CN111518804B - Circular RNA circRalgapa1 and application thereof - Google Patents

Abstract

The invention discloses a circular RNA circRalgapa1 and application thereof. The circular RNA circRalgapa1 is a brand-new circular non-coding RNA reported for the first time and is proved to be related to morphine tolerance. The medicine can slow down the formation of morphine tolerance, and provide a new way for treating chronic pain and morphine tolerance.

Description

Circular RNA circRalgapa1 and application thereof

Technical Field

The invention belongs to the technical field of biological medicines. The invention relates to endogenous non-coding circular RNA and new drug application thereof, in particular to circRalgapa1 and application thereof in preparing drugs for relieving or treating chronic pain and morphine tolerance.

Background

Pain is a protective mechanism of our body, but it brings certain trouble, especially chronic pain, while protecting our body. Morphine is commonly used for treating acute pain and cancer pain, and is still one of the analgesic drugs widely used clinically at present. However, it has many side effects besides analgesia, of which headache is its tolerance. And also due to the development of tolerance, severely hampers the efficacy of morphine in the treatment of chronic pain. Morphine tolerance refers to the phenomenon in which repeated exposure to morphine results in a reduction in the therapeutic effect of the drug or requires higher doses to maintain the same effect, which appears as a shift to the right in the dose-response curve. The mechanism of morphine tolerance development is still unclear, and most of the related studies are at the molecular level, and recent evidence that epigenetic mechanism-mediated gene expression regulation dysfunction plays a key role in the development and maintenance of chronic pain caused by various reasons is shown, so that our study on morphine tolerance is gradually shifted to the epigenetic direction.

circRNAs (circular RNAs) are a non-coding RNA that has recently emerged, which can be produced by exons or introns, and which, unlike other RNAs, have an independent mode of formation, and the potential functions of circRNAs in regulating gene expression are becoming well known. Genome-wide studies have shown that circRNAs are diverse, abundant, and often evolutionarily conserved. At the same time, circRNAs are highly homologous and are generally more stable than linear RNAs because they lack a poly a tail and are therefore resistant to exonucleases (Rnase R). With advances in biotechnology, especially the development of bioinformatics and high throughput sequencing technologies, researchers have discovered and identified a large number of circRNAs. With their knowledge, we have a wider understanding of their function, but for the subject of morphine tolerance, no more detailed study of the mechanisms by which circRNAs modulate morphine tolerance has emerged.

Disclosure of Invention

The primary object of the present invention is to provide a novel endogenous circular RNA circRalgapa1 (chr 6: 76491315-76492176), the cDNA sequence of which is shown in SEQ ID NO. 1. The circular RNA circRalgapa1 is a brand-new circular non-coding RNA reported for the first time and proved to be related to morphine tolerance, and the circular RNA is derived from mice.

The second purpose of the invention is to provide the application of the circRalgapa1 in preparing the medicine for treating or relieving chronic pain. The drug slowed the development of morphine tolerance.

Further, the drug for treating or relieving chronic pain is a drug for inhibiting morphine tolerance.

Further, the medicament for inhibiting morphine tolerance is a preparation for over-expressing circRalgapa1.

Further, the preparation for over-expressing circRalgapa1 is a circRalgapa1 over-expression lentiviral vector.

Further, the construction method of the circRalgapa1 overexpression lentiviral vector is as follows:

(1) After PCR amplification of a circRalgapa1 sequence is carried out by using a full-length primer, a target fragment and a blank vector are subjected to double enzyme digestion and then are connected to form a recombinant plasmid, and the recombinant plasmid is transferred into a competent cell DH5 alpha; the transformed cells are smeared on a bacterial culture plate containing ampicillin and cultured overnight; after picking the bacteria on the flat plate, shaking the bacteria; after PCR identification is carried out on the bacterial liquid, sanger sequencing is carried out on the positive clone bacterial liquid; extracting the plasmid with a large-scale endotoxin-free plasmid extraction kit from the recombinant plasmid with a correct sequencing result;

(2) Preparing 293T cells before transfection, and adding plasmids containing lentiviruses and various auxiliary plasmids for transfection; centrifuging after transfection to remove cell debris, collecting virus supernatant, filtering, and ultracentrifuging to obtain lentivirus ultracentrifugation liquid.

