CN111528092A - Culture method of chrysanthemum virus-free seedlings - Google Patents
Culture method of chrysanthemum virus-free seedlings Download PDFInfo
- Publication number
- CN111528092A CN111528092A CN202010453756.7A CN202010453756A CN111528092A CN 111528092 A CN111528092 A CN 111528092A CN 202010453756 A CN202010453756 A CN 202010453756A CN 111528092 A CN111528092 A CN 111528092A
- Authority
- CN
- China
- Prior art keywords
- stem
- culture medium
- chrysanthemum
- medium
- culture
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Images
Classifications
-
- A—HUMAN NECESSITIES
- A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
- A01H—NEW PLANTS OR NON-TRANSGENIC PROCESSES FOR OBTAINING THEM; PLANT REPRODUCTION BY TISSUE CULTURE TECHNIQUES
- A01H4/00—Plant reproduction by tissue culture techniques ; Tissue culture techniques therefor
- A01H4/001—Culture apparatus for tissue culture
-
- A—HUMAN NECESSITIES
- A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
- A01H—NEW PLANTS OR NON-TRANSGENIC PROCESSES FOR OBTAINING THEM; PLANT REPRODUCTION BY TISSUE CULTURE TECHNIQUES
- A01H4/00—Plant reproduction by tissue culture techniques ; Tissue culture techniques therefor
- A01H4/008—Methods for regeneration to complete plants
Landscapes
- Life Sciences & Earth Sciences (AREA)
- Developmental Biology & Embryology (AREA)
- Engineering & Computer Science (AREA)
- Biotechnology (AREA)
- Cell Biology (AREA)
- Botany (AREA)
- Environmental Sciences (AREA)
- Breeding Of Plants And Reproduction By Means Of Culturing (AREA)
Abstract
The invention discloses a culture method of a detoxified chrysanthemum seedling. The method comprises the following steps: (1) performing pre-detoxification treatment on the chrysanthemum infected with the virus to obtain pre-detoxified chrysanthemum; (2) sequentially culturing the stem sections of the pre-detoxified chrysanthemum in an adventitious bud induction culture medium and an enrichment culture medium to obtain aseptic seedlings; (3) carrying out heat treatment on the aseptic seedlings to obtain heat-treated aseptic seedlings; (4) culturing the stem tip stripped from the heat-treated aseptic seedling in a CHR-1 culture medium until the stem tip with the length of 0.8-1.0mm is obtained; (5) and (3) culturing the stem tip with the length of 0.8-1.0mm in a stem tip differentiation culture medium to obtain a chrysanthemum plant. Experiments prove that: the detoxication rate of the chrysanthemum plantlets obtained by the method can reach 92.5 percent, and the method has good application prospect in cultivating the chrysanthemum detoxication seedlings.
Description
Technical Field
The invention belongs to the technical field of plant culture, and particularly relates to a culture method of a detoxified chrysanthemum seedling.
Background
Chrysanthemum Morifolium Ramat is a perennial herb of Chrysanthemum L of Compositae, has high economic value and ornamental value, and can be used for ornamental, garden arrangement, environment beautification and edible and medicinal use. In recent years, the demand of chrysanthemum in domestic and foreign markets is increasing, and the economic value of chrysanthemum is increasing.
At present, the main problems in chrysanthemum production are variety degradation caused by viruses, reduction of chrysanthemum yield, dwarfing of plants and great reduction of economic value. Therefore, the cultivation of the detoxified chrysanthemum seedlings becomes the key for improving the economic value of the chrysanthemum.
Disclosure of Invention
The invention aims to provide a culture method of a chrysanthemum virus-free seedling.
The culture method of the chrysanthemum indicum virus-free seedlings provided by the invention comprises the following steps:
(1) performing pre-detoxification treatment on the chrysanthemum infected with the virus to obtain pre-detoxified chrysanthemum;
(2) sequentially culturing the stem sections of the pre-detoxified chrysanthemum in an adventitious bud induction culture medium and an enrichment culture medium to obtain aseptic seedlings;
(3) carrying out heat treatment on the aseptic seedlings to obtain heat-treated aseptic seedlings;
(4) culturing the stem tip stripped from the heat-treated aseptic seedling in a CHR-1 culture medium until the stem tip with the length of 0.8-1.0mm is obtained;
the CHR-1 medium comprises NaH2PO4·H2O、KNO3、(NH4)2SO4、MgSO4·7H2O、CaCl2·2H2O, thiamine hydrochloride, 6-benzylamino adenine, naphthylacetic acid and activated carbon;
(5) culturing the stem tip with the length of 0.8-1.0mm in a stem tip differentiation culture medium to obtain a chrysanthemum plant;
the stem tip differentiation medium comprises 6-benzylamino adenine, naphthylacetic acid and activated carbon.
In the above method, in the step (1), the pre-detoxification treatment is injection of the virus-infected feverfew with a ribavirin solution.
Furthermore, the solvent of the ribavirin solution is water, and the concentration of the ribavirin can be 8-10mg/L or 8mg/L or 10mg/L, and specifically 10 mg/L.
The injection dose may be 3-5mL or 3mL or 5mL, in particular 5 mL.
Furthermore, the injection position is a plant stem 2cm away from the ground.
In the above method, a step of culturing the pre-detoxified feverfew is further included between the step (1) and the step (2). The culture condition can be that the culture is carried out for 30 days under the conditions that the air humidity is 50-75%, the ambient temperature is 15-30 ℃, the illumination time is 14 h/day and the illumination intensity is 5-10 ten thousand Lux.
In the above method, the step (2) includes the steps of:
(2-1) selecting current-year shoots of the pre-detoxified chrysanthemum (leaves are removed), and cutting stem sections of the current-year shoots into small sections with 4-5 buds to obtain stem sections with 4-5 buds;
(2-2) sterilizing the stem sections with 4-5 buds to obtain sterilized stem sections;
(2-3) cutting the sterilized stem segments into 2-3cm long stem segments with 1-3 axillary buds, and inoculating the stem segments into an adventitious bud induction culture medium for culture;
the adventitious bud culture medium comprises 6-benzylamino adenine;
(2-4) when the adventitious bud of the stem segment with 1-3 buds grows to 5-6cm, cutting the stem segment into stem segments with 2-3cm and 1-3 leaf buds, and inoculating the stem segments into a multiplication culture medium for culture;
the multiplication medium comprises 6-benzylamino adenine.
In the step (2-2), the method for sterilizing comprises the following steps:
(2-2-1) soaking the stem segments with 4-5 buds in liquid detergent, and washing;
(2-2-2) soaking the stem segments obtained in the step (2-2-1) in carbendazim, and washing;
(2-2-3) soaking the stem segments obtained in the step (2-2-2) in an ethanol solution, and washing;
(2-2-4) soaking the stem sections obtained in the step (2-2-3) in a sodium hypochlorite solution, and washing to obtain the stem sections after disinfection and sterilization.
Further, in the step (2-2-1), the soaking time may be 10 min; the time for the rinsing may be 1 min.
In the step (2-2-2), the carbendazim solution can be 1000 times of carbendazim solution; the soaking time can be 30 min; the time for the rinsing may be 1 min.
In the step (2-2-3), the ethanol solution may be a 75% (volume fraction) ethanol solution; the soaking time can be 30 s; the number of flushes may be 2.
In the step (2-2-4), the sodium hypochlorite solution may be a sodium hypochlorite solution with 5% available chlorine; the soaking time can be 8-10 min; the number of the washing times can be 5-6, and the time of each washing can be 1 min.
In the step (2-3), the concentration of the 6-benzylaminopurine (6-BA) in the adventitious bud induction medium may be 0.1 to 0.5mg/L, or 0.1 to 0.2mg/L, or 0.2 to 0.5mg/L, or 0.1mg/L, or 0.2mg/L, or 0.5mg/L, specifically 0.2 mg/L.
The culture conditions were as follows: the culture temperature is 22 +/-2 ℃, the illumination intensity is 2000-3000lx, and the illumination time is 12-14 h/day.
Further, the adventitious bud induction medium consists of an MS (3/4 macroelement) medium, 6-BA, sucrose and agar. The concentration of the 6-BA in the adventitious bud induction medium is 0.2mg/L, the concentration of the sucrose in the adventitious bud induction medium is 20g/L, and the concentration of the agar in the adventitious bud induction medium is 5 g/L. The MS (3/4 macroelement) medium consisted of a solvent, which was water, and a solute, the concentrations of which are shown in table 2.
