety of viruses and are therefore useful as broad-spectrum antiviral agents. The invention has important application value for resisting virus.

Drawings

FIG. 1 is an electrophoretogram of the protein in example 2.

FIG. 2 is a graph showing the results of example 3.

FIG. 3is a graph showing the results of example 4.

FIG. 4 is a graph showing the results of example 5.

FIG. 5 is a graph showing the results of example 6.

FIG. 6 is a graph showing the results of the RNA inhibition ratio in example 7.

FIG. 7 is a graph showing the results of the relative abundances of positive-strand RNA and negative-strand RNA in example 7.

FIG. 8 is a graph showing the results of example 8.

FIG. 9 is a graph showing the results of example 9.

FIG. 10 is a graph showing the results of example 10.

Detailed Description

The following examples are given to facilitate a better understanding of the invention, but do not limit the invention. Unless otherwise specified, the experimental procedures in the following examples are conventional procedures known to those skilled in the art or as suggested by the manufacturers. Unless otherwise specified, the test materials used in the following examples were purchased from conventional biochemical stores. Unless otherwise stated, the quantitative tests in the following examples were performed in triplicate, and the results were averaged. Protein concentration was measured by BCA protein assay kit (Pierce).

The compound RAI-13 has a CAS number of 1108743-60-7, a Chinese name of Entricinib and an English name of Entretinib, has a structural formula shown as a formula (I), and belongs to a small molecular compound.

RdRp of human norovirus, denoted by hNV-RdRp.

RdRp of dengue virus, expressed as DENV-RdRp.

Example 1 preliminary screening of Compounds

There are five allosteric sites in the RNA polymerase structure of HCV: thumb site I, thumb site II, palm site I, palm site II and palm site β. Palmar site I in the RNA polymerase structure of HCV is structurally equivalent to the allosteric site N-Pocket in the RNA polymerase structure of DENV. The palmar site I of the RNA polymerase structure of HCV is located in the thumb/palmar region, surrounded by a β -hairpin loop. The N-Pocket in the RNA polymerase structure of DENV is located at the thumb and palm domain boundary and adjacent to the priming loop. The priming loop in the RNA polymerase structure of DENV has similar biological functions as the β -hairpin loop in the RNA polymerase structure of HCV. hNV the binding site (B-site) of PPNDS in the RNA polymerase structure is roughly the same in structure as the palmar site I in the RNA polymerase structure of HCV. Similarly, the B-site is located in the thumb domain of the RNA polymerase structure at hNV, surrounded by C-terminal. The allosteric site B-site is highly conserved in the caliciviridae family to which norovirus belongs.

The inventors of the present invention first explained and analyzed the binding pattern and mechanism of action of compounds at the molecular level by means of molecular docking. And searching a small molecule compound (the database contains 4 ten thousand small molecules with known biological activities) in a TargetMol active compound database by using N-Pocket in DENV-RdRp and B-site in hNV-RdRp as targets through a virtual screening method based on a structure. According to the calculated binding free energy data of the small molecules and the target protein, 256 small molecule compounds with better binding free energy with DENV-RdRp and hNV-RdR are preliminarily screened. Finally, the binding mode of the small molecule and the target protein is further evaluated by a molecular docking method. 20 compounds were finally obtained and purchased. The 20 compounds are represented by RAI-1 to RAI-20 in this order.

Example 2, hNV and expression and purification of RNA-dependent RNA polymerase for DNEV

Expression and purification of RNA-dependent RNA polymerase of I, hNV

1. hNV-RdRp DNA (hNV-RdRp DNA is double-stranded DNA molecule shown in sequence 2 of a sequence table, and hNV-RdRp shown in sequence 1 of a coding sequence table) is inserted between BamH I and Not I enzyme cutting sites of pET-21a (+) to obtain a recombinant plasmid, which is named as hNV-RdRp recombinant plasmid.

hNV-RdRp recombinant plasmid, hNV-RdRp DNA is connected with the following DNA molecule' ATGGCTAGCATGACTGGTGGACAGCAAATGGGTCGCGGATCC", downstream is linked to a DNA molecule"GCGGCCGCACTCGAGCACCACCACCACCACCACTGA' form a fusion gene, express His₆hNV-RdRp for the tag.

2. The hNV-RdRp recombinant plasmid is introduced into Escherichia coli BL21(DE3) to obtain a recombinant strain.

3. Inoculating the recombinant strain obtained in the step 2 into LB liquid culture medium containing 100 mu g/ml ampicillin, and carrying out shaking culture at 37 ℃ and 200rpm until the culture reaches 0D_600nmThen, IPTG was added to the medium to give a concentration of 0.5mM in the system, and the mixture was cultured at 16 ℃ for 18 hours with shaking at 200 rpm.

4. After completion of step 3, lysozyme and DNase I (the concentration of lysozyme in the system was 0.2mg/ml, and the concentration of DNase I in the system was 0.02mg/ml) were added to the system, followed by ultrasonication, followed by centrifugation at 12000rpm for 10min at 4 ℃ and collection of the supernatant.

5. And (4) taking the supernatant obtained in the step (4), and purifying by adopting Ni-trinitrotriacetic acid affinity chromatography.

Washing with buffer A to remove non-target protein, and eluting with buffer B to collect target protein.

And (3) buffer solution A: contains 300mM NaCl, 10% (by volume) glycerol, 2mM DTT, 10mM imidazole, and the balance being PBS buffer (pH7.5, 10 mM). And (3) buffer solution B: contains 300mM NaCl, 10% (by volume) glycerol, 2mM DTT, 500mM imidazole, and the balance being PBS buffer (pH7.5, 10 mM).

