CN111537732B - Application of salmonella gallinarum SifA protein in preparation of ELISA antibody detection kit for detecting salmonella gallinarum antibody - Google Patents

Abstract

The invention discloses an application of a salmonella gallinarum SifA protein in preparing an ELISA antibody detection kit for detecting an antibody of the salmonella gallinarum, wherein the salmonella gallinarum SifA protein is expressed and purified to be used as an envelope antigen of ELISA, the working procedure of the kit is optimized, standard positive serum of salmonella pullorum, salmonella enteritidis, salmonella typhimurium, escherichia coli, pasteurella, bordetella and avibacterium paragallinarum is prepared by SPF (specific pathogen free) chickens, standard negative serum is prepared by healthy SPF chickens, and the prepared positive serum and the prepared negative serum are detected by the kit, so that the kit has good specificity. The kit provided by the invention detects clinical serum in large batch, and is compared with a glass plate agglutination test commonly used for clinical detection of salmonella, so that the practicability of the kit is proved. The kit can be used for detecting the antibody after the infection of the salmonella gallinarum, and provides a quick and accurate antibody detection method for the salmonella gallinarum.

Description

Application of salmonella gallinarum SifA protein in preparation of ELISA antibody detection kit for detecting salmonella gallinarum antibody

Technical Field

The invention relates to the technical field of biotechnology and animal bacteriology detection, and particularly relates to application of a salmonella gallinarum SifA protein in preparation of an ELISA antibody detection kit for detecting a salmonella gallinarum antibody.

Background

The salmonella is one of the pathogenic bacteria of zoonosis reported by the national health organization legal, is classified as two types of infectious diseases in China, and poses great threats to the animal husbandry production and human health (rosa laevigata, huangcuiying, wanfang, liu bo wen, pan shiming, gunning, pyronew safety)]Chinese society of veterinary medicine, 2018, academic annual meeting, college of avian diseases, nineteenth academic seminar proceedings, Chinese society of veterinary medicine, 2018, 114). The salmonella is one of food-borne pathogenic bacteria, and can cause salmonellosis to people through polluted eggs or meat products and the like, and symptoms such as diarrhea, vomiting, fever, septicemia and the like appear, thereby seriously harming food safety and public health (Lizhuoyang, Guosheng, Bangnang, Zhangzeng, Gunsheng, Jiaxinan, Panshiming, Salmonella enteritidis and eggs: pollution mechanism, harm analysis and biological control [ J]Chinese poultry, 2018, 40(17): 40-44). Salmonella is extremely harmful to the chicken industry, can cause serious economic loss, adult chicken infection may have atypical symptoms such as diarrhea, inappetence, laying rate reduction, hatchability reduction and the like, some chickens may be invisible in a recessive infection state, can be horizontally transmitted or vertically transmitted, and chickens surviving in the infection process may become an infection source of salmonella (Eriksson H,

R,Ernholm L,Melin L,Jansson D S.Diagnostics,epidemiological observations and genomic subtyping in an outbreak of pullorum disease in non-commercial chickens[J]vet Microbiol,2018,217: 47-52). The high-level infection and the continuous existence of the salmonella in the chicken flocks need to establish an efficient, specific, sensitive and stable detection method so as to detect the occurrence of the disease in time and prevent the disease.

Among the methods for detecting salmonellosis, pathogen-based detection methods require consideration of intermittent detoxification of salmonella, collection of samples is time-consuming and labor-consuming and samples are easily contaminated during collection or transportation (king jee, chen glu yu, peng clean, guo ei zhen. The detection method based on the serum antibody does not need to consider whether the infected animal is in the detoxification period, the collected whole blood or serum is not easy to be polluted, and the detection method is more convenient. The method for detecting the salmonella gallinarum serum antibody recommended by OIE is a glass plate agglutination test and plays an important role in the purification of pullorum disease in countries such as Europe (world animal health organization, terrestrial animal diagnosis test and vaccine manual [ M ]. Beijing: Chinese agriculture press 2012: 514-529).

At present, the glass plate agglutination test is a commonly used detection method for purifying salmonella pullorum in chicken farms in China, and the antigen is prepared by culturing standard and variant salmonella pullorum and salmonella gallinarum in a proper culture medium, harvesting thalli, inactivating, treating with ethanol, and adding crystal violet, glycerol and the like (refer to antigen specification of agglutination test of polyvalent staining plates of salmonella gallinarum by Beijing Zhonghai Biotech Co., Ltd.). Since the antigen of the plate agglutination test is a multivalent antigen, the specificity is not very strong. Although the method is simple to operate, low in cost and capable of being operated on site without professional operation, the method is low in sensitivity and specificity, strong in subjectivity and different in detection results of different manufacturers or different batches of the same manufacturer (looking after snow, Liuyang, Hostaqi, Liuyuliang, Hanxue, Zqian, Zhai new test, Wang Yinxin, pullorum/Salmonella typhi antibody detection reagent comparison and evaluation.

Compared with a glass plate agglutination test, the ELISA has high detection sensitivity and strong specificity, can carry out quantitative detection, does not need special treatment on samples, can detect a large number of samples in a short time, saves time and labor, has low cost, and can be used for monitoring and diagnosing diseases (Kuhn K G, Falkenhorst G, Ceper T H, Dalby T, Ethelberg S,

K,Krogfelt K A.Detecting non-typhoid Salmonella in humans by ELISAs:a literature review[J].J Med Microbiol,2012,61:1–7)。

therefore, the establishment of a sensitive and specific ELISA detection method for the antibody of the salmonella gallinarum is urgently needed to achieve the aim of more sensitive, specific, rapid, efficient and batch detection.

Disclosure of Invention

The invention aims to overcome the defects of the prior art and provides the application of the salmonella gallinarum SifA protein in preparing an ELISA antibody detection kit for detecting the salmonella gallinarum antibody, and the core of the invention is to establish the salmonella gallinarum SifA-ELISA antibody detection kit by taking the purified recombinant SifA protein as an ELISA coated antigen; the SifA protein is highly conserved in salmonella and has low homology with other pathogenic bacteria through homology comparison. The detection of the chicken-derived standard positive serum and the standard negative serum prepared by SPF chicken also proves that the detection kit for the chicken salmonella SifA-ELISA antibody has good specificity and good detection effect in the detection of clinical serum. The kit provides important reference significance in serodiagnosis and seroepidemiological investigation of the salmonella gallinarum.

