CN111534501A

CN111534501A - Rhizoctonia solani MAPK protein kinase gene target fragment Rsmapk and application thereof

Info

Publication number: CN111534501A
Application number: CN202010323333.3A
Authority: CN
Inventors: 舒灿伟; 赵美; 周而勋; 杨媚; 万俊; 李赞丰
Original assignee: South China Agricultural University
Current assignee: Cross Strait Agricultural Technology Co ltd
Priority date: 2020-04-22
Filing date: 2020-04-22
Publication date: 2020-08-14
Anticipated expiration: 2040-04-22
Also published as: CN111534501B

Abstract

The invention discloses a rice sheath blight bacterium MAPK protein kinase gene target fragment Rsmapk and application thereof. The invention provides a rice sheath blight bacterium MAPK protein kinase gene and a target fragment Rsmapk thereof, wherein the MAPK protein kinase gene is obviously induced and expressed in the early stage process of rice infection by rice sheath blight bacterium; according to the dsRNA synthesized by the rice sheath blight bacterium MAPK protein kinase gene segment Rsmapk, the rice sheath blight bacterium MAPK protein kinase gene can be silenced by in vitro treatment, so that the pathogenicity of the rice sheath blight bacterium can be obviously reduced; the dsRNA can be used for preparing a rice sheath blight bacterium prevention and control preparation, and a recombinant vector containing a target segment Rsmapk is transformed into a plant, so that a rice sheath blight bacterium resistant transgenic plant can be obtained; therefore, the rice sheath blight bacterium MAPK protein kinase gene or the fragment Rsmapk thereof has wide application prospects in preventing and treating rice sheath blight bacteria, preparing rice sheath blight bacteria prevention and treatment preparations and constructing anti-rice sheath blight bacteria transgenic plants.

Description

Rhizoctonia solani MAPK protein kinase gene target fragment Rsmapk and application thereof

Technical Field

The invention belongs to the technical field of biological control. More particularly, relates to a rice sheath blight bacterium MAPK protein kinase gene target fragment Rsmapk and application thereof.

Background

Rice sheath blight disease (Rice sheath height) is one of the important diseases of Rice, the damage degree is only second to Rice blast, the damage is the most serious in dense planting and high yield Rice areas, the yield reduction of the Rice is about 10% -30%, and the serious damage can reach 50%. However, in order to solve the problem of high and wide incidence of rice sheath blight, no highly resistant rice varieties have been obtained so far, and the mechanism of resistance of rice to sheath blight bacteria is poorly understood.

RNAi is a very conservative regulatory mechanism for homologous mRNA pairing and degradation under the direction of small interfering RNAs (siRNAs). RNAi is currently widely used in plant protection, such as plant antiviral and pest control. The Virus-induced gene silencing technology (VIGS technology) is short for VIGS technology, is based on the RNAi principle of homologous RNA complementary combination degradation, is a technology for instantly and quickly identifying the plant gene function by utilizing the natural defense mechanism of plants against viruses, and is a reverse genetics method for verifying the gene function by using a gene sequence.

Mitogen-activated protein kinase (MAPK) signal pathways widely exist in eukaryotic organisms and are evolutionarily well-conserved signal transduction pathways. In most biological cells, after extracellular stimulation, MAPK cascade and amplify signals sequentially and transmit the signals to cells and nuclei to regulate various cell biological processes, such as cell proliferation, differentiation, transformation, apoptosis and the like. In fungi, MAPK signal pathways mainly participate in regulation of the growth, pathogenicity, mating process and the like of fungi, and MAPK signal pathways of model fungi, namely Saccharomyces cerevisiae (Saccharomyces cerevisiae), Ustilago maydis (Ustilago maydis) and Magnaporthe grisea (Magnaporche moryzae) are deeply researched. At present, bioinformatics of rice sheath blight (Rhizoctonia solani) MAPK protein kinase genes, Yangyi and the like are researched, MAPK cascade signal pathway genes of pathogenic bacteria are identified, and MAPK cascade signal pathway maps are predicted; however, the functions, the applications and the like of the rice sheath blight bacterium MAPK protein kinase gene are not researched (rice sheath blight bacterium MAPK cascade signal pathway analysis and signal pathway model prediction, Chinese agricultural science and technology report, 2017). Therefore, screening and cloning the pathogenic related genes of the rice sheath blight disease has important significance for researching the interaction between the rice and the sheath blight bacteria and developing new rice varieties with sheath blight disease resistance.

Disclosure of Invention

The invention aims to solve the technical problem of overcoming the defects and shortcomings of the prior art in the research of pathogenic related genes of rice sheath blight disease and provides a target fragment Rsmapk of a rice sheath blight MAPK protein kinase gene and application thereof.

The invention aims to provide a rice sheath blight bacterium MAPK protein kinase gene.

The invention also aims to provide a protein coded by the rice sheath blight bacterium MAPK protein kinase gene.

The invention also aims to provide a rice sheath blight bacterium MAPK protein kinase gene target fragment Rsmapk.

The invention also aims to provide application of the rice sheath blight bacterium MAPK protein kinase gene or the target fragment Rsmapk in preventing and treating rice sheath blight bacterium or preparing a rice sheath blight bacterium preventing and treating preparation.

The invention also aims to provide application of the rice sheath blight bacterium MAPK protein kinase gene or the target fragment Rsmapk in constructing an anti-rice sheath blight bacterium transgenic plant.

The invention also aims to provide a preparation for preventing and treating rice sheath blight bacteria.