Further, the primers for amplifying the full-length linear sequence of the circRalgapa1 are F1:5 'TGAAACTCAGATGCAACAAGGATT 3' as shown in SEQ ID NO.2;

r1:5'CGTTTGTCCCAGGAATTCATTCC 3' see SEQ ID NO.3.

Further, the endonucleases used in the double enzyme digestion in the step (1) are EcoRI and BamHI; the blank vector is pLCDH-ciR; the various helper plasmids in the step (2) are pLP1, pLP2 and pLP/VSVG. (pLCDH-ciR from Gisela organisms, pLP1, pLP2, pLP/VSVG from Invitrogen)

Further, 24 hours before transfection in step (2), 293T cells at logarithmic growth phase were trypsinized, passaged, seeded into a six-well plate, and placed at 37 ℃ with 5% CO ₂ The incubator of (1), when the cell density reaches 70-80%, the cell culture medium is used for transfection 24 hours, before transfection, the cell culture medium is replaced by serum-free culture medium, each plasmid DNA solution is added into a sterile centrifuge tube, each plasmid DNA solution contains 10 mug of the lentiviral plasmid obtained in the step (1) and 5 mug of each of various helper plasmids pLP1, pLP2 and pLP/VSVG, the lentiviral plasmid DNA solution and the corresponding volume of Opti-MEM are uniformly mixed, the total volume is adjusted to be 1.5ml, lipofectamine 2000 and 1.5ml Opti-MEM are mixed, the reaction is carried out at room temperature for 5min, the diluted plasmid DNA and the diluted Lipofectamine 2000 are uniformly mixed, and the mixture is moved to 293T cells by a pipette gun; and 6h after transfection, replacing the medium with a complete medium, culturing for 48h, collecting cell supernatant rich in lentiviral particles, centrifuging for 10min at 4 ℃ at 2000Xg to remove cell debris, collecting virus supernatant, filtering by using a filter membrane, centrifuging for 120min at 4 ℃ at 82700Xg, and carrying out supercentrifugation to obtain the lentiviral superionic liquid.

Further, the lentivirus-mediated circRalgapa1 overexpression vector amplification and identification primers are circRalgapa1 trans-cyclization site primers F2 and R2, and the sequences are as follows:

f2:5'TCTTGACGAGCTCCTGCAGT 3' in SEQ ID NO.4;

r2:5'TGGCCCAAGTGATTCACCAGA 3', see SEQ ID No.5.

The research content of the invention is as follows:

the cyclic characteristics of the circRalgapa1 are examined and verified in the temporal-spatial expression change of the circRalgapa1 in the dorsal horn of the spinal cord of a mouse.

The circRNAs expression profiling chip is adopted to detect the circRNAs differentially expressed in the lumbar region L4-L6 spinal cord dorsal horn of the morphine-tolerant group (MT group) of the 1d after the morphine tolerance is formed (continuous subcutaneous injection of morphine 7 d) and the control group (NS group is continuous subcutaneous injection of physiological saline 7 d), and the change of the expression quantity of the circRalgapa1 is verified by qPCR, and the result is shown in a figure 3 and a figure 4.

Amplifying the mouse spinal cord lumbar segment L4-L6 tissue samples, wherein the primers are as follows:

F2：5'TCTTGACGAGCTCCTGCAGT 3'；

R2：5’TGGCCCAAGTGATTCACCAGA 3’；

the amplification product of the circularization site of circRalgapa1 was obtained and sequenced by the sanger dideoxy chain terminator method to confirm that the circularization site of circRalgapa1 was formed by the first reverse splicing, and the results are shown in fig. 6.