6. And (5) taking the solution obtained in the step 5, and purifying by using size exclusion chromatography.

Dialyzing with buffer C and concentrating the target protein to 3-5mg/mL to obtain hNV-RdRp protein solution.

And (3) buffer C: contains 150mM NaCl, 2mM DTT, and the balance being PBS buffer (pH7.5, 10 mM).

Expression and purification of RNA-dependent RNA polymerase for DNEV

1. DNEV-RdRp DNA (DNEV-RdRp DNA is a double-stranded DNA molecule shown in a sequence 4 of a sequence table, and DNEV-RdRp shown in a sequence 3 of a coding sequence table) is inserted between BamHI and Not I enzyme cutting sites of pET-21a (+) to obtain a recombinant plasmid, and the recombinant plasmid is named as DNEV-RdRp recombinant plasmid.

In the DNEV-RdRp recombinant plasmid, the DNA molecule 'ATGGCTAGCATGACTGGTGGACAGCAAATGGGTCGC' is connected to the upstream of DNEV-RdRp DNAGGATCC", downstream is linked to a DNA molecule"GCGGCCGCACTCGAGCACCACCACCACCACCACTGA' form a fusion gene, express His₆DNEV-RdRp of the tag.

2. The DNEV-RdRp recombinant plasmid is introduced into Escherichia coli BL21(DE3) to obtain a recombinant strain.

3. Inoculating the recombinant strain obtained in the step 2 into LB liquid culture medium containing 100 mu g/ml ampicillin, and carrying out shaking culture at 37 ℃ and 200rpm until the culture reaches 0D_600nmThen, IPTG was added to the medium to give a concentration of 0.5mM in the system, and the mixture was cultured at 22 ℃ for 18 hours with shaking at 200 rpm.

Steps 4 to 6 are the same as steps 4 to 6 of step one.

Obtaining DNEV-RdRp protein solution.

Protein electrophoresis

hNV-RdRp protein solution and DNEV-RdRp protein solution were subjected to SDS-PAGE, see FIG. 1. The expected molecular weight of hNV-RdRp protein is 57KD, and the expected molecular weight of DNEV-RdRp protein is 70 KD.

Example 3 screening of hNV-RdRp inhibitors

Picogreen is an extremely sensitive fluorescent nucleic acid dye that fluoresces only after binding to double-stranded nucleic acid and the resulting fluorescence is proportional to double-stranded nucleic acid concentration. The effect of test compounds on hNV-RdRp activity was assessed by detecting the amount of double-stranded RNA (dsRNA) formed in the reaction system using PicoGreen.

PicoGreen: thermo Scientific. PicoGreen was diluted to 200-fold volume with TE buffer pH7.5 to obtain PicoGreen working solution.

Test compounds: RAI-1 to RAI-20.

Test compounds were dissolved in DMSO to give a compound stock solution with a concentration of 10 mM.

The reaction was performed in black 96-well plates.

Wells were tested, one reaction system per well (25. mu.L). A25. mu.L reaction was performed with poly (C) RNA (P4903, Sigma-Aldrich), GTP, 0.5. mu.L of hNV-RdRp protein solution prepared in example 2 (protein concentration in hNV-RdRp protein solution: 5mg/mL), MnCl₂DTT, compound stock solution and PBS buffer (pH7.5, 10 mM). The concentration of each component in the reaction system is as follows: 40ng/mL poly (C) RNA, 25. mu.M GTP, 2.5mM MnCl₂5mM DTT, 40. mu.M test compound. The reaction system was incubated at 30 ℃ for 30 minutes, then EDTA was added to the reaction system at a concentration of 10mM to terminate the reaction, 175. mu.L of PicoGreen working solution was added to each well and incubated for 5 minutes in the absence of light, and then the fluorescence intensity was measured using a microplate reader (excitation and emission wavelengths of 485nm and 520nm, respectively). Duplicate wells were set for each test compound.

Blank control wells, compound stock was replaced with equal volume of DMSO, and the wells were identical to the test wells. The wells had RNA polymerase but no inhibitor and the value measured was Total polymerase activity (Total activity). 5 multiple holes are arranged. The mean value was taken for each well and is designated as meanTA.

Negative control wells, hNV-RdRp protein solution was replaced with equal volume of the inactivated (100 ℃, 2min) hNV-RdRp protein solution, otherwise identical to the test wells. The RNA polymerase in this well is inactive and therefore will not synthesize double stranded RNA. 5 multiple holes are arranged. The wells were averaged and scored as meanNSA.

Positive control wells, which were identical to test wells, were substituted for test compound with equimolar amounts of positive control compound. 5 multiple holes are arranged. The positive control compound was PPNDS (hNV-RdRp inhibitor of the prior art, CAS number 1021868-77-8).

hNV-RdRp relative activity × (100 × "(sample-means NSA) ÷ (means TA-means NSA) ].

The results are shown in FIG. 2. In FIG. 2, 1 to 20 correspond to RAI-1 to RAI-20 in this order. At a concentration of 40. mu.M, RAI-5, RAI-13 and RAI-14 have activity towards hNV-RdRp

The inhibitory action of (1).

Example 4 RAI-13 inhibition of hNV-RdRp with good dose dependence

The test compound was RAI-13.

The procedure is essentially as in example 3.

The concentration of the test compound in the reaction system was 12.5. mu.M to 400. mu.M (2-fold gradient).

The inhibition rate is 100- [100 × (sample-means nsa) ÷ (means ta-means nsa) ].

Half maximal effect concentration of RAI-13 was calculated using GraphPad 5.0 software (EC 50).

The results are shown in FIG. 3. In FIG. 3, the abscissa is the logarithm of the base 10 of the compound concentration (. mu.M). RAI-13 showed a dose-dependent inhibition of hNV-RdRp with an EC50 value of 46.88. mu.M.