The above purpose of the invention is realized by the following technical scheme:

the invention provides a rice sheath blight bacterium MAPK protein kinase gene, wherein the full-length cDNA sequence of the gene is shown as SEQ ID NO: 1, the length of the full-length cDNA sequence is 708 bp.

The full-length DNA sequence of the gene is shown as SEQ ID NO: 2, the length of the full-length DNA sequence is 993bp, and the full-length DNA sequence comprises 6 introns which are respectively positioned at 49-102 th, 464-527 th, 677-732 th, 801-851 th, 915-974 th and 956-1010 th; wherein the clipping positions at 49-102, 464-527, 677-732 and 801-851 correspond to the GT-AG rule.

The coding sequence of the gene is shown as SEQ ID NO: 3, the length of the coding sequence is 708bp, and the coding sequence codes 235 amino acids.

The invention also provides a protein coded by the rice sheath blight bacterium MAPK protein kinase gene, and the amino acid sequence of the protein is shown as SEQ ID NO: 4, consisting of 235 amino acids, and the molecular weight of the protein is 26.96 kDa.

The research of the invention finds that the rice sheath blight bacterium MAPK protein kinase gene is a gene related to the pathogenicity of the rice sheath blight bacterium, the target fragment Rsmapk of the gene is induced in the early stage process of rice infected by the rice sheath blight bacterium, and the expression level is continuously increased; therefore, the following applications should be within the scope of the present invention:

the rice sheath blight bacterium MAPK protein kinase gene or the target fragment Rsmapk is applied to the prevention and treatment of rice sheath blight bacterium or the preparation of a rice sheath blight bacterium prevention and treatment preparation.

The rice sheath blight bacterium MAPK protein kinase gene or the target fragment Rsmapk is applied to the construction of an anti-rice sheath blight bacterium transgenic plant.

The invention also provides a preparation for preventing and treating rice sheath blight germ, which contains a substance capable of inhibiting the expression of the rice sheath blight germ MAPK protein kinase gene.

Preferably, the substance is dsRNA comprising a target fragment Rsmapk, a recombinant vector or a recombinant bacterium.

Preferably, the nucleic acid sequence of the dsRNA is as set forth in SEQ ID NO: and 6.

In addition, the invention also provides a method for constructing a rice sheath blight bacterium resistant transgenic plant, wherein dsRNA containing a rice sheath bacterium pathogen MAPK protein kinase gene target segment Rsmapk is synthesized in vitro and is used for treating and silencing a rice sheath bacterium MAPK protein kinase gene in vitro;

or constructing the target fragment Rsmapk of the MAPK protein kinase gene of the rhizoctonia solani into a TRV2 vector, and injecting the vector into a plant by an injection method to obtain a transgenic plant expressing the target fragment Rsmapk of the MAPK protein kinase gene of the rhizoctonia solani;

or dsRNA is generated in the transgenic plant and used for silencing the inoculated rice sheath blight bacterium MAPK protein kinase gene, so that the pathogenicity of the rice sheath blight bacterium on the plant is reduced.

According to the sequence information of the rice sheath blight bacterium MAPK protein kinase gene or the target fragment Rsmapk provided by the invention, the skilled person can easily obtain the fragment equivalent to the target fragment Rsmapk by the following method:

(1) obtaining through database retrieval; (2) screening other rhizoctonia genome libraries or cDNA libraries by taking the target fragment Rsmapk as a probe to obtain; (3) designing an oligonucleotide primer according to the sequence information of a target fragment Rsmapk, and obtaining the oligonucleotide primer from the genome, mRNA and cDNA of rhizoctonia or other closely-related fungi by using a PCR amplification method; (4) the gene is obtained by modification by a genetic engineering method on the basis of a target fragment Rsmapk; (5) the target fragment Rsmapk is obtained by a chemical synthesis method.

The invention has the following beneficial effects:

the invention obtains a rice sheath blight bacterium MAPK protein kinase gene, which is a pathogenicity key gene of rice sheath blight bacterium (soil-borne fungal disease), the gene is obviously induced and expressed in the early stage process that the rice is infected by the rice sheath blight bacterium, and dsRNA synthesized by a target segment Rsmapk of the rice sheath blight bacterium MAPK protein kinase gene can be treated in vitro to silence the rice sheath bacterium MAPK protein kinase gene so as to obviously reduce the pathogenicity of the rice sheath bacterium;

the invention also provides a preparation for preventing and treating rice sheath blight bacteria, which contains a substance capable of inhibiting the expression of the rice sheath blight bacteria MAPK protein kinase gene, wherein the substance is dsRNA containing a target segment Rsmapk, a recombinant vector or a recombinant bacterium; transforming a recombinant vector for efficiently silencing a rice sheath blight MAPK protein kinase gene into a plant to obtain a rice sheath blight resistance transgenic plant, wherein the plant has obvious disease resistance to rice sheath blight, effectively solves the problem of soil-borne fungal diseases caused by sheath blight in production, and effectively prevents and controls the soil-borne fungal diseases;

in addition, the method only expresses a small fragment of gene in the plant, does not produce products such as protein and the like, and does not produce potential risks brought by transgenic food; therefore, the rice sheath blight bacterium MAPK protein kinase gene or the target fragment Rsmapk thereof has wide application prospects in preventing and treating rice sheath blight bacteria, preparing rice sheath blight bacteria prevention and treatment preparations and constructing anti-rice sheath blight bacteria transgenic plants.