Further, the pH of the adventitious bud induction medium is 6.0.
In the step (2-4), the concentration of the 6-benzylaminopurine in the proliferation medium may be 0.5-1.0mg/L, or 0.5mg/L, or 1.0mg/L, specifically 0.5 mg/L.
The culture conditions were as follows: the culture temperature is 22 +/-2 ℃, the illumination intensity is 2000-3000lx, and the illumination time is 12-14 h/day.
Further, the proliferation medium is composed of MS medium, 6-BA, sucrose and agar. Wherein the concentration of the 6-BA in the multiplication medium is 0.5mg/L, the concentration of the sucrose in the multiplication medium is 30g/L, and the concentration of the agar in the multiplication medium is 5 g/L. The MS culture medium consists of a solvent and a solute, wherein the solvent is water, and the solute and the concentration thereof are shown in Table 1.
Further, the pH of the propagation medium was 6.0.
In the above method, in the step (3), the heat treatment includes three stages;
the first stage treatment is carried out for 1-5 days under the following conditions: at 28 deg.C in the daytime and 25 deg.C at night, and humidity of 30-50%;
the second stage is carried out for 6-12 days under the following treatment conditions: day 33 deg.C, night 28 deg.C, humidity 30-50%;
the third stage treatment is carried out for 13-35 days under the following treatment conditions: day 39 deg.C, night 33 deg.C, and humidity of 30-50%.
The daytime is the Beijing time of 8:00-20: 00; the night is 20: 00-8: 00 in Beijing.
In the above method, in the step (4), the method for peeling the stem tip includes the steps of: and cutting 1-2cm of the top end of the chrysanthemum seedling from the heat-treated aseptic seedling, then quickly inoculating the cut chrysanthemum seedling into a stem tip fixing culture medium (the stem tip fixing culture medium consists of an MS culture medium and agar, wherein the concentration of the agar in the stem tip fixing culture medium is 5g/L), and stripping the stem tip in the stem tip fixing culture medium to prevent the survival rate from being influenced by dehydration in the stem tip stripping process. The specific stripping method of the stem tip is as follows: under a 40-time dissecting mirror, gently fixing the material in the visual field by using a pair of tweezers on one hand, carefully and sequentially peeling off the young leaves outside the terminal buds of the chrysanthemum by using a scalpel (No. 11 scalpel) on the other hand, peeling off the redundant leaves of the chrysanthemum layer by layer, and only keeping the growth point and one leaf primordium on one side of the growth point.
The stem tip stripped from the heat-treated aseptic seedling has a length of 0.1-0.3 mm.
The NaH2PO4·H2The concentration of O in the CHR-1 medium was 112.5 mg/L.
The KNO3The concentration in the CHR-1 medium was 2250 mg/L.
Said (NH)4)2SO4The concentration in the CHR-1 medium was 90 mg/L.
The MgSO4·7H2The concentration of O in the CHR-1 medium was 375 mg/L.
The CaCl is2·2H2The concentration of O in the CHR-1 medium was 440 mg/L.
The concentration of the thiamine hydrochloride in the CHR-1 culture medium is 0.02 mg/L.
The concentration of the 6-BA in the CHR-1 medium can be 0.2-1.0mg/L or 0.2mg/L or 1.0mg/L, specifically 0.3 mg/L.
The concentration of the naphthylacetic acid (NAA) in the CHR-1 medium can be 0.1-0.3mg/L or 0.1mg/L or 0.3mg/L, specifically 0.1 mg/L.
The concentration of the activated carbon in the CHR-1 medium can be 300-500mg/L or 300mg/L or 500mg/L, in particular 500 mg/L.
Further, the CHR-1 culture medium is composed of an improved basic culture medium, activated carbon, 6-BA, NAA, sucrose and agar. The concentration of the activated carbon in the CHR-1 culture medium is 500mg/L, the concentration of the 6-BA in the CHR-1 culture medium is 0.3mg/L, the concentration of the NAA in the CHR-1 culture medium is 0.1mg/L, the concentration of the sucrose in the CHR-1 culture medium is 30g/L, and the concentration of the agar in the CHR-1 culture medium is 5 g/L. The improved basal medium is an improved MS medium, the improved MS medium is composed of a solvent and a solute, the solvent is water, and the solute and the concentration thereof are shown in Table 4.
Further, the CHR-1 medium has a pH of 6.0.
In the above method, in the step (5), the concentration of the 6-BA in the stem tip differentiation medium may be 0.1-0.3mg/L, or 0.1-0.2mg/L, or 0.2-0.3mg/L, or 0.1mg/L, or 0.2mg/L, or 0.3mg/L, specifically 0.2 mg/L.
The concentration of the NAA in the stem tip differentiation medium can be 0.05-0.2mg/L, or 0.05-0.1mg/L, or 0.1-0.2mg/L, or 0.05mg/L, or 0.1mg/L, or 0.2mg/L, and specifically 0.1 mg/L.
The concentration of the activated carbon in the stem tip differentiation medium can be 0.2-0.5mg/L or 0.2mg/L or 0.5mg/L, and specifically 0.5 mg/L.
Further, the stem tip differentiation medium consists of an MS medium, 6-BA, NAA, activated carbon, sucrose and agar. The concentration of the 6-BA in the stem tip differentiation medium is 0.2mg/L, the concentration of the NAA in the stem tip differentiation medium is 0.1mg/L, the concentration of the activated carbon in the stem tip differentiation medium is 0.5g/L, the concentration of the sucrose in the stem tip differentiation medium is 30g/L, and the concentration of the agar in the stem tip differentiation medium is 5 g/L.
Further, the stem tip differentiation medium had a pH of 6.0.
The step (5) is followed by the following steps:
(5-1) carrying out virus detection on the chrysanthemum indicum plants to obtain virus-free plants without carrying viruses;
(5-2) inoculating the detoxified plant into the multiplication culture medium for culturing to obtain a multiplied detoxified plant;
(5-3) cutting the proliferated stem segments of the detoxified plants into 2-3cm stem segments with 1-3 leaf buds, and then inoculating the stem segments into a rooting culture medium for culture to obtain the detoxified rooted seedlings; the rooting medium comprises naphthylacetic acid.
Further, the concentration of the naphthylacetic acid in the rooting medium can be 0.2-0.5mg/L or 0.2mg/L or 0.5mg/L, and specifically 0.5 mg/L.
Further, the rooting medium consists of 1/2MS medium and NAA. The concentration of the NAA in the rooting medium is 0.5 mg/L. The 1/2MS medium is composed of solvent and solute, the solvent is water, and the solute and its concentration are shown in Table 3.
In the method, the virus-infected chrysanthemum morifolium ramat is infected with tomato infertility virus TAV.
The feverfew may be a feverfew of Japan.
The Japanese chrysanthemum may be Hongchang.
It is also an object of the present invention to provide a complete culture medium.
The complete set of culture medium provided by the invention comprises the adventitious bud induction culture medium, the proliferation culture medium, the CHR-1 culture medium, the stem tip differentiation culture medium and the rooting culture medium.
Furthermore, the complete set of culture medium provided by the invention also comprises the stem tip fixing culture medium.
The application of the complete culture medium in any one of the following a1) -a4) also belongs to the protection scope of the invention:
a1) detoxification of the chrysanthemum indicum;
a2) preparing a detoxified product of the chrysanthemum indicum;
a3) cultivating the detoxified seedlings of the chrysanthemum indicum;
a4) preparing the product for cultivating the detoxified seedlings of the chrysanthemum.
The invention has the following beneficial effects:
1. the invention pre-detoxifies ribavirin solution with the concentration of 10mg/L injected into chrysanthemum plants infected with virus before detoxification, and a series of detoxification treatment is carried out on explants collected one month after injection, thus improving the detoxification rate to a certain extent.