And the expression, subcellular level localization and neuron co-expression of the circRalgapa1 in the dorsal horn of the spinal cord of the mouse are discussed.

The detection of the localization of circRalgapa1 at the subcellular level of the dorsal horn of the spinal cord of mice was accomplished by Fluorescence In Situ Hybridization (FISH), and the change in the expression level of circRalgapa1 in the morphine-resistant group (MT group) and the physiological saline group (NS group). FISH fluorescence in situ hybridization can confirm the subcellular level positioning of the circRalgapa1, and confirms that the circRalgapa1 is mainly expressed in cytoplasm, and an immunofluorescence multiple labeling method is adopted to detect the cell type distribution of the circRalgapa1 in the dorsal horn of the spinal cord of the mouse. It was confirmed that circRalgapa1 was expressed in neuronal cells in the dorsal horn of mouse spinal cord, and it was further confirmed that circRalgapa1 was downregulated in expression after the morphine-resistant model was established, and the results are shown in fig. 7,8,9.

Study on the role of circRalgapa1 in the development of morphine tolerance

The expression change of circRalgapa1 was detected and divided into 4 groups: NS group, day3 group, day5 group, day7 group. Materials were taken immediately after the completion of administration, and the dynamic change in the expression amount of circRalgapa1 during the establishment of morphine tolerance was identified by qPCR, and the results are shown in fig. 5.

To investigate whether upregulation of circRalgapa1 alleviated morphine tolerance, circRalgapa1 over-expressed lentivirus was injected intrathecally prior to morphine tolerance modeling (figure 1). The expression of circRalgapa1 in spinal cord was up-regulated and observed for the percentage of maximal analgesic potency of morphine tolerance and the amount of circRalgapa1 expression at different time points before and after morphine injection, as shown in fig. 10,11.

The invention proves that the circRNAs are involved in the formation of chronic morphine tolerance through experiments.

The present invention demonstrates that circRalgapa1 is a novel circular RNA involved in pain, development and maintenance of chronic morphine tolerance. Therefore, an overexpression lentivirus of circRalgapa1 is developed and used for preparing a medicament for treating chronic pain and morphine tolerance. Provides a new target point for treating chronic pain and morphine tolerance.

Drawings

FIG. 1 is a flow chart of the administration of circRalgapa1 overexpression lentivirus intervention.

FIG. 2 shows the maximal percent analgesic efficacy (MPE%) obtained in tail flick experiments in morphine-resistant (MT group) and saline-controlled (NS group) mice; the differences are statistically significant when compared to NS group ( ^* P<0.05 Represents morphine tolerance modeling efforts.

FIG. 3 shows the results of a circRNA chip on spinal cord tissue of a chronic morphine-resistant mouse, panel a is a cluster plot of circRNA, each column representing a tissue sample, each row representing a circRNA, red for high expression, and green for low expression; panel b is a circRNA cassette diagram: comparing the distribution of circRNAs expression values (log 2 ratios) of each sample after normalization (MT: morphine-resistant group; NS: saline group); panel c is a circRNA scattergram: evaluating the change in circRNA expression between morphine-tolerant and saline group samples, the values on the X and Y axes in the scatter plot represent the mean values after normalization (ratio log 2) in each group of samples; the upper and lower light green oblique lines represent lines with the difference multiple of 2 times, and the value difference multiple outside the two lines is more than or equal to 2 times; d is circRNA volcano: circRNAs with differential expression are shown. The vertical line corresponds to 2.0 times the top and bottom, and the horizontal line represents a P value of 0.05; the red dots in the figure represent statistically significant differentially expressed circRNAs (FC. Gtoreq.2 and P. Gtoreq.0.05).