Drawings

FIG. 1 is a graph showing the amplification result of a rice sheath blight bacterium MAPK protein kinase gene target fragment Rsmapk; wherein, M: DNA molecular weight standard; 1: and (3) PCR products.

FIG. 2 is a diagram showing the results of gene expression analysis of MAPK protein kinase gene in the infection process of Rhizoctonia solani.

FIG. 3 is a graph showing RNA extraction results of dsRNA treatment in vitro on Rhizoctonia solani for 24, 48, 72 and 96 h; wherein, M: DNA molecular weight standard; 1: RNA extracted for 24 hours; 2: RNA extracted for 48 hours; 3: 72h of extracted RNA; 4: 96h of extracted RNA.

FIG. 4 is a graph showing the results of dsRNA treatment on rice sheath blight bacterium at 0, 24, 48, 72 and 96h in vitro.

FIG. 5 is a VIGS vector information map.

FIG. 6 is a map of a TRV2-Rsmapk silencing vector constructed according to the invention.

FIG. 7 is a diagram showing the results of colony validation of the TRV2-Rsmapk silencing vector constructed by the present invention transformed into Agrobacterium tumefaciens GV 3101; wherein, M: DNA molecular weight standard; 1. 2: and (5) bacterial colonies.

FIG. 8 is a phenotypic chart of Nicotiana benthamiana after inoculation of Rhizoctonia solani 6 d.

FIG. 9 is a graph showing the results of analysis of fungal biomass and target gene transcription levels of Nicotiana benthamiana after inoculation of Rhizoctonia solani 6 d; wherein, the graph (A) is a result graph of the fungal biomass analysis of the Nicotiana benthamiana after 6d inoculation of Rhizoctonia solani; (B) the graph is the result of analysis of the transcription level of the target gene of Nicotiana benthamiana inoculated with Rhizoctonia solani 6 d.

Detailed Description

The present invention is further illustrated by the following specific examples, which are not intended to limit the invention in any way. Reagents, methods and apparatus used in the present invention are conventional in the art unless otherwise indicated.

Unless otherwise indicated, reagents and materials used in the following examples are commercially available.

Example 1 cloning of a target fragment Rsmapk of a MAPK protein kinase Gene of Rhizoctonia solani

1. Experimental methods

The cloning of the rice sheath blight bacterium MAPK protein kinase gene target fragment Rsmapk comprises the following steps:

s1, extracting RNA of rhizoctonia solani

Extraction of Rhizoctonia solani RNA Using TaKaRa Total RNA extraction kit (code No. 9769). 0.1g of Rhizoctonia solani hyphae are weighed, quickly ground into powder in liquid nitrogen, added into a 1.5mL sterilized centrifuge tube containing Buffer RL lysate, and the lysate is centrifuged at 12,000rpm and 4 ℃ for 5 min. The supernatant was carefully pipetted into a fresh 1.5mL sterile centrifuge tube. The 1/2 volumes of absolute ethanol from the supernatant from the sample lysis step were added and the mixture (containing the pellet) was immediately transferred to the RNase Column (containing 2mL Collection Tube). Centrifuging at 12,000rpm for 1min, discardingAnd (6) filtering the solution. 500. mu.L of Buffer RWA, 600. mu.L of Buffer RWB, and 600. mu.L of Buffer RWB were added to the RNA Spin Column in this order, and centrifuged at 12,000rpm for 30 seconds, and the filtrate was discarded. The tube was then emptied and centrifuged at 12,000rpm for 1 min. The RNA Spin Column was mounted on a 1.5mL RNase Free Collection Tube, and 125. mu.L of RNase Free ddH was added to the center of the RNA Spin Column membrane₂O (preheated at 65 ℃) and stands for 5min at room temperature. And centrifuging at 12,000rpm for 2min to elute the RNA, thereby obtaining the RNA of the rice sheath blight bacterium.

S2. Synthesis of first Strand of cDNA

cDNA was synthesized using the RNA from Rhizoctonia solani obtained in step S1 as a template, using TARAKA PrimeScript reverse transcription kit (code No. 6210A). 2000ng of Total RNA, 1. mu.L of Oligo dTprimer, 1. mu.L of dNTP mix (10mM each), supplemented with RNase Free ddH, were added to the microcentrifuge tube₂Slightly mixing O to 10 mu L, centrifuging for several seconds, keeping the temperature at 65 ℃ for 5min, rapidly cooling on ice, sequentially adding 4 mu L of 5 × PrimeScript II Buffer, 0.5 mu L of RNaseInhibitor (40U/. mu.L), 1 mu L of PrimeScript II RTase (200U/. mu.L), and RNase Free ddH₂O to 20. mu.L, and slowly mix. Keeping the temperature at 42 ℃ for 50min, keeping the temperature at 95 ℃ for 5min (enzyme inactivation) to obtain the rice sheath blight bacterium cDNA, cooling on ice, and storing at-20 ℃ for later use.

S3, cloning of target fragment Rsmapk

The cloning primer of the target fragment Rsmapk is 4099F/R, 4099F: ACGCTGCTGATGACGGAA, as shown in SEQ ID NO: 7, 4099R: AGACGGCTAACGATGGGTAA, as shown in SEQ ID NO: shown in fig. 8. The rice sheath blight bacterium cDNA obtained in step S2 is used as a template, and a high fidelity polymerase of code No. TP001 is used for PCR amplification reaction. The reaction conditions are as follows: at 98 ℃ for 2 min; 40 cycles of 98 ℃, 10s, 58 ℃, 15 s; finally 72 ℃ for 10 min. A1.0% agarose gel was prepared using TAE buffer, and the PCR product was subjected to agarose gel electrophoresis. PCR product purification was performed using the Axygen PCR clean-up kit.