2. The detoxification method adopted by the invention is heat treatment combined with the micro stem tip. The heat treatment adopts a day and night temperature changing mode, the heat treatment temperature is optimized, the detoxification rate of the stem tip tissue culture seedling obtained at the heat treatment temperature of 25-39 ℃ reaches 92.5%, and the detoxification rate of the stem tip is further improved. The heat-treated chrysanthemum growing points are separated from the leaf primordium and the tender leaves more flexibly, and the difficulty of stem tip peeling can be reduced to a certain degree (the stem tip growing points which are not subjected to heat treatment are bubble-shaped, and are easy to break in the operation process; so the difficulty of stem tip peeling can be reduced to a certain degree by heat treatment). Before the stem tip is stripped, the top end of a 1-2cm chrysanthemum plantlet which is subjected to heat treatment is firstly cut and inoculated to a culture dish provided with a stem tip fixed culture medium, and then the chrysanthemum plantlet is placed under a dissecting mirror for stripping the stem tip, so that the stem tip is not dehydrated too early and kept fresh, the stem tip stripping difficulty is reduced to a certain extent on one hand, and the survival rate of the stem tip inoculated to the culture medium on the other hand can be improved. The stem tip stripping is operated under a 40-time dissecting mirror, redundant leaves of chrysanthemum are stripped layer by layer, only a growth point and a leaf primordium on one side of the growth point are reserved, the size of the stem tip is 0.1-0.3mm, the stem tip stripping is more accurate, and the detoxification rate is also improved to a certain extent.
3. The invention adopts the CHR-1 culture medium to culture the stripped stem tips, thereby effectively improving the survival rate of the stem tips.
4. According to the invention, 0.5g/L of activated carbon is added into the stem tip differentiation culture medium, and the inoculated stem tip can be directly differentiated into a seedling on the culture medium without callus, so that on one hand, the excellent properties of the variety can be sufficiently stabilized, on the other hand, the detoxification time can be greatly saved, and the efficiency is higher.
Drawings
FIG. 1 shows the result of virus detection before detoxification of chrysanthemum morifolium. Lane M represents Marker, lane 1 represents a negative control, and lane 2 represents the detection of tomato infertility virus TAV of the tested detoxified material.
FIG. 2 shows the sterile seedling state of a chrysanthemum bud-bearing stem section after being inoculated into an adventitious bud induction culture medium for 10 days.
FIG. 3 shows the sterile seedling state of a chrysanthemum bud stem after being inoculated into a proliferation culture medium for 7 days.
FIG. 4 shows the pre-heat treatment state of sterilized seedlings in a bottle of chrysanthemum.
FIG. 5 shows the heat-treated state of sterilized seedlings of Chrysanthemum indicum L.
FIG. 6 shows the stem tip of 0.1-0.3mm in size.
FIG. 7 shows the stem tip after one month of culture.
FIG. 8 shows the stem apex after two months of culture.
FIG. 9 shows the results of virus detection of the detoxified plants of example 1. Lane M shows Marker, lane 1 shows a negative control, and lane 2 shows the result of detection of tomato infertility virus TAV of stem tip tissue-cultured seedlings.
FIG. 10 shows the proliferation status of the detoxified chrysanthemum seedlings.
FIG. 11 shows the rooting status of detoxified chrysanthemum seedlings.
FIG. 12 shows the result of virus detection on the detoxified plant of comparative example 1. Lane M shows Marker, lane 1 shows a negative control, and lane 2 shows the result of detection of tomato infertility virus TAV of stem tip tissue-cultured seedlings.
Detailed Description
The following examples are given to facilitate a better understanding of the invention, but do not limit the invention. The experimental procedures in the following examples are conventional unless otherwise specified. The test materials used in the following examples were purchased from a conventional biochemical reagent store unless otherwise specified. The quantitative tests in the following examples, all set up three replicates and the results averaged.
In the following examples, the variety of Chamomile is the Japanese chamomile variety Hongchang, which is a product of the Nippon Jingxing garden, and the catalog number is 030-.
Ribavirin in the following examples is a product from Shandong Jingwei pharmaceuticals, Inc. under catalog number H20093066.
The detergents in the following examples are products of Shanghai and blue and white Cat Inc. under the catalog number GB 14930.
Carbendazim in the following examples is a product of Guanghong agro-chemical GmbH of Sichuan, catalog number HG/T3290.
The activated carbon in the examples described below is a product of Shanghai agricultural Biotech, Inc., catalog number 180936.
The specific steps for identifying whether the chrysanthemum morifolium is infected with or carries tomato infertility virus TAV in the following examples are as follows: extracting RNA of a chrysanthemum plant to be detected, and performing reverse transcription to obtain cDNA; using cDNA as template and TAV-F1And TAV-R1Carrying out a first round of PCR reaction to obtain a first round of PCR product; the first round PCR product was used as a template for the second round using TAV-F2 and TAV-R2And carrying out PCR to obtain a second round of PCR products (final products). If the fragment size of the final product is 328bp, the to-be-detected chrysanthemum carries the tomato infertility virus TAV, otherwise, the to-be-detected chrysanthemum does not carry the tomato infertility virus TAV. The primer sequences are as follows:
TAV-F1：CCATCCCTTCAACATCCGAC；
TAV-R1：GTTGAAGCGGAAGGAATACG；
TAV-F2：TTATTGCTGGGAAGAAGTGTCG；
TAV-R2：CGGTGGGAACGTGCTGAT。
the MS medium in the following examples consists of a solvent, which is water, and solutes, the concentrations of which are shown in Table 1.
TABLE 1
The MS (3/4 macroelement) medium in the following examples consisted of a solvent, which was water, and a solute, the concentrations of which are shown in Table 2.
TABLE 2
The 1/2MS medium in the following examples consisted of a solvent, which was water, and a solute, the concentrations of which are shown in Table 3.
TABLE 3
Example 1 cultivation method of detoxified seedlings of Chrysanthemum
Test detoxification materials: by identifying the chrysanthemum morifolium (collected from the planting base of Haifeng flowers Co., Ltd. in Zhejiang) infected with the tomato sterility virus TAV, the chrysanthemum morifolium is a chrysanthemum morifolium seedling obtained after 18 days of cuttage and culture, and is in a vegetative growth period. The identification result of the Tay tomato sterility virus TAV is shown in FIG. 1.
Pre-detoxification of ribavirin
The test detoxification material was subjected to a pre-detoxification treatment. The method comprises the following specific steps:
1. preparation of ribavirin solutions
A solution of ribavirin (solvent is water) with a concentration of 10mg/L is prepared.
2. Pre-detoxification treatment
And (3) injecting the ribavirin solution prepared in the step (1) into a tested detoxification material by using a disposable injector, wherein the injection amount is 5mL, and the injection position is a plant stem 2cm away from the ground, so as to obtain the injected chrysanthemum.
3. Culture after pre-detoxification treatment
And (3) culturing the injected chrysanthemum morifolium obtained in the step (2) under the conditions that the air humidity is 50-75%, the environmental temperature is 15-30 ℃, the illumination time is 14 h/day and the illumination intensity is 5-10 ten thousand Lux, paying attention to insect prevention and bacterium prevention during the culture period, and culturing for 30 days to obtain the pre-detoxified chrysanthemum morifolium.
Secondly, sterile culture of explants
Taking the stem section of the pre-detoxified chrysanthemum as an explant to carry out aseptic culture, and specifically comprising the following steps:
1. primary culture
1) And (3) selecting the current-year shoots of the pre-detoxified chrysanthemum obtained in the step one, cutting off leaves of the current-year shoots, and then cutting stem sections of the current-year shoots into small sections with 4-5 buds to obtain stem sections with buds (4-5 buds).
2) Soaking the stem segments with buds obtained in the step 1) in liquid detergent for 10min, taking out, and washing each stem segment with buds with running water for 1 min; then soaking the cleaned stem segments with the buds in 1000 times of carbendazim solution for 30min, taking out and washing each stem segment with the buds with running water for 1 min; soaking the cleaned stem segments with buds in 75% (volume fraction) ethanol solution for 30s on a superclean workbench, taking out, and washing with sterile water for 2 times; and finally, soaking the washed stem segments with buds in a sodium hypochlorite solution with effective chlorine of 5% for 10min, taking out, washing with sterile water for 6 times, and washing for 1min each time to obtain the sterilized stem segments.
3) Cutting the stem section obtained in the step 2) after disinfection and sterilization into small sections with the length of about 2-3cm, wherein each small section is provided with 1-3 axillary buds, and simultaneously cutting off the parts of the two ends of the stem section, which are 2-3mm and are contacted with the medicine, so as to obtain the stem section with buds (1-3 buds).
4) Inoculating the stem segments with buds obtained in the step 3) into tissue culture bottles containing adventitious bud induction culture media, and culturing in an illumination culture room, wherein each tissue culture bottle is inoculated with 1 stem segment with buds, and the culture conditions are as follows: the culture temperature is 22 +/-2 ℃, the illumination intensity is 2000lx, and the illumination time is 14 h/day.