FIG. 4 shows the results of RT-qPCR validation of circRalgapa1 spinal cord dorsal horn differential expression of circRNA in morphine-resistant group (MT group) and normal saline control group (NS group); the differences are statistically significant when compared to NS groups ( ^* P<0.05)。

FIG. 5RT-qPCR validation results for spinal cord dorsal horn differential expression for the morphine-administered group on the third day (group D3), the morphine-administered group on the fifth day (group D5), the morphine-administered group on the seventh day (group D7) and the saline control group (group NS); the differences between the D5 group and the NS group are statistically significant ( ^* P<0.05 D7 groups compared with NS group, the difference is statistically significant: ( ^** P<0.01)

FIG. 6 shows the result of PCR amplification of the circRalgapa1 cycle site and sequencing by the sanger dideoxy chain terminator method, which indicates that circRalgapa1 is formed by reverse splicing.

Figure 7 is a subcellular localization of circRalgapa 1: the DAPI stain indicates the location of the nucleus, while circRalgapa1 stains red, mainly distributed around the nucleus, i.e. circRalgapa1 is mainly expressed in the cytoplasm.

Fig. 8 is a graph showing FISH results that circRalgapa1 expression was significantly lower in the morphine-resistant group than in the saline group: it can be seen that the expression level of circRalgapa1 represented by red color in the morphine-resistant group was lower than that in the saline group.

FIG. 9 shows FISH + immunofluorescence double-labeling results showing that circRalgapa1 is expressed in neuronal cells: circRalgapa1 is red and the neuronal cell marker NeuN is stained green, and it can be seen that in spatial localization, circRalgapa1 and neurons are in the same spatial position, i.e. circRalgapa1 is expressed in neuronal cells.

FIG. 10 shows the maximal percentage of analgesic potency (MPE%) obtained in tail flick experiments for Morphine + blank vector group (Morphine + LV-control group), morphine + circRalgapa1 overexpression lentivirus group (Morphine + LV-circRalgapa1 group) and saline control group (NS group); the difference between Morphine + LV-CirCralgapa1 and Morphine + LV-control in the overexpression of lentivirus at D3, D5 and D7 points is statistically significant (comparison between Morphine + LV-CirCralgapa1 and Morphine + LV-control group: ( ^* P<0.05； ^*** P<0.001 Representing that circRalgapa1 overexpresses lentiviruses to inhibit morphine tolerance in mice.

FIG. 11 shows Morphine + blank vector group (Morphine + LV-control group), morphine + circRalgapa1 overexpression lentivirus group (Morphine + LV-circRalgapa1 group), and physiological saline control group (N.sub.Group S) expression level of mouse spinal cord tissue circRalgapa 1; the difference in the expression level of circRalgapa1 was statistically significant in the case of the Morphine + LV-control group versus the NS group: ( ^* P<0.05 And the difference in expression level of circRalgapa1 is statistically significant in the case of the Morphine + LV-circRalgapa1 group as compared with the Morphine + LV-control group(s) (( ^### P<0.001)。

Detailed Description

The following examples are intended to further illustrate the invention without limiting it.

Example (b):

establishment of mouse morphine tolerance model

Adult male clear grade ICR mice were subcutaneously modeled as a model of chronic morphine-tolerant Model (MT) (mice were subcutaneously injected 2 times with morphine, 10mg/kg once, 7 consecutive days at the same time point per day at 8AM,4 PM) and controls were subcutaneously injected with an equivalent amount of saline at the same time point. The thermal pain threshold values of morphine tolerance (MT group) and saline control group (NS group) were measured as experimental data for calculating the percentage of maximal analgesic efficacy using a thermal pain machine at 1d, 3d, 5d, and 7d, respectively, of subcutaneously injected morphine.