In order to realize the purpose, the invention designs the application of the salmonella gallinarum SifA protein in preparing an ELISA antibody detection kit for detecting the salmonella gallinarum antibody, wherein the amino acid sequence composition of the salmonella gallinarum SifA protein is shown as SEQ ID No. 2.

The invention also provides a salmonellae antibody SifA-ELISA antibody detection kit for detecting the salmonellae antibody, which comprises an ELISA plate with salmonellae SifA protein as a coating antigen, positive control serum prepared by infecting SPF chickens with salmonella, negative serum of healthy SPF chickens, rabbit anti-chicken enzyme-labeled secondary antibody, serum diluent, 10-fold concentrated cleaning solution, developing solution A, developing solution B and stop solution.

Further, the method for manufacturing the ELISA plate comprises the following steps:

the chicken salmonellae SifA protein is diluted to 0.25 mu g/mL by 0.5M carbonate buffer solution with the pH value of 9.6, 100 mu L of the protein is added into each enzyme labeling hole, the mixture is coated for 12h at the temperature of 4 ℃, defatted milk with the mass fraction of 5 percent is prepared by PBS buffer solution to be used as a sealing solution, and the mixture is incubated for 2h at the temperature of 37 ℃ in an incubator.

Furthermore, the nucleotide sequence of the chicken salmonellosis sifA gene corresponding to the chicken salmonellosis sifA protein is shown as SEQ ID No. 1.

Still further, the preparation method of the salmonella gallinarum SifA protein comprises the following steps:

1) synthesizing according to the nucleotide sequence of the salmonella gallinarum sifA gene to obtain the salmonella gallinarum sifA gene, and designing a primer with an enzyme cutting site:

P1，CCGGAATT(EcoR I)CCCGATTACTATAGGGAATGG，

P2，CCGCTCGAG(Xho I)TTAGCCGCTTTGTTGTTCT；

2) connecting the PCR product with pET-28a carrier by enzyme digestion to construct recombinant plasmid pET-28a-sifA, transforming the group plasmid pET-28a-sifA into escherichia coli competent cells BL21(DE3), carrying out amplification culture by using LB liquid culture medium, and adding IPTG to induce the expression of protein;

3) and centrifuging the induced escherichia coli, taking the precipitate, adding a buffer solution for resuspension, crushing the resuspended thalli by using a low-temperature ultrahigh-pressure cell crusher, centrifuging, taking supernate, and purifying the SifA protein in the supernate to obtain the recombinant protein SifA, namely the salmonella gallinarum SifA protein.

Further, the positive control serum is serum prepared by collecting blood from the inferior pterygoid vein 20 days after SPF chicken are infected with salmonella (salmonella pullorum, salmonella enteritidis and salmonella typhimurium); the negative serum of the healthy SPF chicken is the serum of the healthy SPF chicken under the same condition;

the serum diluent is as follows: PBS (pH7.4) buffer solution contains bovine serum albumin with mass fraction of 0.2% and Tween-20 with volume fraction of 0.05%;

the 10-fold concentrated washing solution: concentrating 10 times PBS (pH7.4), adding 0.5% volume fraction Tween-20, mixing, and packaging into 30 mL/bottle;

the color developing liquid A: citric acid 9.33g, Na₂HPO₄·12H₂Adding 700mL of deionized water into 14.60g of O and 0.52g of carbamide peroxide for dissolving, adjusting the pH value to 5.0-5.4, fixing the volume to 1000mL, and subpackaging into 10 mL/bottle;

the color developing liquid B: 10mg of tetramethylbenzidine and 5mL of absolute ethyl alcohol are dissolved by adding deionized water, the volume is determined to be 500mL, and the mixture is subpackaged into 10 mL/bottle;

the stop solution is as follows: 1.25mL of hydrofluoric acid solution was added to 300mL of deionized water, and the volume was adjusted to 500mL and the mixture was dispensed into 10mL bottles.

The invention also provides the salmonellae strain SifA-ELISA antibody detection kit, which comprises the following steps:

1) diluting chicken serum to be detected by a serum diluent by 1:200 times, adding 100 mu L of each sample into an enzyme label plate, respectively adding positive control serum and 100 mu L of healthy SPF chicken negative serum into the enzyme label plate, incubating in a 37 ℃ incubator for 30min, discarding the diluted serum in the enzyme label plate, adding 200 mu L of a washing solution into each hole, standing for 5min, discarding the washing solution and drying, and repeatedly washing for 3 times; wherein the chicken serum to be detected is serum prepared by collecting blood from the subclavian vein of a clinical chicken;

2) diluting rabbit anti-chicken enzyme-labeled secondary antibody with PBS at a ratio of 1:10000, adding 100 μ L of the diluted secondary antibody into each hole, and incubating the diluted secondary antibody in an incubator at 37 ℃ for 30 min; discarding the enzyme-labeled secondary antibody, adding 200 μ L of washing solution into each hole, standing for 5min, discarding the washing solution, drying, and repeatedly washing for 3 times;

3) adding 50 μ L of developing solution A into each well, adding 50 μ L of developing solution B, mixing, developing at room temperature (25 deg.C) in dark for 15min, adding 50 μ L of stopping solution into each well, and measuring absorbance (OD) at 630nm wavelength in enzyme-linked immunosorbent assay (ELISA) for 10min₆₃₀) The value is obtained.

4) And (4) judging a result: and (3) judging a negative critical value and a positive critical value (cut-off) according to a statistical analysis method:

when the S/P value is more than or equal to 0.268, the positive result is judged, and the positive result indicates that the sample contains the salmonella antibody;

and when the S/P value is less than 0.268, the sample is judged to be negative, and the negative result indicates that the sample does not contain the salmonella antibody.