The adventitious bud induction culture medium consists of MS (3/4 macroelements) culture medium, 6-BA, sucrose and agar. Wherein the concentration of 6-BA in the adventitious bud induction culture medium is 0.2mg/L, the concentration of sucrose in the adventitious bud induction culture medium is 20g/L, and the concentration of agar in the adventitious bud induction culture medium is 5 g/L. The pH of the adventitious bud induction medium was 6.0.
The sterile seedling state after the stem segment with the bud is inoculated into the adventitious bud induction culture medium for 10 days is shown in figure 2.
2. Proliferation culture
After the stem section with the bud is cultured in an adventitious bud culture medium for 10 days, the axillary leaf on the stem section of the explant grows to be adventitious bud about 2 cm. When the adventitious bud grows to 5-6cm, cutting into stem segments with 1-3 leaf buds with the length of about 2cm, inoculating the stem segments into tissue culture bottles containing proliferation culture medium, and culturing in an illumination culture room, wherein each tissue culture bottle is inoculated with 7 stem segments with buds, and the culture conditions are as follows: the culture temperature is 22 +/-2 ℃, the illumination intensity is 2000lx, and the illumination time is 14 h/day.
The proliferation culture medium consists of MS culture medium, 6-BA, cane sugar and agar. Wherein the concentration of 6-BA in the proliferation culture medium is 0.5mg/L, the concentration of sucrose in the proliferation culture medium is 30g/L, and the concentration of agar in the proliferation culture medium is 5 g/L. The pH of the propagation medium was 6.0.
The sterile seedling state 7 days after the budded stem section is inoculated into the proliferation medium is shown in figure 3.
Thirdly, heat treatment is combined with stem tip culture for detoxification
1. Thermal treatment
Culturing the sterile bottle seedlings obtained after culturing for 6 days in the enrichment medium in the step two in a light culture chamber for 7 days, placing the bottle seedlings in a light culture box, and performing heat treatment in a day-night temperature changing mode to passivate viruses sensitive to temperature in the chrysanthemum body so as to further improve the detoxification rate of the stem tips. The method comprises the following specific steps:
the total treatment time for the heat treatment was 35 days.
1) The treatment conditions on days 1-5 were as follows:
high temperature of 28 ℃ in the daytime (8:00-20: 00);
low temperature 25 ℃ at night (20: 00-8: 00 days in the next time);
the humidity is 30-50%.
2) The treatment conditions on days 6-12 were as follows:
high temperature of 33 ℃ in daytime (8:00-20: 00);
low temperature of 28 ℃ at night (20: 00-8: 00 days in the next time);
the humidity is 30-50%.
3) The treatment conditions on days 13-35 were as follows:
the high temperature is 39 ℃ in the daytime (8:00-20: 00);
low temperature of 33 ℃ at night (20: 00-8: 00 days in the next time);
the humidity is 30-50%.
The state of the sterilized bottle seedlings before heat treatment is shown in FIG. 4, and the state after heat treatment is shown in FIG. 5.
2. Stem tip peeling, inoculating and culturing
1) Peeling of stem tip
Cutting 1-2cm of the top end of the chrysanthemum seedling in the sterile bottle seedling subjected to heat treatment in the step 1 in a superclean workbench by using tweezers and a blade, then quickly inoculating the seedling into a stem tip fixing culture medium to prevent the survival rate from being influenced by dehydration in the stem tip peeling process, slightly fixing the material in a visual field by using the tweezers in one hand under a 40-time dissecting mirror, carefully and sequentially peeling off the young leaves outside the chrysanthemum terminal bud by using a No. 11 scalpel in the other hand, paying attention to not prematurely breaking the stem in the operation process so as not to increase the peeling difficulty until the stem tip with a smooth surface and a disc shape and slight brightness can be seen under the dissecting mirror.
The stem tip fixing culture medium consists of MS culture medium and agar. Wherein the concentration of the agar in the stem tip fixing culture medium is 5 g/L. The pH of the shoot tip fixing medium was 6.0.
2) Shoot apex inoculation
Cutting the shoot tip tissue obtained in the step 1) with a scalpel to obtain a shoot tip with a length of about 0.1-0.3mm (fig. 6), then quickly inoculating in a CHR-1 culture medium, and lightly placing on the surface of the culture medium during inoculation to avoid burying the shoot tip deeply in the culture medium.
The CHR-1 culture medium consists of a modified MS culture medium, activated carbon, 6-BA, NAA, sucrose and agar. The concentration of activated carbon in the CHR-1 medium was 500mg/L, the concentration of 6-BA in the CHR-1 medium was 0.3mg/L, the concentration of NAA in the CHR-1 medium was 0.1mg/L, the concentration of sucrose in the CHR-1 medium was 20g/L, and the concentration of agar in the CHR-1 medium was 5 g/L. The modified MS medium consisted of solvent and solute, the solvent was water, and the solute and its concentration are shown in Table 4. The pH of the CHR-1 medium was 6.0.
TABLE 4
3) Shoot tip culture
Transferring the stem tip obtained in the step 2) after inoculation into a culture chamber for illumination culture, wherein the culture conditions are as follows: the culture temperature is 22 +/-2 ℃, the illumination intensity is 2000lx, and the illumination time is 14 h/day. The growth of the stem tip is regularly observed in the culture process, the stem tip begins to grow and turn green (the length of the stem tip is 0.8-1.0mm, figure 7) after about one month of culture can be observed in a hidden way, and the survival rate of the stem tip is counted. The stem tip survival rate calculation formula is as follows: (number of surviving shoot tips/total number of inoculated shoot tips). times.100%. The results show that: the survival rate of the stem tip is 58 percent (87/150).
Then, stem tips with the length of 0.8-1.0mm are transferred to a stem tip differentiation medium for illumination culture under the following culture conditions: the culture temperature is 22 +/-2 ℃, the illumination intensity is 2000lx, and the illumination time is 14 h/day. After 30 days of growth in shoot tip differentiation medium, shoots were separated and grown in shoot tip differentiation medium for 60 days to form whole chrysanthemum plants (FIG. 8).
The stem tip differentiation culture medium consists of an MS culture medium, 6-BA, NAA, activated carbon, sucrose and agar. Wherein the concentration of the 6-BA in the stem tip differentiation medium is 0.2mg/L, the concentration of the NAA in the stem tip differentiation medium is 0.1mg/L, the concentration of the activated carbon in the stem tip differentiation medium is 0.5g/L, the concentration of the sucrose in the stem tip differentiation medium is 30g/L, and the concentration of the agar in the stem tip differentiation medium is 5 g/L. The pH of the shoot tip differentiation medium was 6.0.
3. Virus detection
Carrying out the TAV detection of the tomato sterility virus on the chrysanthemum indicum plant (stem tip tissue culture seedling) obtained in the step 2 and carrying out statistics on the detoxification rate to determine the detoxification effect. The calculation formula of the detoxification rate is as follows: (number of detoxified plants/number of heat-treated plants) × 100%. The results show that: the detoxification rate is 92.5% (185/200). The results of virus detection of partially detoxified shoot tip tissue culture seedlings are shown in FIG. 9.
Fourthly, culture after detoxification
1. Proliferation culture
Inoculating the chrysanthemum indicum plant which is identified and does not carry the tomato sterility virus TAV into a proliferation culture medium for proliferation culture, wherein the culture conditions are as follows: the culture temperature is 22 +/-2 ℃, the illumination intensity is 2000lx, and the illumination time is 14 h/day. After 30 days of culture, proliferated detoxified plants were obtained (fig. 10).
2. Rooting culture
Cutting the proliferated stem segment of the detoxified plant obtained in the step 1 into stem segments with about 2cm and 1-3 leaf buds on an ultraclean workbench, inoculating the stem segments into a rooting culture medium for rooting culture, obviously observing the growth of a root system after culturing for 5-7 days, and culturing in the rooting culture medium for 30 days to obtain the detoxified rooted seedling (figure 11).
The rooting culture medium consists of 1/2MS culture medium, NAA, cane sugar and agar. The concentration of NAA in the rooting medium is 0.5mg/L, the concentration of sucrose in the rooting medium is 30g/L, and the concentration of agar in the rooting medium is 5 g/L. The rooting medium had a pH of 6.0.