2. Results of the experiment

The full-length cDNA sequence of the rice sheath blight bacterium MAPK protein kinase gene is shown as SEQ ID NO: 1, and the full-length DNA sequence is shown as SEQ ID NO: 2, and the coding sequence is shown as SEQ ID NO: 3, the amino acid sequence of the encoded protein is shown as SEQ ID NO: 4, respectively.

The nucleotide sequence of the rice sheath blight bacterium MAPK protein kinase gene target fragment Rsmapk is shown as SEQ ID NO: 5, respectively.

The amplification result of the target fragment Rsmapk of the MAPK protein kinase gene of the Rhizoctonia solani is shown in figure 1, and it can be seen that the target fragment Rsmapk of the MAPK protein kinase gene of the Rhizoctonia solani is obtained by successful amplification of the gene of the target fragment Rsmapk of the MAPK protein kinase gene of the Rhizoctonia solani, and the size of the target fragment is 275 bp.

Example 2 expression analysis of MAPK protein kinase Gene during Rice infection with Rhizoctonia solani

1. Experimental methods

The expression analysis of the MAPK protein kinase gene in the rice infection process of the rice sheath blight pathogen comprises the following steps:

s1, preparation of inoculation spray: firstly, a strain GD-118 (Shu-Can-Wei, and the like, an optimized method for extracting proteins of rhizoctonia solani suitable for dimensional electrophoresis, academic newspaper of university of China agriculture, 2017) of rhizoctonia solani stored in a laboratory is activated by using a PDA (personal digital assistant) plate (culture dish diameter is 90mm, 8mL of PDA culture medium), and the rhizoctonia solani is cultured for 2 days at 28 ℃ under the dark condition. Then cutting the PDA plate with the fungi into square mycelium blocks with the side length of about 1mm by using a sterilized blade, transferring the square mycelium blocks into a conical flask (containing 200mL of PDB), culturing the square mycelium blocks at 28 ℃ for 180r/min in the dark under shaking for 2d, and homogenizing the whole flask into liquid to ensure that the OD600 is 1.0, thus being used for inoculation.

S2, planting and inoculating rice: rice seeds (rice variety: Nipponbare) are sterilized by respectively using 10% of sodium hypochlorite and 30% of hydrogen peroxide, then the seeds are placed in a sterile culture dish, and are soaked for more than 3d by using sterile water until germination occurs, and then the germinated seeds are transferred to a square pot (length: 80 cm; width: 40 cm; height: 15cm) containing 10cm of sterile soil. And (4) inoculating and selecting the three-leaf one-heart period of rice, and inoculating by using the homogenized liquid obtained in the step S1 under the condition of anhydrous drying in a pot, wherein 5mL of the homogenized liquid is inoculated to each rice plant, and the humidity is more than 90% at 30 ℃ so as to be beneficial to disease attack.

S3, real-time fluorescent quantitative PCR analysis of the sample: in order to verify the expression quantity of different genes in the rice infection process of rhizoctonia solani, 6 time points after inoculation are selected, and the whole rice is collected as a sample after 24 hours, 48 hours, 72 hours, 96 hours and 120 hours. The total RNA Extraction of the rice samples was carried out for various periods of time using TaKaRa MiniBEST Plant RNA Extraction Kit (code No.9769), in the same manner as in "step S1 in example 1".

The RNA reverse transcription was carried out using TARAKA PrimeScript reverse transcription kit (code No.6210A) in the same manner as in "step S2" of example 1, and the cDNA product obtained by the reverse transcription was diluted 10-fold and used for real-time fluorescent quantitative PCR.

Utilizing Primer Premier 5.0 software to design a real-time fluorescent quantitative PCR Primer 4099qPCR F/R of a target fragment Rsmapk, 4099qPCR F: CATCGAGTTATCCGAACGCAG, as shown in SEQ ID NO: 9 is shown in the figure; 4099qPCR R: ATCAGCGCTGTGTAGTGC, as shown in SEQ ID NO: shown at 10. The specificity of the primers was verified by gel electrophoresis, sequencing and dissolution curves. The experiment used a Bio-Rad CFX real-time PCR system with a 20. mu.L reaction system containing 10. mu. LMIX, 0.2. mu.M primer 4099qPCR F/R, 2. mu.L cDNA template and appropriate amount of purified water. Three technical replicates were performed for each sample.

The internal reference gene of Rhizoctonia solani was normalized for gene expression between samples using GAPDH, primers were GAPDH F/R, GAPDH F: GGTCGGCAAAGTCATACCAT, as shown in SEQ ID NO: 11 is shown in the figure; GAPDH R: TCTGCGTCCTTCTTGGAGATA, as shown in SEQ ID NO: shown at 12. Results adopted 2^-ΔΔCtMethods were performed for analysis (suxiaofeng, 2014).

2. Results of the experiment

The result of gene expression analysis of the MAPK protein kinase gene in the rice sheath blight germ infection process is shown in FIG. 2, and it can be seen that the MAPK protein kinase gene is induced in the early stage of rice sheath germ infection, and the expression level is continuously increased along with the time extension; the gene is proved to play a key role in the interaction process of the rhizoctonia solani and the rice.