Grouping and intrathecal administration of laboratory animals

30 ICR mice were selected and randomized into 3 groups of 10 mice each (n = 10): saline group (NS group), control Morphine-added group (Morphine + LV-control group) and circRalgapa1 lentivirus-added Morphine group (Morphine + LV-circRalgapa1 group). Groups of mice were: NS group mice were injected intrathecally with 10. Mu.l of physiological saline, morphine + LV-control group intrathecally with 10. Mu.l of control lentivirus (titer: 3X 10) ⁸ TU), morphine + LV-circRalgapa1 group was injected intrathecally with 10 μ l of circRalgapa1 overexpressing lentivirus (titer: 3 x 10 ⁸ TU). On day3 after intrathecal administration, groups of mice were administered subcutaneous continuous morphine (see figure 1): the Morphine + LV-circRalgapa1 group and Morphine + LV-control mice were injected continuously subcutaneously with 10mg/kg 2 times per day (8 morning, 00 evening, 18 evening) for seven days; NS mice were injected subcutaneously with an equal amount of saline in the same manner.

Behavioral experiments

Tail-flick test (tail-flick test): the temperature of the water bath is adjusted to be that the tail of the mouse is put in water for 3-4s, the tail flicking phenomenon can occur, and the cut-off time is set to be 10s, so that the tissue damage of the mouse is avoided. The mouse tail was placed in the water bath and a stopwatch was used to start the timing and start the measurement. The tail flick was performed when the mice felt pain, at which time the tail flick time was recorded using a stopwatch. The measurement was performed every 10min for 3 times, and the average value was taken. Tail flick experiments were performed once each on day 1,3,5,7 of subcutaneous administration before and 30min after administration. The tail flick time before morphine administration is taken as a basic time, the tail flick time after morphine administration is taken as an effect time, and the analgesic effect of morphine is represented by a percent of maximum analgesic effect (% MPE), which is calculated as [% MPE = (effect time-basic time)/(cut-off time-basic time) × 100].

FISH

The fluorescent in situ hybridization probe labeled by red fluorescent Cy3 (FISH probe is composed of four strips, 5'-biotin-GUUGCA-biotin-3' is shown in SEQ ID NO.6, 5'-biotin-UCUGAGUU-biotin-3' is shown in SEQ ID NO.7, 5'-biotin-UUCACGUUUG-biotin-3' is shown in SEQ ID NO.8, and 5'-biotin-UCCCAGGAAUUCA-biotin-3' is shown in SEQ ID NO. 9), and the steps of the following experimental method are washed by proper buffer solution. Anesthesia of mice by intraperitoneal injection of 10% sodium pentobarbital, intubation of left ventricle of chest, perfusion of PBS and 4% paraformaldehyde, rapid material selection → 4% paraformaldehyde pre-fixation, overnight at 4 ℃ → sucrose fundation, 4 ℃, O/N → low temperature (-20 ℃) embedding → frozen section → room temperature airing → exposure of mRNA nucleic acid fragments: pepsin freshly diluted with 3% citric acid at 37 ℃ for 20min → post-fixed 4% paraformaldehyde for 10min → 30% ₂ O ₂ 1 part + 50 parts of pure methanol, treatment at room temperature for 30 minutes → prehybridization, treatment at 37 ℃ for 6h → denatured probe, 75 ℃ for 5min → hybridization, overnight at 37 ℃ → stringent washing → incubation of the sections with blocking solution in a wet box, room temperature for 1h → co-incubation of the sections with a diluted (1Light, cell-specific staining is green fluorescence.

Immunofluorescence

The mice are perfused and fixed by ascending aorta after the last administration of (morphine) (after the last administration, the metabolism time of the medicament in vivo is limited, so the mice are perfused immediately after the administration to ensure that the medicament effect is not metabolized), spinal cord waist is expanded, 4 percent paraformaldehyde is fixed, sucrose is dehydrated in a gradient way, and the thickness of the slice is 10 mu m. And (3) dyeing: washing the section with Phosphate Buffer Solution (PBS), 5min × 2 times, blocking 10% donkey serum for 1h at room temperature, adding primary antibody: rabbit anti- β -arrestin 2 (1.