Comparative example 1
Test detoxification materials: by identifying the chrysanthemum morifolium (collected from the planting base of Haifeng flowers Co., Ltd. in Zhejiang) infected with the tomato sterility virus TAV, the chrysanthemum morifolium is a chrysanthemum morifolium seedling obtained after 18 days of cuttage and culture, and is in a vegetative growth period.
First, culture of test detoxification materials
The tested virus-free material is not pretreated by ribavirin, and the stem segment of the chrysanthemum infected with tomato infertility virus TAV is directly used as an explant for aseptic culture.
Step two, the same method as in example 1
Step three, the same method as in example 1
The statistical results of the detoxification rates of the stem tip tissue-cultured seedlings obtained according to the method of comparative example 1 are shown in table 5. The results show that: the detoxification rate is 56% (112/200). The results of virus detection of a part of shoot tip tissue-cultured seedlings are shown in FIG. 12.
As can be seen from table 5: the detoxification rate of the obtained stem tip tissue culture seedlings is obviously reduced when the heat treatment temperature is 25-39 ℃ without virus azole pre-detoxification. In the embodiment 1 of the invention, the detoxication rate of the stem tip tissue culture seedling obtained by pre-detoxication of ribavirin is 92.5 percent at the heat treatment temperature of 25-39 ℃. It is demonstrated that the ribavirin pretreatment step in the detoxification method of the present invention plays a crucial role in the detoxification effect.
TABLE 5
| Group of | Example 1 | Comparative example 1 |
| Whether or not to be pretreated by ribavirin | Is that | Whether or not |
| Temperature of heat treatment | 25-39℃ | 25-39℃ |
| Number of heat-treated plants | 200 | 200 |
| Number of detoxified plants | 185 | 112 |
| Rate of detoxification | 92.5％ | 56％ |
Comparative example 2
Test detoxification materials: by identifying the chrysanthemum morifolium (collected from the planting base of Haifeng flowers Co., Ltd. in Zhejiang) infected with the tomato sterility virus TAV, the chrysanthemum morifolium is a chrysanthemum morifolium seedling obtained after 18 days of cuttage and culture, and is in a vegetative growth period.
Step one, the same method as in step one of embodiment 1
Step two, the same method as in example 1
Thirdly, the heat treatment mode in the third step of the embodiment 1 is replaced by the heat treatment mode in the invention patent application with the name of ' a heat treatment stem tip detoxification tissue culture substrate and method suitable for chrysanthemum morifolium and the application publication number of ' CN110741930A ', and the heat treatment mode is as follows: the illumination is 12h/d, the illumination intensity is 3000Lx, and the temperature is 28-32 ℃ in day and night; 30-35 ℃; and (3) shifting every 2d in the sequence of 33-38 ℃. Then continuing heat treatment detoxification culture at 33-38 ℃ for 30 d. The other steps are the same as in step three of example 1.
The statistical results of the detoxification rates of the stem tip tissue-cultured seedlings obtained according to the method of comparative example 2 are shown in table 6. The results show that: the detoxification rate was 47.5% (95/200).
As can be seen from table 6: the detoxification rate of the stem tip tissue cultured seedlings obtained according to the heat treatment method of comparative example 2 at the heat treatment temperature of 28-38 ℃ was significantly reduced. The detoxication rate of the stem tip tissue culture seedlings obtained by the heat treatment mode in the embodiment 1 of the invention at the heat treatment temperature of 25-39 ℃ reaches 92.5 percent. The heat treatment mode and temperature of the invention are shown to play a crucial role in the detoxification effect.
TABLE 6
| Group of | Example 1 | Comparative example 2 |
| Whether or not to be pretreated by ribavirin | Is that | Is that |
| Temperature of heat treatment | 25-39℃ | 28-38℃ |
| Number of heat-treated plants | 200 | 200 |
| Number of detoxified plants | 185 | 95 |
| Rate of detoxification | 92.5％ | 47.5％ |
Comparative example 3
Test detoxification materials: by identifying the chrysanthemum morifolium (collected from the planting base of Haifeng flowers Co., Ltd. in Zhejiang) infected with the tomato sterility virus TAV, the chrysanthemum morifolium is a chrysanthemum morifolium seedling obtained after 18 days of cuttage and culture, and is in a vegetative growth period.
Step one, the same method as in step one of embodiment 1
Step two, the same method as in example 1
Third, the CHR-1 medium in step three of example 1 was replaced with a normal medium (CHR-2 medium), and the other steps were the same as those in step three of example 1. Wherein the common culture medium (CHR-2 culture medium) comprises MS solid culture medium, activated carbon, 6-BA, NAA, sucrose and agar. The concentration of activated carbon in the CHR-2 medium was 500mg/L, the concentration of 6-BA in the CHR-2 medium was 0.2mg/L, the concentration of NAA in the CHR-2 medium was 0.1mg/L, the concentration of sucrose in the CHR-2 medium was 20g/L, and the concentration of agar in the CHR-2 medium was 5 g/L. The MS culture medium is composed of solvent and solute, the solvent is water, and the solute and the concentration thereof are shown in Table 1. The statistical results of the survival rate of the shoot tips obtained according to the method of comparative example 3 are shown in Table 7.
As can be seen from table 7: the survival rate of stem tips cultured using the CHR-1 medium of the present invention (stem tip survival rate in example 1) was significantly higher than that of the stem tips in comparative example 3. The CHR-1 culture medium has the components and the concentration which greatly improve the survival rate of the stem tip.
TABLE 7
| Group of | Example 1 | Comparative example 3 | Comparative example 4 | Comparative example 5 | Comparative example 7 |
| Number of shoot tips inoculated | 150 | 150 | 150 | 150 | 150 |
| Number of stem tip survived | 87 | 20 | 41 | 47 | 34 |
| Survival rate | 58％ | 13.3％ | 27.33％ | 31.33％ | 22.66％ |
Comparative example 4
Test detoxification materials: by identifying the chrysanthemum morifolium (collected from the planting base of Haifeng flowers Co., Ltd. in Zhejiang) infected with the tomato sterility virus TAV, the chrysanthemum morifolium is a chrysanthemum morifolium seedling obtained after 18 days of cuttage and culture, and is in a vegetative growth period.
Step one, the same method as in step one of embodiment 1
Step two, the same method as in example 1
Thirdly, mixing the fruitsIn the third step of example 1, the CHR-1 culture medium and the stem tip culture method are replaced by a method with the name of 'a heat treatment stem tip detoxification tissue culture substrate and method suitable for chrysanthemum morifolium ramat', the stem tip induction culture medium combination and the stem tip induction culture medium I + stem tip induction culture medium II replacement culture in the invention patent application with the application publication number of 'CN 110741930A', the specific operation method is that the stem tip stripped under a microscope is taken as an explant to be inoculated into the stem tip induction culture medium I for induction culture, after 25 days of culture, the stem tip with the existing sprout is transferred into the stem tip induction culture medium II for culture for 30 days, the stem tip tissue with obvious greening is transferred into the stem tip induction culture medium I for culture for 30 days, and the stem tip tissue is alternately cultured in such a way until seedlings are formed; wherein, the stem tip induction culture medium I is 1/2B5Culture medium, calcium nitrate, 6-BA, NAA, sucrose, agar and AC. The concentration of calcium nitrate in the stem tip induction medium I is 500mg/L, the concentration of 6-BA in the stem tip induction medium I is 0.2mg/L, the concentration of NAA in the stem tip induction medium I is 0.1mg/L, the concentrations of sucrose and agar in the stem tip induction medium I are 20g/L and 4.4g/L respectively, and the concentration of AC in the stem tip induction medium I is 0.5 mg/L; the pH of the shoot tip induction medium I was 5.8. The stem tip induction culture medium II consists of an MS solid culture medium, 6-BA, IBA, sucrose and agar, wherein the concentration of the 6-BA in the stem tip induction culture medium II is 0.2mg/L, the concentration of the IBA stem tip induction culture medium II is 0.1mg/L, and the concentrations of the sucrose and the agar in the stem tip induction culture medium I are respectively 20g/L and 4.4 g/L. The other steps are the same as in step three of example 1. The statistical results of the survival rate of the shoot tips obtained according to the method of comparative example 4 are shown in Table 7.