The invention has the beneficial effects that:

the antigen coated by the kit is recombinant protein SifA (chicken salmonellosis SifA protein), the protein is highly conserved in salmonella and has very low amino acid homology with non-salmonella bacteria, the antigen specificity is improved by using the SifA recombinant protein as the coating antigen, and the recombinant protein has good stability and is easy to prepare in large quantities.

The salmonella gallinarum SifA-ELISA antibody detection kit for detecting the salmonella gallinarum antibody can specifically and sensitively detect the salmonella antibody in chicken serum, thereby accurately judging a sample. The kit has low detection cost, can detect a large amount of samples at high flux, and has important practical significance for the rapid and large-scale detection of the salmonella gallinarum antibodies.

Drawings

FIG. 1 is a PCR amplification plot of the salmonellae margaritae sifA gene;

FIG. 2 is a diagram of the expression and purification of the recombinant protein SifA;

FIG. 3 is a Western blot identification of recombinant protein SifA;

FIG. 4 is a diagram of the specificity of the detection kit for detecting the SifA-ELISA antibody of the salmonella gallinarum for detecting the serum of the salmonella gallinarum and the serum of the chicken of other avian bacterial diseases;

FIG. 5 is a graph showing the change of serum antibodies per week after the detection of the antibody detection kit for SifA-ELISA of the salmonella gallinarum in SPF chickens infected with Salmonella pullorum.

Detailed Description

The present invention is described in further detail below with reference to specific examples so as to be understood by those skilled in the art.

EXAMPLE 1 Synthesis or cloning of the Gene of interest (sifA)

(1) Synthesis of Salmonella gallinarum sifA Gene

The salmonella gallinarum sifA gene can be obtained by synthesis, and the nucleotide sequence is shown as SEQ ID No. 1.

(2) Amplification of the Salmonella gallinarum sifA Gene

The Primer for amplifying the salmonella gallinarum sifA gene is designed by using Primer Premier 5 software according to the salmonella gallinarum gene sequence accession number CP007319.2 in GenBank, the Primer nucleic acid is synthesized by Wuhan engine science and technology Limited, and the Primer sequence is as follows:

P1，CCGGAATT(EcoR I)CCCGATTACTATAGGGAATGG，

P2，CCGCTCGAG(Xho I)TTAGCCGCTTTGTTGTTCT。

performing PCR amplification by using a salmonella enteritidis SA083 genome as a template, wherein the PCR system is as follows: the total volume is 50 mu L, and 22 mu L ddH is added into each PCR tube₂O, 25. mu.L of Primer STAR Max DNApolymerase, 1. mu.L each of the upstream Primer and the downstream Primer, and 1. mu.L of the Salmonella enteritidis SA083 genome.

The PCR reaction program is: pre-denaturation at 98 ℃ for 2min, denaturation at 98 ℃ for 10s, renaturation at 52 ℃ for 15s, extension at 72 ℃ for 90s and 30 cycles, and finally extension at 72 ℃ for 5min to obtain a PCR product. The product was detected by agarose gel electrophoresis at 1% mass fraction, and the result showed that the fragment was the same size as expected (FIG. 1).

(3) Construction of the sifA recombinant plasmid

Dissolving the synthesized DNA recombinant fragment or PCR amplified fragment with deionized water, performing double enzyme digestion on the pET-28a vector and the target gene recovered by PCR by adopting EcoR I and Xho I respectively, and placing in a constant temperature box at 37 ℃ for reaction for 3 hours. And (3) purifying the product subjected to double enzyme digestion, measuring the nucleic acid concentration of the product, connecting the product by using quick ligase according to a proper molar ratio (the molar ratio is 3-10: 1), and standing the product at 16 ℃ for 30 min. Taking out an escherichia coli competent cell DH5 alpha in a refrigerator at the temperature of-80 ℃, transforming the ligation product into escherichia coli DH5 alpha, culturing at the temperature of 37 ℃ overnight until a single colony grows out, picking up the single colony to extract a plasmid, and identifying that the sequence of the recombinant pET-28a-sifA plasmid is 100 percent homologous with the sequence shown in SEQ ID No.1 through sequencing.

(4) Prokaryotic expression and purification of SifA recombinant protein

The recombinant plasmid pET-28a-sifA with correct sequencing is transformed into an Escherichia coli competent cell BL21(DE 3). And (3) carrying out incubator culture at 37 ℃ for 10-15 h, picking a single colony containing the recombinant plasmid into 5mL of LB liquid culture medium containing kanamycin resistance, and carrying out shake culture at 37 ℃ for 10-15 h.

Transferring the bacterial liquid containing the recombinant plasmid into LB liquid culture medium containing kanamycin resistance, and performing shake culture at 37 ℃ until the bacterial liquid OD₆₀₀At a value of around 0.6, IPTG was added to a final concentration of 0.8 mM. The cultivation was continued in a shaker at 37 ℃ for 5 h. The cells were centrifuged at 12000 Xg for 10min in a large-volume centrifuge, and then suspended in 1/10 volumes of binding buffer. And (3) crushing the resuspended thalli by using a low-temperature ultrahigh-pressure cell crusher at 4 ℃, repeatedly crushing for 5-8 times, then centrifuging for 10min at 4 ℃ at 12000 Xg, and collecting supernatant for later use.

And (3) purifying the protein by using Ni Sepharose 6Fast Flow filler (the filler is stored in ethanol with the volume fraction of 20%) of GE Healthcare company, eluting the protein by using imidazole with different concentrations of 5 mM-300 mM respectively, and finally determining that the SifA protein washing buffer contains 50mM imidazole and can wash off the hybrid protein and the elution buffer contains 150mM imidazole and can elute the target protein. After obtaining the purified target protein, the concentration of SifA protein was 261. mu.g/mL as determined by BCA protein concentration assay kit, and the purified recombinant protein was analyzed by SDS-PAGE (FIG. 2).