Western blot

After the last administration, the mice were killed by decapitation, and the lumbar spinal cord of the fresh mice was enlarged on ice. The protein concentration was determined by extracting whole protein using RIPA and BCA method. And (3) sampling 50 mu g of protein sample, performing 10% gel electrophoresis (SDS-PAGE), performing 80-120V electrophoresis for 90min, performing wet membrane transfer on a PVDF membrane, and performing 250mA membrane transfer for 50min. Blocking with 5% milk for 1h, adding a primary anti-rabbit anti- β -arrestin 2 (1. The Quantity One software was used for analysis.

Real-time PCR

Primers were designed by the Prime Primier 510 software as follows: the circRalgapa1 primer sequence is F2:5'TCTTGACGAGCTCCTGCAGT 3';

R2：5’TGGCCCAAGTGATTCACCAGA3’。

each group of mice was sacrificed by decapitation after the last administration, and the lumbar spinal cord was freshly taken to enlarge. Tissue RNA is extracted by a Trizol method, and the conditions for synthesizing cDNA by RNA reverse transcription are as follows: 25 ℃ for 10min,42 ℃ for 60min,85 ℃ for 5min. Then, amplification reaction was carried out, and the reaction was cycled 35 times at 94 ℃ for 4min, 94 ℃ for 20s, 60 ℃ for 30s, and 72 ℃ for 30 s. The analysis was carried out by the delta-delta Ct method and the relative expression was calculated.

construction of circRalgapa1 overexpression lentivirus:

with full-length primers F1, R1

F1：5'TGAAAACTCAGATGCAACAAGGATT 3’；

R1：5'CGTTTGTCCCAGGAATTCATTCC 3’。

After PCR amplification of the full-length circRalgapa1 sequence, the target fragment and the vector plasmid (pLCDH-ciR) EcoRI/BamHI are subjected to double enzyme digestion and then are connected to form a recombinant plasmid, and the recombinant plasmid is transferred into a competent cell DH5 alpha. The transformed cells were plated on ampicillin-containing bacterial plates and cultured overnight at 37 ℃. After the transformed circRalgapa1 plate is selected, the bacteria are shaken at 37 ℃ at 250r/min for 14h. After PCR identification is carried out on the bacterial liquid, sanger sequencing is carried out on the positive clone bacterial liquid. The recombinant plasmid with correct sequencing result is extracted with endotoxin-free plasmid great extracting kit and stored at-20 deg.c for further use.

24h before transfection, 293T cells at logarithmic growth phase were trypsinized, passaged, seeded into six-well plates, and placed at 37 ℃ 5% ₂ The cell culture medium was replaced with a serum-free medium before transfection, each plasmid DNA solution (containing 10. Mu.g of lentiviral plasmid and 5. Mu.g of each of the helper plasmids pLP1, pLP2, pLP/VSVG) was added to a sterile centrifuge tube and mixed uniformly with the corresponding volume of Opti-MEM, the total volume was adjusted to 1.5ml, lipofectamine 2000 was mixed with 1.5ml of Opti-MEM, the mixture was reacted at room temperature for 5min, the diluted plasmid DNA was mixed uniformly with the diluted Lipofectamine 2000, and the mixture was transferred to 293T cells with a pipette. And 6h after transfection, replacing the medium with a complete medium, culturing for 48h, collecting cell supernatant rich in lentiviral particles, centrifuging for 10min at 4 ℃ at 2000Xg to remove cell debris, collecting virus supernatant, filtering by using a filter membrane, centrifuging for 120min at 4 ℃ at 82700Xg, and superionizing the virus supernatant to obtain the high-titer lentiviral superionic liquid.

The lentivirus-mediated circRalgapa1 overexpression vector amplification and identification primers are circRalgapa1 trans-cyclization site primers F2 and R2, and the sequences are as follows:

F2：5'TCTTGACGAGCTCCTGCAGT 3'；

R2：5’TGGCCCAAGTGATTCACCAGA 3’。

by the above identified primer amplification, the sequencing confirmed the acquisition of circRalgapa1.