As can be seen from table 7: the survival rate of the stem tip cultured by the CHR-1 culture medium according to the method (the survival rate of the stem tip in the example 1) is obviously higher than that of the stem tip induction culture medium combination and the method for alternate culture of the stem tip induction culture medium I + the stem tip induction culture medium II in the comparative example 4. The CHR-1 culture medium has the components and the concentration which greatly improve the survival rate of the stem tip.
Comparative example 5
Test detoxification materials: by identifying the chrysanthemum morifolium (collected from the planting base of Haifeng flowers Co., Ltd. in Zhejiang) infected with the tomato sterility virus TAV, the chrysanthemum morifolium is a chrysanthemum morifolium seedling obtained after 18 days of cuttage and culture, and is in a vegetative growth period.
Step one, the same method as in step one of embodiment 1
Step two, the same method as in example 1
Thirdly, the CHR-1 culture medium in the third step of example 1 is replaced with a culture method named as "cultivation method of detoxified seedlings of chrysanthemum morifolium ramat by combining micro stem tip culture with heat treatment", and the detoxified stem tip adventitious bud induction culture medium JH7 in the invention patent application with the application publication number of "CN 109258460A", and the detoxified stem tip adventitious bud induction culture medium JH7 is composed of ZL culture medium, 6-benzylaminopurine, a-naphthylacetic acid, gibberellin, fresh coconut juice, trehalose, sucrose and compound carrageenan. Wherein the concentration of ZL culture medium in JH7 is 0.2mg/L, the concentration of 6-benzylaminopurine in JH7 is 0.01mg/L, the concentration of alpha-naphthylacetic acid in JH7 is 0.2mg/L, the concentration of gibberellin in JH7 is 0.5mg/L, the concentration of fresh coconut juice in JH7 is 100ml/L, the concentration of trehalose in JH7 is 10mg/L, the concentration of sucrose in JH7 is 30g/L, and the concentration of composite carrageenan in JH7 is 5.5 g/L. The other steps are the same as in step three of example 1. The statistical results of the survival rate of the shoot tips obtained according to the method of comparative example 5 are shown in Table 7.
As can be seen from table 7: the survival rate of the stem tip cultured by the CHR-1 culture medium (the survival rate of the stem tip in the example 1) is obviously higher than that of the stem tip cultured by the detoxified stem tip adventitious bud induction culture medium JH7 in the comparative example 5. The CHR-1 culture medium has the components and the concentration which greatly improve the survival rate of the stem tip.
Comparative example 6
Test detoxification materials: by identifying the chrysanthemum morifolium (collected from the planting base of Haifeng flowers Co., Ltd. in Zhejiang) infected with the tomato sterility virus TAV, the chrysanthemum morifolium is a chrysanthemum morifolium seedling obtained after 18 days of cuttage and culture, and is in a vegetative growth period.
First, culture of test detoxification materials
The tested virus-free material is not subjected to ribavirin pretreatment, and the stem segment of the chrysanthemum infected with the tomato infertility virus TAV is directly used as an explant for aseptic culture;
step two, the same method as in example 1
And thirdly, replacing the heat treatment culture condition, the micro stem tip sterile cutting mode and the virus-free stem tip adventitious bud induction culture medium in the third step of the example 1 with a culture method for obtaining the virus-free seedlings of the chrysanthemum zengchenii by combining micro stem tip culture and heat treatment, the heat treatment culture condition, the micro stem tip sterile cutting mode and the virus-free stem tip adventitious bud induction culture medium in the invention patent application with the application publication number of CN109258460A, and other steps are the same as the method in the third step of the example 1. The invention relates to a cultivation method for obtaining virus-free seedlings of the chrysanthemum morifolium ramat by combining micro-stem tip cultivation with heat treatment, and the heat treatment cultivation conditions, the micro-stem tip sterile cutting mode and the virus-free stem tip adventitious bud induction culture medium in the invention patent application with the application publication number of CN109258460A are as follows:
1. heat treatment culture conditions
And the specific operation steps comprise the step two of placing the sterile tissue culture bottle seedling obtained in the step two into an illumination incubator for heat treatment culture, illuminating for 10 hours every day in the illumination incubator with the temperature of 40 ℃ and the illumination intensity of 2000Lux, and continuously culturing for 72 hours to obtain the culture seedling for pre-detoxification.
2. Microstem tip sterile cutting mode and virus-free stem tip adventitious bud induction culture medium
The specific operation steps are that under the aseptic condition, the stem tip of the pre-detoxified culture seedling is cut under an ultraclean workbench dissecting mirror for 1.9mm, and the stem tip is inoculated into the detoxified stem tip adventitious bud induction culture medium JH7 for 25 days to obtain the detoxified adventitious bud. Wherein the detoxified stem tip adventitious bud induction medium JH7 comprises ZL medium, 6-benzylaminopurine, alpha-naphthylacetic acid, gibberellin, fresh coconut juice, trehalose, sucrose, and compound carrageenan. Wherein the concentration of ZL culture medium in JH7 is 0.2mg/L, the concentration of 6-benzylaminopurine in JH7 is 0.01mg/L, the concentration of alpha-naphthylacetic acid in JH7 is 0.2mg/L, the concentration of gibberellin in JH7 is 0.5mg/L, the concentration of fresh coconut juice in JH7 is 100ml/L, the concentration of trehalose in JH7 is 10mg/L, the concentration of sucrose in JH7 is 30g/L, and the concentration of composite carrageenan in JH7 is 5.5 g/L.
The statistical results of the detoxification rates of the stem tip tissue-cultured seedlings obtained according to the method of comparative example 6 are shown in table 8. The results show that: the detoxification rate is 26.5% (53/200).
As can be seen from table 8: the detoxification rate of the stem tip tissue cultured seedlings obtained under the heat treatment culture conditions, the micro-stem tip aseptic cutting manner and the conditions of detoxification of the adventitious bud induction medium of the stem tip in comparative example 6 was significantly reduced. In the embodiment 1 of the invention, the detoxification rate of the stem tip tissue culture seedlings obtained when the heat treatment temperature is 25-39 ℃, the size of the micro stem tip is 0.1-0.3mm and the stem tip culture medium is CHR-1 reaches 92.5%. The detoxification method of the invention has better and stable detoxification effect.
TABLE 8
| Group of | Example 1 | Comparative example 6 |
| Whether or not to be pretreated by ribavirin | Is that | Whether or not |
| Temperature of heat treatment | 25-39℃ | 40℃ |
| Time of heat treatment | 35d | 72h |
| Cutting stem tip into size | 0.1-0.3mm | 1.9mm |
| Stem tip culture medium | CHR-1 | JH7 |
| Number of plants treated by comparison | 200 | 200 |
| Number of detoxified plants | 185 | 53 |
| Rate of detoxification | 92.5％ | 26.5％ |
Comparative example 7
Test detoxification materials: by identifying the chrysanthemum morifolium (collected from the planting base of Haifeng flowers Co., Ltd. in Zhejiang) infected with the tomato sterility virus TAV, the chrysanthemum morifolium is a chrysanthemum morifolium seedling obtained after 18 days of cuttage and culture, and is in a vegetative growth period.
Step one, the same method as in step one of embodiment 1
Step two, the same method as in example 1
Thirdly, heat treatment is combined with stem tip culture for detoxification
1. Heat treatment method in step three of example 1
2. Stem tip peeling, inoculating and culturing
1) Peeling of stem tip
Cutting the top end of the heat-treated sterile bottle seedling in the step 1 in a superclean workbench by 1-2cm by using forceps and a blade, then directly under a 40-fold dissecting mirror, slightly fixing the material in the visual field by using the forceps in one hand, carefully and sequentially stripping the young leaves outside the terminal bud of the chrysanthemum by using a No. 11 scalpel in the other hand, and carrying out the other operations like the method 1) in the step three 2 of the example 1 without carrying out inoculation treatment on a stem tip fixing culture medium.
2) The shoot tips were inoculated by the same method as 2) in step three 2 of example 1.
3) Shoot tip culture was performed in the same manner as in 3) of step three 2 of example 1.
3. Virus detection method in step three of example 1
The statistical results of the survival rate of the shoot tips obtained according to the method of comparative example 7 are shown in Table 7.
As can be seen from table 7: the survival rate of the stem tip obtained by peeling the stem tip and then culturing the stem tip by using the stem tip fixing medium of the invention is significantly higher than that of the stem tip in the comparative example 7. The stem tip fixing culture medium can relieve the situation that the stem tip is rapidly dehydrated in the stripping process to a certain extent, and greatly improves the survival rate of the stem tip.