The IPTG (0.8 mM): weighing 4g of IPTG, dissolving in distilled water, diluting to a constant volume of 20mL, filtering and sterilizing by using a 0.22 mu m filter, subpackaging and storing at-20 ℃.

Binding buffer (5mM imidazole buffer): weighing 2.42g of Tris-base, 29.22g of NaCl29 and 0.34g of imidazole, dissolving in distilled water, adjusting the pH value to 7.4, metering to 1L, filtering by a 0.22 mu m filter, and storing at 4 ℃ for later use.

(5) Western blot identification of recombinant SifA protein

After the purified SifA protein is subjected to electrophoresis and membrane transfer, the expressed protein is subjected to Western blot verification by using a mouse anti-His monoclonal antibody as a primary antibody, and the result shows that only a specific band is detected at a corresponding position of the target protein under the condition of the mouse anti-His monoclonal antibody, and the purified protein is further determined to be the target protein, namely the salmonella gallinarum SifA protein (fig. 3).

Example 2 preparation of Standard Positive and negative sera

The 21-day-old healthy SPF chickens are randomly divided into 7 infection groups and 1 control group, each group comprises 15 chickens, and the infection groups are respectively a pullorum disease salmonella group, an enteritis salmonella group, a typhimurium salmonella group, an escherichia coli group, a pasteurella group, a bordetella group and a paragallinacea avian bacillus group. Each infection group was further randomized into 3 infection gradients, 5 chickens per gradient. Wherein, the oral gavage infection of the pullorum disease salmonella, the enteritis salmonella, the typhimurium, the colibacillus and the paragallinarum is caused; pasteurella, bordetella, nasal drops and ocular infections. And in the gavage infection group, the patients are deprived of food 12h before infection and are deprived of water 4h before infection, and 0.5mL of sodium bicarbonate solution with the mass fraction of 5% is orally taken 0.5h before infection to neutralize gastric acid. The specific infection pattern is shown in table 1.

Continuously observing the death condition of the infected SPF chickens after the infected SPF chickens are infected, collecting blood of experimental chickens through veins under wings every week, separating serum, storing the experimental chickens in a refrigerator at the temperature of-80 ℃ for later use, and detecting the generation condition of antibodies through a glass plate agglutination experiment every week; blood is collected by escherichia coli, pasteurella, bordetella and avibacterium paragallinarum every week, and the whole bacteria antigen indirect ELISA of each strain is used for detecting the generation of the antibody until the antibody titer meets the requirement.

TABLE 1 number and dose of SPF-chickens infected

Example 3 determination of detection conditions of the Salmonella gallinarum SifA-ELISA antibody detection kit

(1) Determination of optimal coating concentration of antigen

The antigen coating concentration and the dilution factor of the primary antiserum were determined according to a square matrix experiment. Diluting the recombinant protein to 1 mug/mL, 0.5 mug/mL, 0.25 mug/mL, 0.125 mug/mL, 0.062 mug/mL, 0.031 mug/mL, 0.016 mug/mL and 0.008 mug/mL respectively for 8 gradients, diluting the serum according to 1:50, 1:100, 1:200 and 1:400 times, diluting the enzyme-labeled secondary antibody according to 1:10000 times,the remaining conditions were according to conventional ELISA procedures. Detection of OD₆₃₀Values, determine the optimal coating concentration of antigen and optimal dilution of serum. Selection of OD of Positive serum₆₃₀The value is about 1.0, and positive serum OD₆₃₀Negative serum OD₆₃₀The maximum (P/N) value was used as the optimal antigen coating concentration and serum dilution factor. The results show (Table 2) that the optimal antigen coating concentration was 0.25. mu.g/mL and the serum was diluted 1: 200-fold.

TABLE 2 determination of optimal antigen coating concentration and serum-antibody working concentration

Note: "+" is positive serum; "-" is negative serum

(2) Selection of the best confining liquid type

And respectively selecting the optimal concentration of Fetal Bovine Serum (FBS) with the volume fraction of 1%, the optimal concentration of Bovine Serum Albumin (BSA) with the mass fraction of 2% and the optimal concentration of skim milk with the mass fraction of 5% as a sealing liquid after the antigen of the salmonella gallinarum SifA-ELISA antibody detection kit is coated, and performing conventional ELISA operation steps under the rest conditions. Each condition was repeated 3 wells each, and OD was detected₆₃₀Taking the average value, and taking the maximum P/N value as the optimal confining liquid. The results (Table 3) show that the best confining liquid is skim milk with 5% by mass since the P/N value is the largest when skim milk with 5% by mass is used as the confining liquid.

TABLE 3 selection of optimal confining liquid species

Note: "+" is positive serum; "-" is negative serum

(3) Selection of optimal confining liquid time

Adding 5 wt% of skimmed milk at 37 deg.C in incubator according to the above determined optimum conditionsAnd (3) respectively sealing the enzyme label plate of the sealing liquid for 0.5h, 1h, 1.5h, 2h, 2.5h and 3h, and performing conventional ELISA operation steps under the other conditions. OD detection was performed by repeating 3 wells each for each blocking time₆₃₀Taking the average value, and setting the maximum P/N value as the optimal closing time. The results (Table 4) show that the P/N value is the greatest when the blocking time is 1.5h, so the optimum blocking time is 1.5 h.

TABLE 4 selection of optimal confining liquid time

Note: "+" is positive serum; "-" is negative serum

(4) Selection of optimal incubation time for primary antiserum

And (3) according to the optimized optimal conditions, incubating the ELISA plates with the added serum-antibody for 30min, 45min, 60min, 75min and 90min in a 37 ℃ incubator respectively, and performing conventional ELISA operation steps on the rest conditions. OD was measured by repeating 3 wells at each time₆₃₀Taking the average value, and the maximum P/N value is the optimal action time of the primary antibody. The results show (Table 5) that the P/N is significantly greater for 30min and 45min incubations of the primary antibody than for several others, and the difference between the P/N values for 30min and 45min is not significant, so that the incubation time of the primary antibody is 30min in order to save the time for the assay.