Example 5 RAI-13 inhibition of MNV with good dose dependence

Human norovirus has difficulty establishing culture systems in vitro, and Murine Norovirus (MNV) is often used as a model for NV biology and pathogenesis. Murine norovirus was therefore used to evaluate compounds for anti-norovirus activity.

RAW264.7 cells, namely RAW264.7 cell line, American Type Culture Collection (ATCC), accession number TIB-71. MNV SH 1603: an MNV strain separated from mouse excrement; the following documents are described: isolation and culture of mouse norovirus and genomic sequence analysis thereof in China, Wang Hui Min, China journal of biological products, Vol.30, No. 5 in 5 months in 2017, 462-466.

First, cell culture

1. RAW264.7 cells were seeded into 12-well plates (2X 10)⁵Individual cells/well), cultured with DMEM medium for 24 hours.

2. After completion of step 1, the supernatant was aspirated, MNV SH1603 was inoculated in a virus amount of MOI 10, and then cultured for 4 hours using a medium containing RAI-13.

3. After completion of step 2, the supernatant was aspirated and cultured for 48h with a fresh RAI-13-containing medium.

In step 2 and step 3, the concentration of RAI-13 was the same.

The preparation method of the culture medium containing RAI-13 comprises the following steps: the RAI-13 stock solution and DMEM medium were mixed. The preparation method of the RAI-13 mother liquor comprises the following steps: RAI-13 was dissolved in DMSO to give a mother liquor of RAI-13 at a concentration of 10 mM.

Test wells, the concentration of RAI-13 in the medium was set to: 0.3125. mu.M, 0.625. mu.M, 1.25. mu.M, 2.5. mu.M or 5. mu.M. 5 multiple wells were set for each concentration.

Negative control wells, the RAI-13 stock solution was replaced with an equal volume of DMSO. Negative control wells were set up in 5 replicates.

Second, detecting

After completion of step one, cells were collected, total RNA was extracted and levels of viral RNA were determined by qRT-PCR analysis using a one-step SYBR PrimeScript RT-PCR kit.

Primers used for detecting the virus were as follows:

5’-CCACTGCTCAGATCACATGC-3’；

5’-TTAGAAAGAAGGCGGCCAGA-3’。

the mGAPDH gene serves as an internal reference gene. Primers used to detect the reference gene were as follows:

5’-TGCAGTGGCAAAGTGGAGATT-3’；

5’-GTGAGTGGAGTCATACTGGAACATGT-3’。

RNA inhibition rate ═ (RNA abundance of negative control wells-RNA abundance of test wells) ÷ RNA abundance of negative control wells × 100%.

The results are shown in FIG. 4. In FIG. 4, the abscissa is the base 10 logarithm of the compound concentration (. mu.M). RAI-13 showed dose-dependent inhibition of MNV with an EC50 value of 1.73. mu.M.

Example 6 inhibition of DNEV-RdRp Activity

Test compounds: RAI-5, RAI-13 and RAI-14.

CAS number for RAI-5: 612847-09-3.

CAS number for RAI-14: 1033769-28-6.

Test compounds were dissolved in DMSO to give a compound stock solution with a concentration of 10 mM.

The reaction was performed in black 96-well plates.

Wells were tested, one reaction system per well (25. mu.L). A25. mu.L reaction system was prepared from poly (C) RNA (P4903, Sigma-Aldrich), GTP, 5. mu.L of the DNEV-RdRp protein solution prepared in example 2 (protein concentration in the DNEV-RdRp protein solution was 3mg/mL), and MnCl₂DTT, compound stock solution and PBS buffer (pH7.5, 10 mM). The concentration of each component in the reaction system is as follows: 40ng/mL poly (C) RNA, 50. mu.M GTP, 2.5mM MnCl₂5mM DTT, 40. mu.M test compound. The reaction system was incubated at 30 ℃ for 30 minutes, then EDTA was added to the reaction system at a concentration of 10mM to terminate the reaction, 175. mu.L of PicoGreen working solution was added to each well and incubated for 5 minutes in the absence of light, and then the fluorescence intensity was measured using a microplate reader (excitation and emission wavelengths of 485nm and 520nm, respectively). Duplicate wells were set for each test compound.

Blank control wells, compound stock was replaced with equal volume of DMSO, and the wells were identical to the test wells. The wells had RNA polymerase but no inhibitor and the value measured was Total polymerase activity (Total activity). 5 multiple holes are arranged. The mean value was taken for each well and is designated as meanTA.

Negative control wells, DNEV-RdRp protein solution after equal volume inactivation (100 ℃, 2min) was used instead of DNEV-RdRp protein solution, other wells were identical to the test wells. The RNA polymerase in this well is inactive and therefore will not synthesize double stranded RNA. 5 multiple holes are arranged. The wells were averaged and scored as meanNSA.

Positive control wells, which were identical to test wells, were substituted for test compound with equimolar amounts of positive control compound. 5 multiple holes are arranged. The positive control compound is JF-31-MG46, a DENV-RdRp inhibitor in the prior art. JF-31-MG 46: IUPAC name 2- {6-methoxy- [1,1' -biphenyl ] -3-yl } acetic acid; MolPort, Inc. USA, with the product number MolPort-006-827-314.

DENV-RdRp relative activity × (100 × "(sample-means nsa) ÷ (means ta-means nsa) ].

The results are shown in FIG. 5. RAI-13 significantly inhibited DENV-RdRp activity, and RAI-5 and RAI-14 had no effect on DENV-RdRp activity.

Example 7 inhibition of DENV-2 by RAI-13 is dose-dependent

DENV-2Tr1751, a strain of DENV-2Tr1751, is described in the following references: wang J, Gao N, Chen W, et al; preparation of Antibodies against Soluble ingredients bound by Soluble ingredients; dengue Bulletin-Volume 30,2006.