The foregoing is only a preferred embodiment of the present invention, and it should be noted that, for those skilled in the art, various modifications and decorations can be made without departing from the technical principle of the present invention, and these modifications and decorations should also be regarded as the protection scope of the present invention.
Claims (10)
1. A culture method of a chrysanthemum virus-free seedling comprises the following steps:
(1) performing pre-detoxification treatment on the chrysanthemum infected with the virus to obtain pre-detoxified chrysanthemum;
(2) sequentially culturing the stem sections of the pre-detoxified chrysanthemum in an adventitious bud induction culture medium and an enrichment culture medium to obtain aseptic seedlings;
(3) carrying out heat treatment on the aseptic seedlings to obtain heat-treated aseptic seedlings;
(4) culturing the stem tip stripped from the heat-treated aseptic seedling in a CHR-1 culture medium until the stem tip with the length of 0.8-1.0mm is obtained;
the CHR-1 medium comprises NaH2PO4·H2O、KNO3、(NH4)2SO4、MgSO4·7H2O、CaCl2·2H2O、Thiamine hydrochloride, 6-benzylamino adenine, naphthylacetic acid and activated carbon;
(5) culturing the stem tip with the length of 0.8-1.0mm in a stem tip differentiation culture medium to obtain a chrysanthemum plant;
the stem tip differentiation medium comprises 6-benzylamino adenine, naphthylacetic acid and activated carbon.
2. The method of claim 1, wherein: in the step (1), the pre-detoxification treatment is to inject the virus-infected chrysanthemum morifolium into a ribavirin solution;
or, the concentration of the ribavirin solution is 8-10 mg/L;
or, the injection dosage is 3-5 mL.
3. The method according to claim 1 or 2, characterized in that: the step (2) comprises the following steps:
(2-1) selecting current-year shoots of the pre-detoxified chrysanthemum, and cutting stem segments of the current-year shoots into small segments with 4-5 buds to obtain stem segments with 4-5 buds;
(2-2) sterilizing the stem sections with 4-5 buds to obtain sterilized stem sections;
(2-3) cutting the sterilized stem segments into 2-3cm long stem segments with 1-3 axillary buds, and inoculating the stem segments into an adventitious bud induction culture medium for culture;
the adventitious bud culture medium comprises 6-benzylamino adenine;
(2-4) when the adventitious bud of the stem segment with 1-3 buds grows to 5-6cm, cutting the stem segment into stem segments with 2-3cm and 1-3 leaf buds, and inoculating the stem segments into a multiplication culture medium for culture;
the multiplication medium comprises 6-benzylamino adenine.
4. The method of claim 3, wherein: the method for sterilization in the step (2-2) comprises the following steps:
(2-2-1) soaking the stem segments with 4-5 buds in liquid detergent, and washing;
(2-2-2) soaking the stem segments obtained in the step (2-2-1) in carbendazim, and washing;
(2-2-3) soaking the stem segments obtained in the step (2-2-2) in an ethanol solution, and washing;
(2-2-4) soaking the stem sections obtained in the step (2-2-3) in a sodium hypochlorite solution, and washing to obtain disinfected and sterilized stem sections;
or, the culture conditions in the step (2-3) are as follows: the culture temperature is 22 +/-2 ℃, the illumination intensity is 2000-;
or, the culture conditions in the step (2-4) are as follows: the culture temperature is 22 +/-2 ℃, the illumination intensity is 2000-;
or, the concentration of the 6-benzylamino adenine in the adventitious bud induction culture medium is 0.1-0.5 mg/L;
or the concentration of the 6-benzylaminopurine in the proliferation culture medium is 0.5-1.0 mg/L.
5. The method according to any one of claims 1 to 4, wherein: in the step (3), the heat treatment comprises three stages;
the first stage treatment is carried out for 1-5 days under the following conditions: at 28 deg.C in the daytime and 25 deg.C at night, and humidity of 30-50%;
the second stage is carried out for 6-12 days under the following treatment conditions: day 33 deg.C, night 28 deg.C, humidity 30-50%;
the third stage treatment is carried out for 13-35 days under the following treatment conditions: day 39 deg.C, night 33 deg.C, and humidity of 30-50%.
6. The method according to any one of claims 1 to 5, wherein: in the step (4), the method for peeling the stem tip comprises the following steps: cutting 1-2cm of the top end of the heat-treated aseptic seedling off the chrysanthemum seedling, then inoculating the cut chrysanthemum seedling into a stem tip fixed culture medium, and stripping the stem tip from the stem tip fixed culture medium;
or the stem tip stripped from the heat-treated aseptic seedling is 0.1-0.3mm long;
or, the NaH2PO4·H2The concentration of O in the CHR-1 medium is 112.5 mg/L;
or, the KNO3The concentration in the CHR-1 culture medium is 2250 mg/L;
or, the (NH)4)2SO4The concentration in the CHR-1 culture medium is 90 mg/L;
or, the MgSO4·7H2The concentration of O in the CHR-1 medium is 375 mg/L;
or, the CaCl2·2H2The concentration of O in the CHR-1 culture medium is 440 mg/L;
or, the concentration of the thiamine hydrochloride in the CHR-1 culture medium is 0.02 mg/L;
or, the concentration of the 6-benzylamino adenine in the CHR-1 culture medium is 0.2-1.0 mg/L;
or, the concentration of the naphthylacetic acid in the CHR-1 culture medium is 0.1-0.3 mg/L;
or the concentration of the activated carbon in the CHR-1 culture medium is 300-500 mg/L.
7. The method according to any one of claims 1 to 6, wherein: in the step (5), the concentration of the 6-benzylamino adenine in the stem tip differentiation culture medium is 0.1-0.3 mg/L;
or, the concentration of the naphthylacetic acid in the stem tip differentiation culture medium is 0.05-0.2 mg/L;
or the concentration of the activated carbon in the stem tip differentiation medium is 0.2-0.5 mg/L;
or, the step (5) is followed by the following steps:
(5-1) carrying out virus detection on the chrysanthemum indicum plants to obtain virus-free plants without carrying viruses;
(5-2) inoculating the detoxified plant into the multiplication culture medium for culturing to obtain a multiplied detoxified plant;
(5-3) cutting the proliferated stem segments of the detoxified plants into 2-3cm stem segments with 1-3 leaf buds, and inoculating the stem segments into a rooting culture medium for culture to obtain the detoxified rooted seedlings; the rooting medium comprises naphthylacetic acid;
or the concentration of the naphthylacetic acid in the rooting culture medium is 0.2-0.5 mg/L.
8. The method according to any one of claims 1 to 7, wherein: the chrysanthemum morifolium infected with the virus is the chrysanthemum morifolium infected with tomato infertility virus TAV;
or, the parthenolide is a parthenolide japonica;
or, the Japanese chrysanthemum variety is Hongchang.
9. A set of culture media comprising the adventitious bud induction medium of any one of claims 1 to 8, the proliferation medium of any one of claims 1 to 8, the CHR-1 medium of any one of claims 1 to 8, the shoot tip differentiation medium of any one of claims 1 to 8, and the rooting medium of any one of claims 1 to 8.