TABLE 5 selection of optimal incubation time for primary antiserum

Note: "+" is positive serum; "-" is negative serum

(5) Selection of optimal incubation time for enzyme-labeled secondary antibody

And (3) according to the optimized optimal conditions, incubating the ELISA plate added with the second enzyme-labeled antibody for 30min, 45min, 60min, 75min and 90min respectively in a 37 ℃ incubator, and performing conventional ELISA operation steps on the rest conditions. OD was measured by repeating 3 wells at each time₆₃₀The values are averaged, and the maximum P/N value is the optimal action time of the secondary antibody. The results show (Table 6) that the P/N ratio was significantly greater at 30min incubation with the enzyme-labeled secondary antibody than at several other incubations, so the incubation time with the secondary antibody serum was defined as 30 min.

TABLE 6 selection of optimal incubation time for enzyme-labeled secondary antibodies

Note: "+" is positive serum; "-" is negative serum

(6) Selection of optimal color development time

Developing at room temperature (25 deg.C) according to the optimized optimal conditions, incubating the enzyme-labeled plate with developing solution for 5min, 10min, 15min, and 20min, and detecting OD₆₃₀Taking the average value, and taking the maximum P/N value as the optimal color development time of the substrate. As a result, it was found (Table 7) that the P/N ratio was significantly higher at the development time of 15min than at the other several stages, so that the development time was set to 15 min.

TABLE 7 selection of optimal incubation time for enzyme-labeled secondary antibodies

Note: "+" is positive serum; "-" is negative serum

(7) Determination of negative and positive cut-off

A total of 50 negative sera from healthy SPF chickens were selected and verified by glass plate agglutination tests. OD (origin-destination) detection by using optimized salmonella gallinarum SifA-ELISA antibody detection kit₆₃₀The value is obtained.

TABLE 8.50 detection of negative sera

OD of negative serum selected as above₆₃₀Value (Table 8) calculationS/P value, S/P ═ OD of test sample₆₃₀Negative control OD₆₃₀) /(Positive control OD₆₃₀Negative control OD₆₃₀)。

And (3) judging a negative critical value and a positive critical value (cut-off) according to a statistical analysis method:

when the S/P value of the detected sample is more than or equal to the S/P average value

(standard deviation), the test piece was judged to be positive; when the S/P value of the sample is

If yes, judging the test result as negative;

by the above formula and determination method, the negative and positive critical values (cut-off) are:

when the S/P value is more than or equal to 0.268, the positive result is judged, and the positive result indicates that the sample contains the salmonella antibody;

and when the S/P value is less than 0.268, the sample is judged to be negative, and the negative result indicates that the sample does not contain the salmonella antibody.

Example 4 preparation of Salmonella gallinarum SifA-ELISA antibody detection kit

(1) Preparation of recombinant protein ELISA plate

The purified SifA protein of the strain of salmonellae is used as a coating antigen, the SifA protein of the strain of salmonellae is diluted to 0.25 mu g/mL by 0.5M carbonate buffer solution with the pH value of 9.6, 100 mu L of the diluted protein is added into each hole, the solution is placed at 4 ℃ overnight, the solution is discarded and dried by beating, 200 mu L of PBST washing solution is added, the solution is kept stand for 5min, and the washing is repeated for 3 times.

Then adding 200 μ L PBS (pH7.4) containing 5% skimmed milk, incubating at 37 deg.C for 2 hr, discarding liquid and draining, adding 200 μ L PBST washing solution, standing for 5min, repeatedly washing for 3 times, air drying, vacuum packaging, and storing at low temperature.

The washing solution comprises: PBS (pH7.4) containing Tween-20 (Tween-20) at a volume fraction of 0.05%.

The sealing liquid is prepared by the following steps: PBS (pH7.4) containing 5% of skimmed milk.

(2) Composition of salmonellas sifA-ELISA antibody detection kit

The kit comprises 2 salmonellae acutae SifA-ELISA detection plates which are detachable, 1 bottle (50 mL/bottle) of serum diluent, 1 tube (50 mu L/tube) of negative control serum and positive control serum, 1 bottle (30 mL/bottle) of 10-time concentrated washing solution, 1 bottle (20 mL/bottle) of horseradish peroxidase-labeled rabbit anti-chicken secondary antibody, and 1 bottle (10 mL/bottle) of developing solution A, developing solution B and stop solution.

The detection plate: purified chicken salmonellae SifA protein is used as coating antigen, the chicken salmonellae SifA protein is diluted to 0.25 mu g/mL by 0.1mol/L of pH9.6 carbonate buffer solution, 100 mu L of the solution is added into each hole, after the solution is placed at 4 ℃ overnight, the solution is washed by PBST for 3 times, 200 mu L of PBS buffer solution (pH7.4) containing 0.05g/mL skimmed milk powder is added into each hole, and the solution is blocked for 2 hours at 37 ℃.

The serum diluent is as follows: 50mL of PBS buffer (pH7.4).

The sample wash (PBST): is PBS buffer containing Tween-20 with volume fraction of 0.05%.

The negative control serum and the positive control serum: the positive control serum is prepared by collecting blood of infrapteral vein 20 days after SPF chicken is infected with salmonella (Salmonella pullorum, Salmonella enteritidis, and Salmonella typhimurium); the negative control serum was serum from healthy SPF chickens.

The horseradish peroxidase-labeled rabbit anti-chicken secondary antibody: purchased from Wuhan Ante Jie Biotech limited (import Split charging).

The serum diluent is as follows: PBS (pH7.4) buffer contains bovine serum albumin with a mass fraction of 0.2% and Tween-20 with a volume fraction of 0.05%.

The 10-fold concentrated washing solution: adding 0.5% Tween-20 into 10 times of concentrated PBS (pH7.4), mixing, and packaging into 30 mL/bottle.

The color developing liquid A: citric acid 9.33g, Na₂HPO₄·12H₂14.60g of O and 0.52g of carbamide peroxide, adding 700mL of deionized water for dissolving, adjusting the pH value to 5.0-5.4, fixing the volume to 1000mL, and subpackaging into 10 mL/bottle.