Statistical analysis

The statistics are analyzed by SPSS19.0 statistical software, and the experimental data are averaged to be +/-standard deviation

And (4) showing. Behavioral experiments were compared using a repeated measures two-way ANOVA, two sets of data were compared using two independent sample t-tests, multiple sets of experimental data were analyzed using one-way ANOVA, P<0.05 indicates that the difference is statistically significant.

Results of the experiment

1. Establishment of morphine tolerance model

Morphine or saline was subcutaneously administered to ICR mice twice a day at 10mg/kg for seven consecutive days and measured in tail flick experiments at 1d, 3d, 5d and 7d, respectively, to calculate the maximum percent analgesic efficacy (see figure 2). This model is a classical morphine tolerance model, which is administered in most literature for 7 consecutive days, with a tolerance success marked by a decrease in the percentage of maximal analgesic potency and a statistically significant difference from the normal saline group: ( ^*** P<0.001)。

2. Differentially expressed circRNAs in morphine-resistant models

After the morphine tolerance model is successfully established, mouse spinal cord L4-L6 tissues are taken for chip analysis, and circRNAs which are expressed in a difference way are shown in figure 3.

Changes in mouse spinal cord dorsal horn expression of circralgapa1

Selection of circRalgapa1 in circRNAs differentially expressed in spinal cord dorsal horn and RT-qPCR validation showed that circRalgapa1 expression was significantly down-regulated in MT group compared to NS group (saline group) ((s)) ^* P<0.05 See fig. 4). Furthermore, the dynamic changes in the expression level of circRalgapa1 during morphine tolerance were also confirmed by RT-qPCR experiments, comparing the NS group with circRalgapa1(statistically significant) at the onset of downregulation of D3 expression upon morphine administration ^* P<0.05 Significant downregulation on day D7, with statistical significance of the differences ( ^** P<0.01 See fig. 5).

4.Sanger dideoxy chain termination sequencing

Amplifying the mouse spinal cord lumbar segment L4-L6 tissue sample to obtain an amplification product of the circRalgapa1 cyclization site, and sequencing by a sanger dideoxy chain termination method to verify that the cyclization site of the circRalgapa1 is formed by first-position reverse splicing, and the figure is 6.

Subcellular localization of circralgapa1

Subcellular localization of circRalgapa1 was confirmed by FISH fluorescence in situ hybridization to confirm that circRalgapa1 is predominantly expressed in the cytoplasm, see fig. 7. Further, it was confirmed that circRalgapa1 was down-regulated in expression after morphine-resistant model establishment as compared to the NS group (saline group), as shown in fig. 8. Meanwhile, the FISH + immunofluorescence double-labeling result confirms that the circRalgapa1 and the neuron marker NeuN have spatial position overlapping, namely the circRalgapa1 is expressed in neuron cells of the dorsal horn of the spinal cord of the mouse, and the result is shown in figure 9.

Involvement of circralgapa1 in morphine tolerance

The expression of circRalgapa1 in the spinal cord of mice is up-regulated by circRalgapa1 overexpression lentivirus, the change of maximum analgesic efficiency percentage (MPE%) of Morphine-resistant mice at different time points before and after Morphine injection is observed, and the result shows that the difference of circRalgapa1 overexpression lentivirus at the time points of D3, D5 and D7 has statistical significance (the difference of the maximum analgesic efficiency percentage (MPE%) of the Morphine-resistant mice in the Morphine + LV-circRalgapa1 group is compared with the Morphine + LV-control group) ^* P<0.05； ^*** P<0.001 Representing circRalgapa1 overexpressing lentivirus relieves morphine tolerance in mice, see figure 10.