A549 cells: american Type Culture Collection (ATCC), accession number CCL-185.

First, cell culture

1. A549 cells were seeded into 6-well plates (5X 10)⁵Individual cells/well), cultured with DMEM medium for 24 hours.

2. After completion of step 1, the supernatant was aspirated, DENV-2Tr1751 was inoculated with a virus amount of MOI 0.1, and then cultured for 4 hours using a medium containing RAI-13.

3. After completion of step 2, the supernatant was aspirated and cultured for 48h with a fresh RAI-13-containing medium.

In step 2 and step 3, the concentration of RAI-13 was the same.

The preparation method of the culture medium containing RAI-13 comprises the following steps: the RAI-13 stock solution and DMEM medium were mixed. The preparation method of the RAI-13 mother liquor comprises the following steps: RAI-13 was dissolved in DMSO to give a mother liquor of RAI-13 at a concentration of 10 mM.

The concentrations of RAI-13 in the medium were set to: 0.25. mu.M, 0.5. mu.M, 1. mu.M, 2. mu.M or 4. mu.M. 5 multiple wells were set for each concentration.

Negative control wells, the RAI-13 stock solution was replaced with an equal volume of DMSO. Negative controls were set up in 5 duplicate wells.

Second, detecting

After completion of step one, cells were collected, total RNA was extracted and levels of viral RNA were determined by qRT-PCR analysis using a one-step SYBR PrimeScript RT-PCR kit.

Primers used for detecting the virus were as follows:

5'-TCATACTCTATGTGCACAGGAAAG-3'；

5'-CGATGAAGCTTGGCCGATAGAACTTCC-3'。

the hGAPDH gene is used as a reference gene. Primers used to detect the reference gene were as follows:

5’-ATCATCCCTGCCTCTACTGG-3’；

5’-GTCAGGTCCACCACTGACAC-3’。

RNA inhibition rate ═ (RNA abundance of negative control wells-RNA abundance of test wells) ÷ RNA abundance of negative control wells × 100%.

The results are shown in FIG. 6. In FIG. 6, the abscissa is the base 10 logarithm of the compound concentration (. mu.M). RAI-13 showed a dose-dependent inhibition of DENV2 with an EC50 value of 2.35. mu.M.

The levels of the positive and negative strand RNA of DENV-2 were determined (for positive strand detection, only 3 'primer was added for reverse transcription, 5' primer was added after reverse transcription was complete; for negative strand detection, only 5 'primer was added for reverse transcription, and 3' primer was added after reverse transcription was complete). The results of the treatment at 2. mu.M concentration of RAI-13 are shown in FIG. 7. The results show that both positive and negative strand RNA levels are reduced by about 50% under the effect of RAI-13.

The above results indicate that RAI-13 reduces DENV RNA synthesis by inhibiting the activity of DENV-RdRp.

Example 8 antiviral Activity of RAI-13 independent of its cytotoxicity

To exclude non-specific differences due to compound toxicity, the effect of RAI-13 on the growth of test cells was assessed using the cell counting Kit-8 (CCK-8).

The test cells were RAW264.7 or a549 cells.

CCK-8 is a kit for detecting cell proliferation, cell survival and cytotoxicity, is a widely-applied rapid high-sensitivity detection kit based on WST-8 (water-soluble tetrazolium salt, chemical name:2- (2-methoxy-4-nitrophenyl) -3- (4-nitrophenyl) -5- (2, 4-disulfophenyl) -2H-tetrazole monosodium salt), and is a substitute method of MTT method. The kit adopts water-soluble tetrazolium salt-WST-8, and can be reduced by some dehydrogenase in mitochondria to generate orange formazan in the presence of an electron coupling reagent. The more rapid the cell proliferation, the darker the color; the more cytotoxic, the lighter the color; the shade of the color and the number of cells were well linear for the same cells.

1. Test cells were seeded into 96-well plates (4X 10)⁴Individual cells/well), cultured with DMEM medium for 24 hours.

2. After completion of step 1, the supernatant was aspirated and cultured for 48 hours in a medium containing RAI-13.

The concentration of RAI-13 in the medium was set to 40. mu.M, 20. mu.M, 10. mu.M, 5. mu.M, 2.5. mu.M, 1.25. mu.M, or 0.625. mu.M, respectively. 5 multiple wells were set for each concentration.

The preparation method of the culture medium containing RAI-13 comprises the following steps: the RAI-13 stock solution and DMEM medium were mixed. The preparation method of the RAI-13 mother liquor comprises the following steps: RAI-13 was dissolved in DMSO to give a mother liquor of RAI-13 at a concentration of 10 mM.

Blank control wells, replace RAI-13 stock with an equal volume of DMSO. Negative controls were set up in 5 duplicate wells.

3. After completion of step 2, the supernatant was aspirated and cultured in DMEM medium containing 10% CCK-8 reagent for 1 hour.

4. After completion of step 3, the Optical Density (OD) values per well at 450nm were recorded on a microplate reader (Thermo, Varioskan Flash).

The OD450nm of the blank control well was recorded as cell viability 1.

The results are shown in FIG. 8. In FIG. 8, the abscissa is the base 10 logarithm of the compound concentration (. mu.M). The CC50 values for RAI-13 versus RAW264.7 and A549 cells were 13.22. mu.M and 20.75. mu.M, respectively. At concentrations below 10. mu.M, RAI-13 had no significant effect on cell viability. Thus, the antiviral activity of RAI-13 at this concentration was not associated with its cytotoxicity.