10. Use of the complete set of media of claim 9 in any of the following a1) -a 4):
a1) detoxification of the chrysanthemum indicum;
a2) preparing a detoxified product of the chrysanthemum indicum;
a3) cultivating the detoxified seedlings of the chrysanthemum indicum;
a4) preparing the product for cultivating the detoxified seedlings of the chrysanthemum.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202010453756.7A CN111528092B (en) | 2020-05-26 | 2020-05-26 | Culture method of chrysanthemum virus-free seedlings |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202010453756.7A CN111528092B (en) | 2020-05-26 | 2020-05-26 | Culture method of chrysanthemum virus-free seedlings |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN111528092A true CN111528092A (en) | 2020-08-14 |
| CN111528092B CN111528092B (en) | 2021-12-14 |
Family
ID=71974072
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202010453756.7A Active CN111528092B (en) | 2020-05-26 | 2020-05-26 | Culture method of chrysanthemum virus-free seedlings |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN111528092B (en) |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN114303955A (en) * | 2022-01-07 | 2022-04-12 | 嘉兴市农业科学研究院桐乡农业科学研究所 | Breeding method of high-quality chrysanthemum morifolium ramat |
| CN116806696A (en) * | 2023-05-06 | 2023-09-29 | 南昌和博生态农业开发有限公司 | Method for breeding, planting and preparing chrysanthemum tea by using spiraea japonica |
Citations (11)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2004048447A2 (en) * | 2002-11-25 | 2004-06-10 | Agdia, Inc. | Controls and standards for assays and method for manufacture thereof |
| CN1926965A (en) * | 2006-09-26 | 2007-03-14 | 河北省农林科学院经济作物研究所 | Process for expelling chrysanthemum flower viroid by cryogenic processing |
| CN101451166A (en) * | 2008-12-19 | 2009-06-10 | 北京市农林科学院 | Method for detecting tomato aspermy virus |
| CN105165609A (en) * | 2015-09-10 | 2015-12-23 | 无锡南理工科技发展有限公司 | Method for efficiently acquiring gerbera jamesonii detoxification seedling |
| KR101783441B1 (en) * | 2015-08-04 | 2017-09-29 | 김낭주 | Oriental Medicinal method of manufacturing a boiled sauce for meat |
| CN109258460A (en) * | 2018-09-07 | 2019-01-25 | 广州田园牧歌农林有限公司 | Micro-stem tip culture combines the breeding method of heat treatment acquisition Zengcheng honey chrysanthemum detoxic seedling |
| CN110199819A (en) * | 2019-06-27 | 2019-09-06 | 浙江海丰花卉有限公司 | A kind of small chrysanthemum cultural method based on pinching technology |
| CN110651717A (en) * | 2019-11-20 | 2020-01-07 | 四川云辰园林科技有限公司 | Chrysanthemum seedling tissue culture detoxification and rapid propagation method |
| CN110679482A (en) * | 2019-07-15 | 2020-01-14 | 浙江省农业科学院 | Chrysanthemum multocida detoxification culture medium with high stem tip induction rate and tissue culture quality and method |
| CN110741930A (en) * | 2019-07-15 | 2020-02-04 | 浙江省农业科学院 | Stem tip detoxification tissue culture medium suitable for heat treatment of cut chrysanthemum and method |
| EP3388137B1 (en) * | 2016-08-08 | 2020-04-15 | Wang, Jingning | Air freshener composition and preparation method therefor |
-
2020
- 2020-05-26 CN CN202010453756.7A patent/CN111528092B/en active Active
Patent Citations (11)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2004048447A2 (en) * | 2002-11-25 | 2004-06-10 | Agdia, Inc. | Controls and standards for assays and method for manufacture thereof |
| CN1926965A (en) * | 2006-09-26 | 2007-03-14 | 河北省农林科学院经济作物研究所 | Process for expelling chrysanthemum flower viroid by cryogenic processing |
| CN101451166A (en) * | 2008-12-19 | 2009-06-10 | 北京市农林科学院 | Method for detecting tomato aspermy virus |
| KR101783441B1 (en) * | 2015-08-04 | 2017-09-29 | 김낭주 | Oriental Medicinal method of manufacturing a boiled sauce for meat |
| CN105165609A (en) * | 2015-09-10 | 2015-12-23 | 无锡南理工科技发展有限公司 | Method for efficiently acquiring gerbera jamesonii detoxification seedling |
| EP3388137B1 (en) * | 2016-08-08 | 2020-04-15 | Wang, Jingning | Air freshener composition and preparation method therefor |
| CN109258460A (en) * | 2018-09-07 | 2019-01-25 | 广州田园牧歌农林有限公司 | Micro-stem tip culture combines the breeding method of heat treatment acquisition Zengcheng honey chrysanthemum detoxic seedling |
| CN110199819A (en) * | 2019-06-27 | 2019-09-06 | 浙江海丰花卉有限公司 | A kind of small chrysanthemum cultural method based on pinching technology |
| CN110679482A (en) * | 2019-07-15 | 2020-01-14 | 浙江省农业科学院 | Chrysanthemum multocida detoxification culture medium with high stem tip induction rate and tissue culture quality and method |
| CN110741930A (en) * | 2019-07-15 | 2020-02-04 | 浙江省农业科学院 | Stem tip detoxification tissue culture medium suitable for heat treatment of cut chrysanthemum and method |
| CN110651717A (en) * | 2019-11-20 | 2020-01-07 | 四川云辰园林科技有限公司 | Chrysanthemum seedling tissue culture detoxification and rapid propagation method |
Non-Patent Citations (3)
| Title |
|---|
| ZHOU, YAN等: ""Stem apex detoxification culture markedly improved several"", 《PLANT CELL TISS ORGAN CULT》 * |
| 何旭君等: ""‘增城蜜菊’茎尖培养脱毒技术"", 《热带农业科学》 * |
| 赵霜: ""菊花病毒脱除与检测技术研究"", 《中国优秀硕士学位论文全文数据库（电子期刊）农业科技辑》 * |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN114303955A (en) * | 2022-01-07 | 2022-04-12 | 嘉兴市农业科学研究院桐乡农业科学研究所 | Breeding method of high-quality chrysanthemum morifolium ramat |
| CN116806696A (en) * | 2023-05-06 | 2023-09-29 | 南昌和博生态农业开发有限公司 | Method for breeding, planting and preparing chrysanthemum tea by using spiraea japonica |
Also Published As
| Publication number | Publication date |
|---|---|
| CN111528092B (en) | 2021-12-14 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN101611697B (en) | Virus removal and rapid propagation technology of sweet potato variety 'Shangshu 19' | |
| CN109258460B (en) | Cultivation method for obtaining virus-free seedlings of Zea mays by combining micro-stem tip cultivation with heat treatment | |
| CN106665357B (en) | A method of establishing short-tube lycoris regenerating system | |
| CN104813939A (en) | Method for constructing lotus regeneration system | |
| CN111528092B (en) | Culture method of chrysanthemum virus-free seedlings | |
| CN109329026B (en) | Method for obtaining sweet potato virus-free seedlings through high-temperature and variable-temperature treatment | |
| CN101803571B (en) | Tissue culture rapid propagation method of Rhizoma Typhonii Flagelliformis | |
| CN106538382B (en) | Method for establishing efficient eremochloa ophiuroides regeneration system by taking young ears as explants | |
| CN113317204B (en) | Method for inducing adventitious buds of seedlings of sedum aizoon and efficiently regenerating plants | |
| CN102487829A (en) | Method of comprehensive detoxification and rapid propagation for starch-type water chestnut | |
| CN112042537A (en) | Method for establishing bletilla striata plant regeneration system | |
| CN111434218A (en) | Tissue culture rapid propagation method for rejuvenation of polygonatum sibiricum varieties | |
| CN112470926B (en) | Rapid propagation method for mesona chinensis benth stem tip detoxified seedlings | |
| CN113016610B (en) | Quinoa hypocotyl in-vitro regeneration method | |
| CN105746344A (en) | Virus-free tissue culture and rapid propagation method of castor oil plants | |
| KR101106953B1 (en) | Proliferation method of Pinus densiflora using somatic embryogenesis | |
| CN101496527B (en) | Method for preventing and treating virus disease of petunia with mild virus | |
| CN110839532A (en) | Asexual propagation method of umbrellas roses | |
| CN111528091B (en) | Method for detoxification and rapid propagation of stem tips of dracaena sanderiana | |
| CN104429963B (en) | A kind of Chinese small iris dissociates pollen cultures method | |
| CN109169288B (en) | Method for inducing regeneration plants from first internodes of water spinach stems | |
| CN108575743B (en) | Tissue culture rapid propagation method for inducing regeneration of mussaenda pubescens embryo | |
| CN108371102B (en) | Tissue culture technology for regenerated plant of figwort stem tip tissue culture seedling leaves and special culture medium combination | |
| CN109832193B (en) | Culture method for inducing and regenerating mature embryo callus of roegneria kamoji | |
| CN117136847A (en) | Tissue culture propagation and cultivation method for lotus |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| CB02 | Change of applicant information | ||
| CB02 | Change of applicant information |
Address after: 312051 Ping Shui Zhen Jian Zao Cun, Keqiao District, Shaoxing City, Zhejiang Province Applicant after: Zhejiang Haifeng Biotechnology Co., Ltd Address before: 312050 Ping Shui Zhen Jian Zao Cun, Keqiao District, Shaoxing City, Zhejiang Province Applicant before: Zhejiang Haifeng flower Co., Ltd |
|
| GR01 | Patent grant | ||
| GR01 | Patent grant |