Example 3 Synthesis and in vitro silencing experiments of dsRNA containing the target fragment Rsmapk

1. Experimental methods

Synthesis and in vitro silencing experiments of dsRNA containing the target fragment Rsmapk, comprising the steps of:

s1, in vitro synthesis of dsRNA containing a target segment Rsmapk: dsRNA containing the target fragment Rsmapk was synthesized using T7RNA Polymerase (ThermoFisher Scientific, Catalog number: EP 011). By adding the T7 promoter sequence at the 5' end of either amplification primer, the T7RNA polymerase promoter can be added to any DNA sequence using PCR.

The minimal T7RNA polymerase promoter sequence is: 5'-TAATACGACTCACTATAGG-3' are provided. The 5' ends of the upstream primer and the downstream primer are respectively added with a T7 promoter sequence, and a dsRNA synthesis primer T7-4099F/R, namely an upstream primer T7-4099F: TAATACGACTCACTATAGGACCCTCCAACCTGCTCCTAA, as shown in SEQ ID NO: 13 is shown in the figure; the downstream primer T7-4099R: TAATACGACTCACTATAGGCCTCAACAGTGATT CGCTTCTT, as shown in SEQ ID NO: as shown at 14.

Carrying out PCR amplification by taking cDNA of Rhizoctonia solani as a template to obtain a dsRNA template, and carrying out transcription and purification to obtain the dsRNA containing a MAPK protein kinase gene target segment Rsmapk.

S2, in-vitro silencing experiment of dsRNA on rice sheath blight bacterium: a square cake with 2mm side length was taken from the edge of the PDA plate of Rhizoctonia solani cultured for 2d and placed in a petri dish (containing 7mL of PDB) with a diameter of 60mm, after standing and culturing for 48 hours, dsRNA was added at 500ng/mL, and hypha samples were collected at 0, 24, 48, 72 and 96 hours, and total RNA Extraction of the rice samples was carried out for different periods of time using the TaKaRa MiniBEST plant RNA Extraction Kit (code No.9769) in the same manner as in "step S1 in example 1", and the treatment was repeated three times each time, and the experiment was repeated three times.

2. Results of the experiment

The nucleic acid sequence of the dsRNA is shown as SEQ ID NO: and 6.

The RNA extraction results of dsRNA treatment in vitro on Rhizoctonia solani for 24, 48, 72 and 96h are shown in FIG. 3, and it can be seen that the RNA extracted from samples at each time period is good in quality.

The results of dsRNA in vitro treatment on the transcription levels of

Rhizoctonia solani

0, 24, 48, 72 and 96h are shown in FIG. 4, and it can be seen that the transcription level of MAPK protein kinase gene is obviously reduced at 24hpi and is continuously reduced along with the increase of treatment time, and the silencing efficiency of 96hpi is as high as more than 80%; it is demonstrated that it is feasible to treat the expression of the gene related to the silencing of Rhizoctonia solani by in vitro dsRNA administration.

Example 4 TRV2-Rsmapk silencing vector construction and transformation of tobacco

1. Experimental methods

TRV2-Rsmapk silencing vector construction and transformation tobacco research comprises the following steps:

s1, vector construction and agrobacterium transformation: designing a specific vector with EcoRI and BamHI enzyme cutting sites at two ends of a primer according to a coding sequence of a rice sheath blight bacterium MAPK protein kinase gene target fragment Rsmapk to construct a primer VIGS-4099F/R, wherein an upstream primer VIGS-4099F: CCGgaattcGTCCGTTGGTTGTATTCTC, as shown in SEQ ID NO: 15 is shown in the figure; the downstream primer VIGS-4099R: CGCggatccAACAGT GATTCGCTTCTTG, as shown in SEQ ID NO: shown at 16. The rice sheath blight bacterium cDNA is used as a template, PCR amplification is carried out by using high fidelity enzyme of code No. TP001, an amplification product is recovered, and the product and the carrier pYL156 are subjected to double enzyme digestion for 5 hours at 37 ℃. Connecting the enzyme-cut target fragment and the vector by T4DNA ligase at 16 ℃ overnight, transforming the connected product into E.coil DH5 alpha competence, performing sequencing to determine no errors, performing propagation to extract a plasmid (TRV2-Rsmapk silent vector), and storing for later use. The VIGS vector information is shown in FIG. 5.

S2, preparation of agrobacterium tumefaciens competence and electric shock transformation: a single colony of Agrobacterium tumefaciens GV3101 was inoculated into 4mL of LB liquid medium containing Rif (25. mu.g/mL) and cultured at 28 ℃ for 2d with shaking at 200 r/min. Inoculating 3mL of the culture solution into 200mL of LB culture solution, culturing at 200r/min under shaking at 28 deg.C until logarithmic phase (cell concentration OD600 is 0.5-0.6). And centrifuging to remove waste liquid, and collecting thalli. The suspension was resuspended and washed 3 times with pre-chilled sterile double distilled water, after which the cells were resuspended in 2mL of sterile pre-chilled 10% w/v glycerol. 100 μ L of the bacterial suspension was put into a 1.5mL centrifuge tube and stored at-70 ℃ for further use. Adding 3 mu L of plasmid into the bacterial liquid, gently mixing uniformly and transferring the plasmid into an aseptic precooled electric shock cup, quickly adding 1mL of LB liquid culture medium after electric shock, mixing uniformly and transferring cells into a 1.5mL centrifuge tube, and culturing for 2-3h at the temperature of 28 ℃ in a shaking table at 200 r/min; mu.L of the suspension was spread on LB plates containing Rif (25. mu.g/m L) and Kan (50. mu.g/mL), and the plates were placed upside down in an incubator at 28 ℃ for 2 days to observe the growth of the transformants, and the results of Agrobacterium without plasmid DNA under the same conditions of electric shock were used as controls. Single colonies were picked and PCR verified using pYL156 vector verification primer (PYL156F/R), upstream primer PYL 156F: AATTCACTGGGAGATGATACGCTG, as shown in SEQ ID NO: 17 is shown; downstream primer PYL 156R: CCTATGGTAAGACAATGAGTCGGC, as shown in SEQ ID NO: 18, respectively.