The color developing liquid B: 10mg of tetramethyl benzidine and 5mL of absolute ethyl alcohol are added with deionized water to be dissolved and the volume is adjusted to 500mL, and the mixture is subpackaged into 10 mL/bottle.

The stop solution is as follows: 1.25mL of hydrofluoric acid solution was added to 300mL of deionized water, and the volume was adjusted to 500mL and the mixture was dispensed into 10mL bottles.

(3) Procedure for the kit

Taking out the detection plate, adding diluted sample to be detected, negative control serum and positive control serum into the hole of the detection plate respectively, incubating at 37 ℃ for 30min for 100 mu L of each hole, discarding liquid and patting dry, adding 200 mu L of PBST washing solution, standing for 5min, and repeatedly washing for 3 times.

Adding rabbit anti-chicken secondary antibody marked by horseradish peroxidase into detection wells, placing 100 μ L of the rabbit anti-chicken secondary antibody into each detection well, incubating for 30min at 37 ℃, removing liquid and beating to dry, adding 200 μ L of PBST cleaning solution, standing for 5min, and repeatedly washing for 3 times.

Adding 50 μ L of color development liquid A into each well, adding 50 μ L of color development liquid B, mixing, developing at room temperature (25 deg.C) in dark for 15min, adding 50 μ L of stop solution into each well, and measuring absorbance (OD) at 630nm on enzyme-linked immunosorbent assay (ELIASA) within 10 min.

And (4) result judgment standard: and (3) judging a negative critical value and a positive critical value (cut-off) according to a statistical analysis method:

when the S/P value is more than or equal to 0.268, the positive result is judged, and the positive result indicates that the sample contains the salmonella antibody;

and when the S/P value is less than 0.268, the sample is judged to be negative, and the negative result indicates that the sample does not contain the salmonella antibody.

Example 5 verification of the Salmonella gallinarum SifA-ELISA antibody detection kit

(1) Experiment of specificity

The established detection kit of the SifA-ELISA antibody of the salmonellae gallinarum is used for respectively detecting salmonella pullorum SA023, salmonella enteritidis SA083, salmonella typhimurium SA014, escherichia coli ACN001, bordetella P8, pasteurella C48-1, avibacterium paragallinarum CVCC3007 positive serum and healthy SPF chicken negative serum prepared by SPF chicken, and the serum of 5 chickens is selected for detection respectively. The results show that the three salmonella antibodies are all positive, and the other avian escherichia coli, bordetella, pasteurella and avibacterium paragallinarum antibodies are all negative. The result shows that the salmonella gallinarum SifA-ELISA antibody detection kit established in the research is specific to salmonella antibodies, and other main avian pathogenic bacteria serum antibodies can not be detected (figure 4).

(2) Repeatability test

The established detection kit of the chicken salmonellae SifA-ELISA antibody is used for carrying out batch repeated and batch-to-batch repeated experiments.

Repeat in batch: selecting a detection plate of the salmonella gallinarum SifA-ELISA antibody detection kit coated on the same date, wherein the positive serum and the negative serum are 3 parts respectively, and 6 parts of serum are used for detection in three times at different time, and calculating the coefficient of variation of the three times of detection. The results are shown in Table 9, and the coefficient of variation is below 10%, indicating that the detection method has good repeatability in batches.

Batch-to-batch repetition: three different batches of detection plates of the salmonella gallinarum SifA-ELISA antibody detection kit coated by the prepared salmonella gallinarum SifA protein are selected, 3 parts of positive serum and 3 parts of negative serum are respectively selected, 6 parts of serum are totally detected under the same experimental condition, and the coefficient of variation of the three batches of detection is calculated. The results are shown in Table 10, and the coefficient of variation is below 10%, indicating that the detection method has good batch-to-batch repeatability.

TABLE 9 repeatability in batches

Note: "P" is positive serum; "N" is negative serum

TABLE 10 repeatability test between batches

Note: "P" is positive serum; "N" is negative serum

(3) Detection of change rule of serum antibody of SPF chicken infected with salmonella pullorum by using salmonella sifA-ELISA antibody detection kit

Taking salmonella pullorum as a model, detecting the change rule of serum antibodies of SPF (specific pathogen free) chicken infected with salmonella pullorum, collecting blood every week for a fixed time after the SPF chicken is infected, collecting the serum of healthy SPF chicken at the same time, collecting the serum in the eighth week after infection, and collecting the serum for storage in a refrigerator at the temperature of-80 ℃. The established salmonella gallinarum SifA-ELISA antibody detection kit is used for detecting salmonella gallinarum serum antibodies, wherein 5 are the serum of an infected group, 3 are the serum of an uninfected group, all the serum of 8 weeks is detected simultaneously, and a line drawing is drawn to analyze the change condition of each salmonella serotype antibody detected by the salmonella gallinarum SifA-ELISA antibody detection kit (figure 5).

As can be seen from FIG. 5, the serum antibodies of SPF chickens have an upward trend after infection, the antibodies can be detected after the first week, the serum antibodies reach the highest level after the third week, the serum antibody level slowly decreases after the third week, but the presence of the salmonella pullorum serum antibodies can be detected until the eighth week, and the result shows that the salmonella gallinarum SifA-ELISA antibody detection kit can continuously detect the presence of the serum antibodies for at least eight weeks.

(4) Comparison of the detection kit for the antibody of the SifA-ELISA of the salmonella gallinarum and the clinical serum detected by the agglutination test of the glass plate

582 parts of chicken serum samples from 6 different chicken farms are respectively detected by using the salmonellae SifA-ELISA antibody detection kit and the glass plate agglutination test established in the research, wherein 162 parts of positive serum samples and 420 parts of negative serum samples are detected by the salmonellae SifA-ELISA antibody detection kit; the plate agglutination test detects 151 positive serum samples and 431 negative serum samples. As can be seen from the table (Table 11), the total coincidence rate of the detection kit for the antibody of the Salmonella gallinarum SifA-ELISA and the glass plate agglutination test is 92.6%.