Example 9 in vitro determination of the binding Capacity of RAI-13 to test proteins Using biofilm optical interference

The binding capacity of RAI-13 to the test protein was measured in vitro using a fiber optic biosensor-based biofilm layer optical interference (BLI) technique. BLI technology enables real-time tracking of interactions between biomolecules and is an ideal choice for studying the interactions of proteins and other biomolecules.

Test proteins: hNV-RdRp or DNEV-RdRp. The protein solution prepared in example 2 (hNV-RdRp protein solution or DNEV-RdRp protein solution) was diluted with PBS buffer as a solvent to obtain a test protein solution.

RAI-13 was dissolved in DMSO to obtain a mother solution of RAI-13 having a concentration of 10mM, and then diluted with PBS buffer to obtain each RAI-13 solution. In the RAI-13 solution, the concentration of RAI-13 was 3.91. mu.M, 7.82. mu.M, 15.63. mu.M, 31.25. mu.M, 62.5. mu.M or 125. mu.M, respectively.

1. The test protein was biotinylated.

Mixing biotin (EZ-Link)^TM NHS-LC-LC-Biotin，Cat.#21343,Thermo Scientific^TM) Mixing with protein to be tested at a molar ratio of 1:1, reacting at room temperature for 1 hr, and passing through desalting column (Zeba)^TMSpin desaling Columns, Cat. #89883, Thermo) to remove unreacted biotin, resulting in a biotinylated test protein.

2. As the experiment adopts a Super Streptavidin (SSA) biosensor and adopts an Octet RED96(ForteBio, Inc., CA, USA) instrument,

(1) first detection baseline

The SSA sensor was immersed in PBS buffer and left to stand for 120s to reach equilibrium.

(2) Incubating biotinylated test proteins onto the sensor

The sensor probe was moved to a biotinylated test protein solution (protein concentration 50. mu.g/ml) and allowed to stand for 600s to immobilize the protein on the SSA sensor.

(3) Enclosed sensor

Moving the sensor to 5. mu.M biocytin: (

Biocytin, Cat. #28022, Thermo) was blocked for 60s in PBS buffer.

(4) Second detection baseline

The sensor was moved to the buffer solution and left to stand for 120s to reach equilibrium.

(5) Bonding of

Moving the sensor to RAI-13 solution and standing for 60s to obtain a Kon value;

(6) dissociation

The sensor was moved to the buffer solution and left to stand for 60s to obtain a Koff value.

The loading and detection are performed separately. The first plate had 3 columns, column 1 was PBS buffer for the first assay baseline, column 2 was biotinylated test protein solution for loading, and column 3 was 5 μ M biocytin in PBS buffer for blocking. The 2 nd plate has 12 columns, 1,3, 5, 7, 9, 11 th column with 5% (volume ratio) DMSO in PBS buffer for the second detection of baseline and dissociation, 2,4, 6, 8, 10, 12 th column RAI-13 solution (each column corresponding to a RAI-13 concentration).

A kinetic curve was obtained. Experimental Data were analyzed using ForteBio Data Analysis software Data Analysis 9.0. Dissociation rate constant KD ═ K_off/K_on。

The results are shown in FIG. 9. In FIG. 9, the abscissa represents the reaction time (in seconds), and the ordinate represents the signal intensity (in nm). RAI-13 was able to bind hNV-RdRp and DENV-RdRp, fitting KD values of 39.9. + -. 3.4. mu.M and 166. + -. 13.7. mu.M, respectively.

Example 10 preparation of hepatitis C Virus (Jc-1-Gluc HCVcc) and infectivity assay

Test viruses: hepatitis C virus (Jc1-Luc HCVcc virus); the following documents are described: human MxB inhibitors of the Replication of Hepatitis C Virus; Dong-Rong Yi, etc.; journal of Virology; january2019Volume 93Issue 1e 01285-18.

Huh7.5.1cells (huh7.5.1cells), described in: human MxB inhibitors of the Replication of Hepatitis C Virus; Dong-Rong Yi, etc.; journal of Virology; january2019Volume 93Issue 1e 01285-18.

The preparation method of the culture medium containing RAI-13 comprises the following steps: the RAI-13 stock solution and DMEM medium were mixed. The preparation method of the RAI-13 mother liquor comprises the following steps: RAI-13 was dissolved in DMSO to give a mother liquor of RAI-13 at a concentration of 10 mM.

1. Huh7.5.1cells were seeded into 96-well plates (2X 10)⁴Individual cells/well), cultured with DMEM medium for 24 hours.

2. After completion of step 1, the supernatant was aspirated, and the test virus was inoculated in a virus amount of MOI ═ 1 and cultured in a medium containing 1 μ M RAI-13 for 4 hours.

3. After completion of step 2, the supernatant was aspirated and cultured with fresh medium containing 1. mu.M RAI-13 for 48 h.

4. After completion of step 3, the activity of Gaussia luciferase (Gluc) was measured using a Centro XS3 LB 960 photometer, thereby measuring the amount of virus infection in the supernatant.

Negative control wells, the RAI-13 stock solution was replaced with an equal volume of DMSO.

The Gluc activity of the negative control well was taken as 1.

The results are shown in FIG. 10 (average of 5 replicates). Compared to the negative control wells, 1 μ M RAI-13 inhibited Jc1HCVcc infection by more than 95%.

The present invention has been described in detail above. While the invention has been described with reference to specific embodiments, it will be appreciated that the invention can be further modified. In general, this application is intended to cover any variations, uses, or adaptations of the invention following, in general, the principles of the invention and including such departures from the present disclosure as come within known or customary practice within the art to which the invention pertains. The use of some of the essential features is possible within the scope of the claims attached below.