S3, agrobacterium culture and tobacco transient transformation: agrobacterium monoclonals were added to 5mL of liquid LB medium (25. mu.g/mLRif and 50. mu.g/mL Kan), incubated overnight at 200r/min in a shaker at 28 ℃ and 1mL of the inoculum was added to 50mL of LB medium (25. mu.g/mL Rif and 50. mu.g/mL Kan), and incubated with shaking at 200r/min in a shaker at 28 ℃. When the culture OD600 is 0.5-0.6, the thalli are collected by low-temperature centrifugation at 6000rpm for 5min, and waste liquid is discarded. The cells were resuspended in injection media (10mM MES, 10mM MgCl)₂100. mu.M acetosyringone) to an OD600 of 0.8 to 1.0. Two agrobacterium strains (TRV1 and TRV2+ target gene fragments) were grown at 1: 1, mixing, standing at room temperature for 3-5h without shaking. Finally, the agrobacterium containing the injection matrix is injected into the tender leaf using a syringe.

S4, pathogenicity detection and biomass measurement: the albinism of Nicotiana benthamiana was very pronounced from day 10 post-injection, indicating that the VIGS vector has produced large amounts of dsRNA and has an interfering effect in Nicotiana benthamiana. Therefore, we chose to perform live vaccination from day 10 after injection of VIGS series vectors. The disease index of the Nicotiana benthamiana is counted on the 6 th day (post-inoculation day, dpi) after inoculation, and the pathogenicity is detected by counting the number of leaf scabs and withered leaves. Extracting total DNA of the leaf blade in the middle of the Nicotiana benthamiana (transgenic plant and negative control) after 6d inoculation of Rhizoctonia solani, taking an ITS sequence of an internal transcription spacer region of Rhizoctonia solani (R.solani) as a target fragment, and carrying out upstream primer RsF: GCCTTTTCTACCTTAATTTGGCAG, as shown in SEQ ID NO: 19 is shown in the figure; the downstream primer Rs is as follows: GTGTGTAAATTAAGTAGACAGCAAATG, as shown in SEQ ID NO: shown at 20. Meanwhile, the tobacco actin gene is used as an internal reference gene, and an upstream primer EF1 a: TGGTGTCCTCAAGCCTGGTAT, as shown in SEQ ID NO: 21 is shown in the figure; downstream primer EF1 b: ACGCTTGAGATCCTTAACCGC, as shown in SEQ ID NO: 22, respectively. The specific method was the same as "step S3 in example 2", and the results were analyzed by the 2-. DELTA.Ct method (Suxiao peak, 2014).

2. Results of the experiment

The map of the TRV2-Rsmapk silencing vector constructed by the invention is shown in figure 6, and it can be seen that the total length of the constructed vector is 9925bp, and the comparison result is the same as the actual sequencing result.

The colony verification result of the TRV2-Rsmapk silencing vector obtained by the construction method and transformed into the agrobacterium tumefaciens GV3101 is shown in figure 7, the size of the strip is 712bp, and the strip is single, bright and correct in size; indicating that the silencing vector TRV2-Rsmapk has successfully transferred into Agrobacterium tumefaciens GV 3101.

The phenotype of the nicotiana benthamiana inoculated with the rhizoctonia solani 6d is shown in fig. 8, and it can be seen that the resistance of the transgenic tobacco to the rhizoctonia solani is obviously improved.

The analysis results of the fungal biomass and the target gene transcription level of the nicotiana benthamiana inoculated with the rhizoctonia solani 6d are shown in fig. 9, and it can be seen that the fungal biomass of the transgenic positive tobacco is obviously reduced and is only 40% of the wild type, and the expression level of the MAPK protein kinase gene in the transgenic plant is reduced by 60%.

The above embodiments are preferred embodiments of the present invention, but the present invention is not limited to the above embodiments, and any other changes, modifications, substitutions, combinations, and simplifications which do not depart from the spirit and principle of the present invention should be construed as equivalents thereof, and all such changes, modifications, substitutions, combinations, and simplifications are intended to be included in the scope of the present invention.