The method recommended by OIE for detecting the chicken salmonellae serum antibody is a glass plate agglutination test at present, and plays an important role in the purification of pullorum disease in Europe and other countries. Although the method is simple to operate, low in cost, free of operation of professional personnel and capable of being operated on site, the method is strong in subjectivity and is prone to erroneous judgment caused by pollution of environmental dust and the like. Compared with a glass plate agglutination test, the salmonella gallinarum sifA-ELISA antibody detection kit can carry out quantitative detection, samples do not need to be specially processed, a large number of samples can be detected in a short time at high flux, time and labor are saved, cost is low, and the method can be used for monitoring and diagnosing diseases.

TABLE 11 comparison of the agglutination of glass plates and detection of clinical sera by the Salmonella gallinarum SifA-ELISA antibody detection kit

Other parts not described in detail are prior art. Although the present invention has been described in detail with reference to the above embodiments, it is only a part of the embodiments of the present invention, not all of the embodiments, and other embodiments can be obtained without inventive step according to the embodiments, and the embodiments are within the scope of the present invention.

Sequence listing

<110> university of agriculture in Huazhong

Application of SifA protein of salmonellosis gallinarum in preparation of ELISA antibody detection kit for detecting salmonellosis gallinarum antibody

<160> 2

<170> SIPOSequenceListing 1.0

<210> 1

<211> 1011

<212> DNA

<213> Salmonella (Salmonella)

<400> 1

atgccgatta ctatagggaa tggtttttta aaaagtgaaa tccttaccaa ctccccaagg 60

aatacgaaag aagcatggtg gaaagtttta tgggaaaaaa ttaaagactt ctttttttct 120

actggcaaag caaaagcgga ccgttgtcta catgagatgt tgtttgccga acgcgccccc 180

acacgagagc ggcttacaga gatttttttt gagttgaaag agttagcctg cgcatcgcaa 240

agagatagat ttcaggttca taatcctcat gaaaatgatg ccaccattat tcttcgcatc 300

atggatcaaa acgaagagaa cgaattgtta cgtatcactc aaaataccga tacctttagc 360

tgtgaagtca tggggaatct ttatttttta atgaaagatc gcccggatat tttaaaatcg 420

catccacaaa tgacggccat gattaagaga agatatagcg aaatcgtaga ctaccccctc 480

ccttcgacat tatgtctcaa tcctgctggc gcgccgatat tatcggttcc attagacaac 540

atagaggggt atttatatac tgaattgaga aaaggacatt tagatgggtg gaaagcgcaa 600

gaaaaggcaa cctacctggc agcgaaaatt cagtctggga ttgaaaagac aacgcgcatt 660

ttacaccatg cgaatatatc cgaaagtact cagcaaaacg catttttaga aacaatggcg 720

atgtgtggat taaaacagct tgaaatacca ccaccgcata cccacatacc tattgaaaaa 780

atggtaaaag aggttttact agcggataag acgtttcagg cgttcctcgt aacggatccc 840

agcaccagcc aaagtatgtt agctgagata atcgaaacca tctctgatca ggtttttcac 900

gccattttta gaatagaccc ccaggctata caaaaaatgg cggaagaaca gttaaccacg 960

ctacacgttc gctcagaaca acaaagcggc tgtttatgtt gttttttata a 1011

<210> 2

<211> 336

<212> PRT

<213> Salmonella (Salmonella)

<400> 2

Met Pro Ile Thr Ile Gly Ser Gly Phe Leu Lys Ser Glu Ile Leu Thr

1 5 10 15

Asn Ser Pro Arg Asn Thr Lys Glu Ala Trp Trp Lys Val Leu Trp Glu

20 25 30

Lys Ile Lys Asp Phe Phe Phe Ser Thr Gly Lys Ala Lys Ala Asp Arg

35 40 45

Cys Leu His Glu Met Leu Phe Ala Glu Arg Ala Pro Thr Arg Glu Arg

50 55 60

Leu Thr Glu Ile Phe Phe Glu Leu Lys Glu Leu Ala Cys Ala Ser Gln

65 70 75 80

Arg Asp Arg Phe Gln Val His Asn Pro His Glu Asn Asp Ala Thr Ile

85 90 95

Ile Leu Arg Ile Met Asp Gln Asn Glu Glu Asn Glu Leu Leu Arg Ile

100 105 110

Thr Gln Asn Thr Asp Thr Phe Ser Cys Glu Val Met Gly Asn Leu Tyr

115 120 125

Phe Leu Met Lys Asp Arg Pro Asp Ile Leu Lys Ser His Pro Gln Met

130 135 140

Thr Ala Met Ile Lys Arg Arg Tyr Ser Glu Ile Val Asp Tyr Pro Leu

145 150 155 160

Pro Ser Thr Leu Cys Leu Asn Pro Ala Gly Ala Pro Ile Leu Ser Val

165 170 175

Pro Leu Asp Asn Ile Glu Gly Tyr Leu Tyr Thr Glu Leu Arg Lys Gly

180 185 190

His Leu Asp Gly Trp Lys Ala Gln Glu Lys Ala Thr Tyr Leu Ala Ala

195 200 205

Lys Ile Gln Ser Gly Ile Glu Lys Thr Thr Arg Ile Leu His His Ala

210 215 220

Asn Ile Ser Glu Ser Thr Gln Gln Asn Ala Phe Leu Glu Thr Met Ala

225 230 235 240

Met Cys Gly Leu Lys Gln Leu Glu Ile Pro Pro Pro His Thr His Ile

245 250 255

Pro Ile Glu Lys Met Val Lys Glu Val Leu Leu Ala Asp Lys Thr Phe

260 265 270

Gln Ala Phe Leu Val Thr Asp Pro Ser Thr Ser Gln Ser Met Leu Ala

275 280 285

Glu Ile Ile Glu Thr Ile Ser Asp Gln Val Phe His Ala Ile Phe Arg

290 295 300

Ile Asp Pro Gln Ala Ile Gln Lys Met Ala Glu Glu Gln Leu Thr Thr

305 310 315 320

Leu His Val Arg Ser Glu Gln Gln Ser Gly Cys Leu Cys Cys Phe Leu

325 330 335

Claims (6)

1. An application of a salmonella gallinarum SifA protein in preparing an ELISA antibody detection kit for detecting a salmonella gallinarum antibody, wherein the amino acid sequence composition of the salmonella gallinarum SifA protein is shown as SEQ ID No. 2.