SEQUENCE LISTING

<110> institute of medical and Biotechnology of Chinese academy of medical sciences

Application of <120> enrotinib in preparation of virus inhibitor

<130> GNCYX201205

<160> 4

<170> PatentIn version 3.5

<210> 1

<211> 510

<212> PRT

<213> Human norovirus

<400> 1

Gly Gly Asp Ser Lys Gly Thr Tyr Cys Gly Ala Pro Ile Leu Gly Pro

1 5 10 15

Gly Ser Ala Pro Lys Leu Ser Thr Lys Thr Lys Phe Trp Arg Ser Ser

20 25 30

Thr Thr Pro Leu Pro Pro Gly Thr Tyr Glu Pro Ala Tyr Leu Gly Gly

35 40 45

Arg Asp Pro Arg Val Lys Gly Gly Pro Ser Leu Gln Gln Val Met Arg

50 55 60

Asp Gln Leu Lys Pro Phe Thr Glu Pro Arg Gly Lys Pro Pro Arg Pro

65 70 75 80

Asn Val Leu Glu Ala Ala Lys Arg Thr Ile Ile Asn Val Leu Glu Gln

85 90 95

Thr Ile Asp Pro Pro Gln Lys Trp Ser Phe Ala Gln Ala Cys Ala Ser

100 105 110

Leu Asp Lys Thr Thr Ser Ser Gly His Pro His His Met Arg Lys Asn

115 120 125

Asp Cys Trp Asn Gly Glu Ser Phe Thr Gly Lys Leu Ala Asp Gln Ala

130 135 140

Ser Lys Ala Asn Leu Met Phe Glu Glu Gly Lys Asn Met Thr Pro Val

145 150 155 160

Tyr Thr Gly Ala Leu Lys Asp Glu Leu Val Lys Thr Asp Lys Val Tyr

165 170 175

Gly Lys Val Lys Lys Arg Leu Leu Trp Gly Ser Asp Leu Ala Thr Met

180 185 190

Ile Arg Cys Ala Arg Ala Phe Gly Gly Leu Met Asp Glu Leu Lys Ala

195 200 205

His Arg Val Thr Leu Pro Val Arg Val Gly Met Asn Met Asn Glu Asp

210 215 220

Gly Pro Ile Ile Phe Glu Lys His Ser Arg Tyr Arg Tyr His Tyr Asp

225 230 235 240

Ala Asp Tyr Ser Arg Trp Asp Ser Thr Gln Gln Arg Asp Val Leu Ala

245 250 255

Ala Ala Leu Glu Ile Met Val Lys Phe Ser Pro Glu Pro His Leu Ala

260 265 270

Gln Ile Ala Ala Glu Asp Leu Leu Ser Pro Ser Val Met Asp Val Gly

275 280 285

Asp Phe Gln Ile Ser Ile Ser Glu Gly Leu Pro Ser Gly Val Pro Cys

290 295 300

Thr Ser Gln Trp Asn Ser Ile Ala His Trp Leu Leu Thr Leu Cys Ala

305 310 315 320

Leu Ser Glu Val Thr Asp Leu Ser Pro Asp Ile Ile Gln Ala Asn Ser

325 330 335

Leu Phe Ser Phe Tyr Gly Asp Asp Glu Ile Val Ser Thr Asp Ile Lys

340 345 350

Leu Asp Pro Glu Lys Leu Thr Ala Lys Leu Lys Glu Tyr Gly Leu Lys

355 360 365

Pro Thr Arg Pro Asp Lys Thr Glu Gly Pro Leu Val Ile Ser Glu Asp

370 375 380

Leu Asp Gly Leu Thr Phe Leu Arg Arg Thr Val Thr Arg Asp Pro Ala

385 390 395 400

Gly Trp Phe Gly Lys Leu Glu Gln Ser Ser Ile Leu Arg Gln Met Tyr

405 410 415

Trp Thr Arg Gly Pro Asn His Glu Asp Pro Phe Glu Thr Met Ile Pro

420 425 430

His Ser Gln Arg Pro Ile Gln Leu Met Ser Leu Leu Gly Glu Ala Ala

435 440 445

Leu His Gly Pro Ala Phe Tyr Ser Lys Ile Ser Lys Leu Val Ile Ala

450 455 460

Glu Leu Lys Glu Gly Gly Met Asp Phe Tyr Val Pro Arg Gln Glu Pro

465 470 475 480

Met Phe Arg Trp Met Arg Phe Ser Asp Leu Ser Thr Trp Glu Gly Asp

485 490 495

Arg Asn Leu Ala Pro Ser Phe Val Asn Glu Asp Gly Val Glu

500 505 510

<210> 2

<211> 1530

<212> DNA

<213> Human norovirus

<400> 2

ggcggcgata gcaaaggtac ctattgcggt gcaccgattc tgggcccggg cagtgcaccg 60

aaactgagca ccaagaccaa gttttggcgt agcagtacca ccccgttacc gccgggtaca 120

tatgaaccgg catatttagg tggccgtgat ccgcgtgtga aaggtggtcc ttctttacag 180

caagttatgc gcgaccagct gaaacctttt acagaaccgc gcggcaaacc gcctcgtccc 240

aatgtgctgg aggccgccaa acgtaccatc attaatgttc tggaacagac catcgacccg 300

ccgcagaaat ggagttttgc ccaagcttgc gccagtctgg ataaaacaac cagcagtggc 360

cacccgcatc atatgcgcaa aaacgattgc tggaacggcg agagcttcac tggtaaactg 420

gcagatcaag ctagcaaagc caatttaatg ttcgaagaag gtaaaaatat gaccccggtg 480

tataccggtg ctttaaagga tgagctggtg aagaccgaca aagtgtatgg caaggtgaaa 540

aagcgtctgt tatggggcag cgatttagcc accatgattc gctgcgcacg cgcctttggt 600

ggtctgatgg atgagctgaa ggcccatcgc gttacactgc cggttcgcgt tggcatgaat 660