Sequence listing

<110> southern China university of agriculture

<120> Rhizoctonia solani MAPK protein kinase gene target fragment Rsmapk and application thereof

<160>22

<170>SIPOSequenceListing 1.0

<210>1

<211>708

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>1

atgcatcgag ttatccgaac gcaggacctt agcgacgatc atgcccaata ttttatctac 60

caaacgcttc gcgccctcaa ggcactacac agcgctgatg tcatccaccg tgatctcaaa 120

ccctccaacc tgctcctaaa cgcgaattgc gatctcaagg tctgcgactt tggtcttgca 180

cggtccgttc ggacggccga gccttcgggc accgaaacag gcttcatgac ggaatacgtt 240

gcgacgagat ggtatcgcgc acccgaaatc atgcttacgt ttaagcagta caccaaggca 300

atcgacgtct ggtccgttgg ttgtattctc gcggagatgt taagcggaaa gcccttgttc 360

cctggacggg actaccatca ccagttgact ttgatcttgg acgtgctagg cacacccacg 420

ctagacgagt tctacgcgat caccacccga cgatcccgcg attacattcg tgcactccca 480

ttccggaaac gtcgaccatt cgcccagtta ttcccgaatg cttctgcgct cgccgtggac 540

tttttgacga aaactttgac ctttgatccc aagaagcgaa tcactgttga ggacgcactc 600

tgccaccctt acctagaggc atacgtcatg atcccgatga tgagcccgtt gcccctcctc 660

tggaccccga ctttttcgag tttgatcgtt gcacaaggac gacattag 708

<210>2

<211>993

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>2

atgcatcgag ttatccgaac gcaggacctt agcgacgatc atgcccaagt aagtacctcc 60

cgccttgcac ccatgcgcca catctaactc gcatattttc agtattttat ctaccaaacg 120

cttcgcgccc tcaaggcact acacagcgct gatgtcatcc accgtgatct caaaccctcc 180

aacctgctcc taaacgcgaa ttgcgatctc aaggtctgcg actttggtct tgcacggtcc 240

gttcggacgg ccgagccttc gggcaccgaa acaggcttca tgacggaata cgttgcgacg 300

agatggtatc gcgcacccga aatcatgctt acgtttaagc agtacaccaa ggcaatcgac 360

gtctggtccg ttggttgtat tctcgcggag atgttaagcg gaaagccctt gttccctgga 420

cgggactacc atcaccagtt gactttgatc ttggacgtgc taggtaagca ctttccgggg 480

attctcccca ccttattctc tcgcagatcc tcacacatcg ttacaaggca cacccacgct 540

agacgagttc tacgcgatca ccacccgacg atcccgcgat tacattcgtg cactcccatt 600

ccggaaacgt cgaccattcg cccagttatt cccgaatgct tctgcgctcg ccgtggactt 660

tttgacgaaa actttggtac gagcacatgt ttgatatcta ggttcgcgcg tattctgacc 720

tggttcttct agacctttga tcccaagaag cgaatcactg ttgaggacgc actctgccac 780

ccttacctag aggcatacgt gcgtagacgt ccaaaaacca acgttagaac tcagctaacg 840

cgtctctata gcatgatccc gatgatgagc ccgttgcccc tcctctggac cccgactttt 900

tcgagtttga tcgtgcgttc attcccttcc ttacatatat acgttcatcg ctgactcaca 960

ctccttgtcc acagtgcaca aggacgacat tag 993

<210>3

<211>708

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>3

atgcatcgagttatccgaac gcaggacctt agcgacgatc atgcccaata ttttatctac 60

caaacgcttc gcgccctcaa ggcactacac agcgctgatg tcatccaccg tgatctcaaa 120

ccctccaacc tgctcctaaa cgcgaattgc gatctcaagg tctgcgactt tggtcttgca 180

cggtccgttc ggacggccga gccttcgggc accgaaacag gcttcatgac ggaatacgtt 240

gcgacgagat ggtatcgcgc acccgaaatc atgcttacgt ttaagcagta caccaaggca 300

atcgacgtct ggtccgttgg ttgtattctc gcggagatgt taagcggaaa gcccttgttc 360

cctggacggg actaccatca ccagttgact ttgatcttgg acgtgctagg cacacccacg 420

ctagacgagt tctacgcgat caccacccga cgatcccgcg attacattcg tgcactccca 480

ttccggaaac gtcgaccatt cgcccagtta ttcccgaatg cttctgcgct cgccgtggac 540

tttttgacga aaactttgac ctttgatccc aagaagcgaa tcactgttga ggacgcactc 600

tgccaccctt acctagaggc atacgtcatg atcccgatga tgagcccgtt gcccctcctc 660

tggaccccga ctttttcgag tttgatcgtt gcacaaggac gacattag 708

<210>4

<211>235

<212>PRT

<213> Artificial Sequence (Artificial Sequence)