2. A salmonellae antibody SifA-ELISA detection kit for detecting salmonellae antibody is characterized in that: the kit comprises an ELISA plate with a salmonella SifA protein as a coating antigen, positive control serum prepared by infecting SPF (specific pathogen free) chickens with salmonella, negative serum of healthy SPF (specific pathogen free) chickens, rabbit anti-chicken enzyme-labeled secondary antibody, serum diluent, 10-time concentrated washing liquid, developing liquid A, developing liquid B and stop solution; the described salmonellas SifA protein is correspondentsifAThe nucleotide sequence of the gene is shown in SEQ ID No. 1.

3. The salmonella gallinarum SifA-ELISA antibody detection kit for detecting an antibody against salmonellae gallinarum according to claim 2, wherein: the method for manufacturing the enzyme label plate comprises the following steps:

the chicken salmonellae SifA protein is diluted to be 0.25 mu g/mL by 0.5M carbonate buffer solution with the pH value of 9.6, 100 mu L of the protein is added into each enzyme labeling hole, the protein is coated for 12h at the temperature of 4 ℃, skim milk with the mass fraction of 5 percent is prepared by PBS buffer solution to be used as sealing solution, and the protein is incubated for 2h at the temperature of 37 ℃ in an incubator.

4. The salmonella gallinarum SifA-ELISA antibody detection kit for detecting an antibody against salmonellae gallinarum according to claim 2, wherein: the preparation method of the salmonella gallinarum SifA protein comprises the following steps:

1) according to the species SalmonellasifASynthesizing nucleotide sequence of gene to obtain salmonella gallinarumsifAGene, and designing a primer with an enzyme cutting site:

P1：CCGGAATTCCCGATTACTATAGGGAATGG，

P2：CCGCTCGAGTTAGCCGCTTTGTTGTTCT；

2) the PCR product is connected with pET-28a vector by enzyme digestion to construct recombinant plasmid pET-28a-sifAThe recombinant plasmid pET-28a-sifATransforming into escherichia coli competent cells BL21, performing amplification culture by using an LB liquid culture medium, and adding IPTG to induce the expression of protein;

3) and centrifuging the induced escherichia coli, taking the precipitate, adding a buffer solution for resuspension, crushing the resuspended thalli by using a low-temperature ultrahigh-pressure cell crusher, centrifuging, taking supernate, and purifying the SifA protein in the supernate to obtain the recombinant protein SifA, namely the salmonella gallinarum SifA protein.

5. The salmonella gallinarum SifA-ELISA antibody detection kit for detecting an antibody against salmonellae gallinarum according to claim 2, wherein: the positive control serum is prepared by collecting blood from the infrapterygous vein 20 days after SPF chicken are infected with salmonella; the negative serum of the healthy SPF chicken is the serum of the healthy SPF chicken under the same condition;

the serum diluent is as follows: the PBS buffer solution contains bovine serum albumin with the mass fraction of 0.2 percent and Tween-20 with the volume fraction of 0.05 percent;

the 10-fold concentrated washing solution: adding 0.5% Tween-20 into 10 times of concentrated PBS, mixing, and subpackaging into 30 mL/bottle;

the color developing liquid A: citric acid 9.33g, Na₂HPO₄·12H₂Adding 700mL of deionized water into 14.60g of O and 0.52g of carbamide peroxide for dissolving, adjusting the pH value to 5.0-5.4, fixing the volume to 1000mL, and subpackaging into 10 mL/bottle;

the color developing liquid B: 10mg of tetramethylbenzidine and 5mL of absolute ethyl alcohol are dissolved by adding deionized water, the volume is determined to be 500mL, and the mixture is subpackaged into 10 mL/bottle;

the stop solution is as follows: 1.25mL of hydrofluoric acid solution was added to 300mL of deionized water, and the volume was adjusted to 500mL and the mixture was dispensed into 10mL bottles.

6. A method for detecting the salmonella gallinarum SifA-ELISA antibody detection kit of claim 2, which comprises the following steps: the method comprises the following steps:

1) diluting chicken serum to be detected by a serum diluent by 1:200 times, adding 100 mu L of each sample into an enzyme label plate, respectively adding positive control serum and 100 mu L of healthy SPF chicken negative serum into the enzyme label plate, incubating in a 37 ℃ incubator for 30min, discarding the diluted serum in the enzyme label plate, adding 200 mu L of a washing solution into each hole, standing for 5min, discarding the washing solution and drying, and repeatedly washing for 3 times; wherein the chicken serum to be detected is serum prepared by collecting blood from the subclavian vein of a clinical chicken;

2) diluting rabbit anti-chicken enzyme-labeled secondary antibody with PBS at a ratio of 1:10000, adding 100 μ L of the diluted secondary antibody into each hole, and incubating the diluted secondary antibody in an incubator at 37 ℃ for 30 min; discarding the enzyme-labeled secondary antibody, adding 200 μ L of washing solution into each hole, standing for 5min, discarding the washing solution, drying, and repeatedly washing for 3 times;

3) adding 50 mu L of developing solution A into each hole, then adding 50 mu L of developing solution B, mixing uniformly, developing for 15min in a dark place at room temperature, adding 50 mu L of stopping solution into each hole, and measuring the absorbance value at the wavelength of 630nm on an enzyme-linked immunosorbent assay (ELIAS) within 10 min;

4) and (4) judging a result: and (3) judging the negative and positive critical values according to a statistical analysis method:

when the S/P value is more than or equal to 0.268, the positive result is judged, and the positive result indicates that the sample contains the salmonella antibody;

and when the S/P value is less than 0.268, the sample is judged to be negative, and the negative result indicates that the sample does not contain the salmonella antibody.

Images