atgaacgaag acggcccgat catcttcgaa aaacacagcc gctaccgcta ccactatgat 720

gcagactaca gccgttggga tagtacacag cagcgtgatg tgctggccgc agcactggag 780

atcatggtga aattcagccc cgaaccgcat ctggcccaga ttgccgccga agatttactg 840

agcccgagtg ttatggacgt gggcgacttt cagatcagca tcagcgaagg tctgcctagt 900

ggcgtgccgt gtaccagcca gtggaatagc atcgcacact ggctgctgac cttatgcgct 960

ttaagcgaag tgaccgatct gagtcccgat atcatccaag ctaactcttt atttagcttc 1020

tacggcgacg acgagattgt tagcacagac attaaactgg atccggaaaa attaacagca 1080

aaactgaaag agtatggtct gaaaccgacc cgtccggata aaaccgaggg tccgctggtg 1140

atcagtgagg atttagatgg tttaacattt ctgcgtcgta ccgttacccg tgacccggct 1200

ggttggtttg gcaagctgga gcagagcagc attttacgcc agatgtactg gacacgtggt 1260

cctaatcacg aggacccgtt tgaaaccatg atcccgcaca gtcaacgccc gatccagctg 1320

atgagcttac tgggtgaggc cgcactgcat ggtccggcct tttacagtaa gatcagcaag 1380

ctggtgattg ccgagctgaa ggaaggtggt atggacttct acgtgccgcg ccaagaaccg 1440

atgtttcgct ggatgcgctt tagcgatctg agcacttggg aaggtgatcg taatttagca 1500

ccgagctttg tgaatgaaga tggtgtggag 1530

<210> 3

<211> 629

<212> PRT

<213> dengue virus

<400> 3

Asn Met Asp Val Ile Gly Glu Arg Ile Lys Arg Ile Lys Glu Glu His

1 5 10 15

Asn Ser Thr Trp His Tyr Asp Asp Glu Asn Pro Tyr Lys Thr Trp Ala

20 25 30

Tyr His Gly Ser Tyr Glu Val Lys Ala Thr Gly Ser Ala Ser Ser Met

35 40 45

Ile Asn Gly Val Val Lys Leu Leu Thr Lys Pro Trp Asp Val Val Pro

50 55 60

Met Val Thr Gln Met Ala Met Thr Asp Thr Thr Pro Phe Gly Gln Gln

65 70 75 80

Arg Val Phe Lys Glu Lys Val Asp Thr Arg Thr Pro Arg Pro Leu Pro

85 90 95

Gly Thr Arg Lys Val Met Glu Ile Thr Ala Glu Trp Leu Trp Arg Thr

100 105 110

Leu Gly Arg Asn Lys Arg Pro Arg Leu Cys Thr Arg Glu Glu Phe Thr

115 120 125

Lys Lys Val Arg Thr Asn Ala Ala Met Gly Ala Val Phe Thr Glu Glu

130 135 140

Asn Gln Trp Asp Ser Ala Lys Ala Ala Val Glu Asp Glu Glu Phe Trp

145 150 155 160

Lys Leu Val Asp Arg Glu Arg Glu Leu His Lys Leu Gly Lys Cys Gly

165 170 175

Ser Cys Val Tyr Asn Met Met Gly Lys Arg Glu Lys Lys Leu Gly Glu

180 185 190

Phe Gly Lys Ala Lys Gly Ser Arg Ala Ile Trp Tyr Met Trp Leu Gly

195 200 205

Val Arg Tyr Leu Glu Phe Glu Ala Leu Gly Phe Leu Asn Glu Asp His

210 215 220

Trp Phe Ser Arg Glu Asn Ser Tyr Ser Gly Val Glu Gly Glu Gly Leu

225 230 235 240

His Lys Leu Gly Tyr Ile Leu Arg Asp Ile Ser Lys Ile Pro Gly Gly

245 250 255

Ala Met Tyr Ala Asp Asp Thr Ala Gly Trp Asp Thr Arg Ile Thr Glu

260 265 270

Asp Asp Leu His Asn Glu Glu Lys Ile Ile Gln Gln Met Asp Pro Glu

275 280 285

His Arg Gln Leu Ala Asn Ala Ile Phe Lys Leu Thr Tyr Gln Asn Lys

290 295 300

Val Val Lys Val Gln Arg Pro Thr Pro Thr Gly Thr Val Met Asp Ile

305 310 315 320

Ile Ser Arg Lys Asp Gln Arg Gly Ser Gly Gln Val Gly Thr Tyr Gly

325 330 335

Leu Asn Thr Phe Thr Asn Met Glu Ala Gln Leu Val Arg Gln Met Glu

340 345 350

Gly Glu Gly Val Leu Thr Lys Ala Asp Leu Glu Asn Pro His Leu Leu

355 360 365

Glu Lys Lys Ile Thr Gln Trp Leu Glu Thr Lys Gly Val Glu Arg Leu

370 375 380

Lys Arg Met Ala Ile Ser Gly Asp Asp Cys Val Val Lys Pro Ile Asp

385 390 395 400

Asp Arg Phe Ala Asn Ala Leu Leu Ala Leu Asn Asp Met Gly Lys Val

405 410 415

Arg Lys Asp Ile Pro Gln Trp Gln Pro Ser Lys Gly Trp His Asp Trp

420 425 430

Gln Gln Val Pro Phe Cys Ser His His Phe His Glu Leu Ile Met Lys

435 440 445

Asp Gly Arg Lys Leu Val Val Pro Cys Arg Pro Gln Asp Glu Leu Ile

450 455 460

Gly Arg Ala Arg Ile Ser Gln Gly Ala Gly Trp Ser Leu Arg Glu Thr

465 470 475 480

Ala Cys Leu Gly Lys Ala Tyr Ala Gln Met Trp Ser Leu Met Tyr Phe

485 490 495

His Arg Arg Asp Leu Arg Leu Ala Ser Asn Ala Ile Cys Ser Ala Val