<400>4

Met His Arg Val Ile Arg Thr Gln Asp Leu Ser Asp Asp His Ala Gln

1 5 10 15

Tyr Phe Ile Tyr Gln Thr Leu Arg Ala Leu Lys Ala Leu His Ser Ala

20 25 30

AspVal Ile His Arg Asp Leu Lys Pro Ser Asn Leu Leu Leu Asn Ala

35 40 45

Asn Cys Asp Leu Lys Val Cys Asp Phe Gly Leu Ala Arg Ser Val Arg

50 55 60

Thr Ala Glu Pro Ser Gly Thr Glu Thr Gly Phe Met Thr Glu Tyr Val

65 70 75 80

Ala Thr Arg Trp Tyr Arg Ala Pro Glu Ile Met Leu Thr Phe Lys Gln

85 90 95

Tyr Thr Lys Ala Ile Asp Val Trp Ser Val Gly Cys Ile Leu Ala Glu

100 105 110

Met Leu Ser Gly Lys Pro Leu Phe Pro Gly Arg Asp Tyr His His Gln

115 120 125

Leu Thr Leu Ile Leu Asp Val Leu Gly Thr Pro Thr Leu Asp Glu Phe

130 135 140

Tyr Ala Ile Thr Thr Arg Arg Ser Arg Asp Tyr Ile Arg Ala Leu Pro

145 150 155 160

Phe Arg Lys Arg Arg Pro Phe Ala Gln Leu Phe Pro Asn Ala Ser Ala

165 170 175

Leu Ala Val Asp Phe Leu Thr Lys Thr Leu Thr Phe Asp Pro Lys Lys

180 185 190

Arg Ile Thr ValGlu Asp Ala Leu Cys His Pro Tyr Leu Glu Ala Tyr

195 200 205

Val Met Ile Pro Met Met Ser Pro Leu Pro Leu Leu Trp Thr Pro Thr

210 215 220

Phe Ser Ser Leu Ile Val Ala Gln Gly Arg His

225 230 235

<210>5

<211>275

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>5

gtccgttggt tgtattctcg cggagatgtt aagcggaaag cccttgttcc ctggacggga 60

ctaccatcac cagttgactt tgatcttgga cgtgctaggc acacccacgc tagacgagtt 120

ctacgcgatc accacccgac gatcccgcga ttacattcgt gcactcccat tccggaaacg 180

tcgaccattc gcccagttat tcccgaatgc ttctgcgctc gccgtggact ttttgacgaa 240

aactttgacc tttgatccca agaagcgaat cactg 275

<210>6

<211>511

<212>RNA

<213> Artificial Sequence (Artificial Sequence)

<400>6

uaauacgacu cacuauagga cccuccaacc ugcuccuaaa cgcgaauugc gaucucaagg 60

ucugcgacuu uggucuugca cgguccguuc ggacggccga gccuucgggc accgaaacag 120

gcuucaugac ggaauacguu gcgacgagau gguaucgcgc acccgaaauc augcuuacgu 180

uuaagcagua caccaaggca aucgacgucu gguccguugg uuguauucuc gcggagaugu 240

uaagcggaaa gcccuuguuc ccuggacggg acuaccauca ccaguugacu uugaucuugg 300

acgugcuagg cacacccacg cuagacgagu ucuacgcgau caccacccga cgaucccgcg 360

auuacauucg ugcacuccca uuccggaaac gucgaccauu cgcccaguua uucccgaaug 420

cuucugcgcu cgccguggac uuuuugacga aaacuuugac cuuugauccc aagaagcgaa 480

ucacuguuga ggccuauagu gagucguauu a 511

<210>7

<211>18

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>7

acgctgctga tgacggaa 18

<210>8

<211>20

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>8

agacggctaa cgatgggtaa 20

<210>9

<211>21

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>9

catcgagtta tccgaacgca g 21

<210>10

<211>18

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>10

atcagcgctg tgtagtgc 18

<210>11

<211>20

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>11

ggtcggcaaa gtcataccat 20

<210>12

<211>21

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>12

tctgcgtcct tcttggagat a 21

<210>13

<211>39

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>13

taatacgact cactatagga ccctccaacc tgctcctaa 39

<210>14

<211>41

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>14

taatacgact cactataggc ctcaacagtg attcgcttct t 41

<210>15

<211>28

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>15

ccggaattcg tccgttggtt gtattctc 28

<210>16

<211>28

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>16

cgcggatcca acagtgattc gcttcttg 28

<210>17

<211>24

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>17

aattcactgg gagatgatac gctg 24

<210>18

<211>24

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>18

cctatggtaa gacaatgagt cggc 24

<210>19

<211>24

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>19

gccttttcta ccttaatttg gcag 24

<210>20

<211>27

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>20

gtgtgtaaat taagtagaca gcaaatg 27

<210>21

<211>21

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>21

tggtgtcctc aagcctggta t 21

<210>22

<211>21

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>22

acgcttgaga tccttaaccg c 21

Claims

1. A rice sheath blight bacterium MAPK protein kinase gene is characterized in that the full-length cDNA sequence of the gene is shown as SEQ ID NO: 1 is shown.

2. A rice sheath blight bacterium MAPK protein kinase gene is characterized in that the full-length DNA sequence of the gene is shown as SEQ ID NO: 2, respectively.

3. A rice sheath blight bacterium MAPK protein kinase gene is characterized in that the coding sequence of the gene is shown as SEQ ID NO: 3, respectively.

4. A protein coded by a rice sheath blight bacterium MAPK protein kinase gene is characterized in that the amino acid sequence of the protein is shown as SEQ ID NO: 4, respectively.

5. A rice sheath blight bacterium MAPK protein kinase gene target fragment Rsmapk is characterized in that the nucleotide sequence is shown as SEQ ID NO: 5, respectively.

6. Use of the rice sheath blight bacterium MAPK protein kinase gene of any one of claims 1 to 3 or the target fragment Rsmapk of claim 5 for prevention and treatment of rice sheath blight bacterium or preparation of a rice sheath blight bacterium prevention and treatment preparation.

7. Use of the rice sheath blight bacterium MAPK protein kinase gene of any one of claims 1 to 3 or the target fragment Rsmapk of claim 5 in construction of an anti-rice sheath blight bacterium transgenic plant.

8. A Rhizoctonia solani control agent comprising a substance capable of inhibiting the expression of the MAPK protein kinase gene of any one of claims 1 to 3.

9. The formulation of claim 8, wherein the substance is a dsRNA comprising a target fragment Rsmapk, a recombinant vector or a recombinant bacterium.

10. The formulation of claim 9, wherein the nucleic acid sequence of said dsRNA is as set forth in SEQ ID NO: and 6.