500 505 510

Pro Val His Trp Val Pro Thr Ser Arg Thr Thr Trp Ser Ile His Ala

515 520 525

His His Gln Trp Met Thr Thr Glu Asp Met Leu Thr Val Trp Asn Arg

530 535 540

Val Trp Ile Glu Glu Asn Pro Trp Met Glu Asp Lys Thr Pro Val Thr

545 550 555 560

Thr Trp Glu Asn Val Pro Tyr Leu Gly Lys Arg Glu Asp Gln Trp Cys

565 570 575

Gly Ser Leu Ile Gly Leu Thr Ser Arg Ala Thr Trp Ala Gln Asn Ile

580 585 590

Pro Thr Ala Ile Gln Gln Val Arg Ser Leu Ile Gly Asn Glu Glu Phe

595 600 605

Leu Asp Tyr Met Pro Ser Met Lys Arg Phe Arg Lys Glu Glu Glu Ser

610 615 620

Glu Gly Ala Ile Trp

625

<210> 4

<211> 1887

<212> DNA

<213> dengue virus

<400> 4

aacatggatg ttatcggcga gcgcatcaag cgcattaaag aagaacataa tagcacctgg 60

cattatgatg atgaaaatcc ttacaagaca tgggcatacc acggcagcta tgaagttaaa 120

gccaccggta gtgccagtag catgatcaat ggcgtggtga agctgctgac caaaccgtgg 180

gatgttgtgc ctatggtgac acagatggcc atgacagata ccacaccgtt tggtcagcag 240

cgcgttttta aggaaaaggt ggacacccgt acccctcgtc cgctgcctgg tacacgcaaa 300

gtgatggaga ttaccgccga atggttatgg cgcaccctgg gtcgcaataa acgtccgcgt 360

ctgtgtaccc gcgaagagtt tacaaagaaa gtgcgcacca acgccgccat gggtgccgtg 420

tttaccgaag aaaaccagtg ggacagcgcc aaagccgcag ttgaagacga ggagttctgg 480

aaactggtgg atcgcgagcg cgagctgcat aaactgggca aatgcggcag ctgcgtgtac 540

aatatgatgg gtaagcgcga aaagaaactg ggcgaattcg gtaaggcaaa aggtagccgt 600

gccatctggt atatgtggct gggcgttcgc tacctggaat ttgaagccct gggcttcctg 660

aacgaagacc actggtttag ccgcgaaaac agctatagcg gcgtggaagg cgaaggtctg 720

cataagctgg gctatattct gcgcgacatc agtaagatcc ctggcggcgc catgtacgca 780

gacgataccg ccggttggga tacccgtatc acagaggatg acctgcacaa cgaggagaag 840

atcatccagc agatggaccc ggaacatcgt cagctggcca atgccatctt caaactgacc 900

tatcagaata aggtggtgaa agtgcagcgt ccgaccccga ccggtacagt gatggacatt 960

atcagccgca aggaccagcg cggtagtggc caggtgggca catatggctt aaacaccttt 1020

acaaatatgg aggcccagct ggttcgtcag atggagggcg aaggcgttct gaccaaagcc 1080

gatctggaga acccgcacct gttagagaaa aagatcaccc agtggctgga aaccaagggc 1140

gttgagcgtc tgaaacgtat ggccatcagc ggcgatgact gcgtggtgaa accgattgat 1200

gaccgcttcg ccaacgcact gctggcactg aacgatatgg gcaaagttcg caaggatatt 1260

ccgcagtggc agccgagcaa gggctggcat gactggcagc aggttccgtt ttgcagccat 1320

cattttcatg aattaatcat gaaagacggt cgtaaactgg ttgtgccttg tcgcccgcag 1380

gatgaactga tcggccgtgc ccgtatcagt cagggcgcag gttggagtct gcgtgaaacc 1440

gcctgcctgg gtaaagcata cgcacagatg tggagcctga tgtatttcca ccgtcgcgat 1500

ctgcgcctgg ccagtaacgc aatttgcagc gccgtgcctg tgcactgggt tccgaccagc 1560

cgtaccacct ggagcattca tgcacatcac cagtggatga caaccgaaga tatgctgacc 1620

gtgtggaatc gtgtgtggat cgaggaaaac ccgtggatgg aagacaaaac ccctgttacc 1680

acctgggaga atgtgccgta tctgggtaaa cgcgaggacc aatggtgcgg tagcttaatc 1740

ggtctgacca gccgtgccac ctgggcccag aatatcccga cagccattca gcaagtgcgc 1800

agcctgattg gcaacgaaga gtttctggac tacatgccga gcatgaaacg cttccgcaaa 1860

gaggaagaga gtgaaggtgc catctgg 1887

Claims (3)

1. The use of a compound of formula (I) or a pharmaceutically acceptable salt thereof in the preparation of a viral inhibitor;

the virus is a single-stranded positive-stranded RNA virus.

2. The use of a compound of formula (i) as claimed in claim 1 or a pharmaceutically acceptable salt thereof in the manufacture of a product; the product is used for treating diseases caused by virus infection; the virus is a single-stranded positive-stranded RNA virus.

3. Use of a compound of formula (i) as claimed in claim 1 or a pharmaceutically acceptable salt thereof in the manufacture of an inhibitor of viral RdRp; the virus is a single-stranded positive-stranded RNA virus.

Images