After each group of mice experiment, taking spinal cord lumbar enlargement tissue to perform RT-qPCR to verify the change of circRalgapa1 expression quantity, comparing the Morphine + LV-control group with the NS group, the difference of circRalgapa1 expression quantity has statistical significance (( ^* P<0.05 In comparison of the Morphine + LV-CirCralgapa1 group with the Morphine + LV-control group, the difference in the expression level of CirCralgapa1 is statistically significant ( ^### P<0.001 See fig. 11).

Sequence listing

<110> Hunan ya Hospital of Zhongnan university

<120> circular RNA circRalgapa1 and application thereof

<160> 9

<170> SIPOSequenceListing 1.0

<210> 1

<211> 862

<212> DNA

<213> musculus 8194and mouse (Mus)

<400> 1

tgaaaactca gatgcaacaa ggattaatct ctatagcagc ccgtactgtt attacccatc 60

tggtgaatca cttgggccat tatccaatga gtggtggtcc tgctatgcta acaagtcagg 120

tgtgtgaaaa tcatgacaat cattacagtg aaagtactga actttctcct gagctctttg 180

aaagtccaaa catccagttc tttgtgctga ataatacaac cttagtgtcc tgtatccaga 240

taagatcgga agagagtatg cctggaggag gtctagctgc tggccttgtg tcagccaact 300

caaatgttag aatcatagta cgtgatctct ctggaaagta ctcatgggat tctgccatac 360

tgtatggacc acccattgta agtggtttgc ctgaacctac atctttcata ctttcaatgt 420

ctgaccaaga gaaaccggaa gagcctccta catctaacga atgcttagaa gacatcgcag 480

taaaagatgg gctttctctc cagcttagaa gatttagaga aactgtacca acttggtcta 540

cgatacgaga ggaagaagat gttcttgacg agctcctgca gtatttaggc actacaagtc 600

ctgagtgttt acagagaacg ggaatctccc tcaatgttcc tgctccacag cctctgtgca 660

tttctgaaaa acaggagaat gatgtcatta atgctatcct taagcaatac acggaagaaa 720

aagagtttgt agagaagcac tttaatgact taaacatgaa agcctcagaa caagatgagc 780

caacacctca gaaacctcag tcagcttttt attactgcag attgcttctt agtatattgg 840

gaatgaattc ctgggacaaa cg 862

<210> 2

<211> 25

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 2

tgaaaactca gatgcaacaa ggatt 25

<210> 3

<211> 23

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 3

cgtttgtccc aggaattcat tcc 23

<210> 4

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 4

tcttgacgag ctcctgcagt 20

<210> 5

<211> 21

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 5

tggcccaagt gattcaccag a 21

<210> 6

<211> 6

<212> RNA

<213> Artificial Sequence (Artificial Sequence)

<400> 6

guugca 6

<210> 7

<211> 8

<212> RNA

<213> Artificial Sequence (Artificial Sequence)

<400> 7

ucugaguu 8

<210> 8

<211> 10

<212> RNA

<213> Artificial Sequence (Artificial Sequence)

<400> 8

uucacguuug 10

<210> 9

<211> 13

<212> RNA

<213> Artificial Sequence (Artificial Sequence)

<400> 9

ucccaggaau uca 13

Claims (8)

1. Use of circralgapa1 in the manufacture of a medicament for the treatment or alleviation of chronic pain;

   the medicine for treating or relieving chronic pain is a medicine for inhibiting morphine tolerance, and the cDNA sequence of the circRalgapa1 is shown in SEQ ID NO. 1.
2. 2. The use according to claim 1, wherein the medicament for inhibiting morphine tolerance is a preparation overexpressing circRalgapa1.
3. 3. The use according to claim 2, wherein the agent overexpressing circRalgapa1 is a circRalgapa1 overexpressing lentiviral vector.
4. 4. The use according to claim 3, wherein the lentivirus-mediated circRalgapa1 overexpression vector is constructed as follows:

   (1) After PCR amplification is carried out on a circRalgapa1 sequence by using a full-length primer, a target segment and a blank vector are subjected to double enzyme digestion and then are connected to form a recombinant plasmid, and the recombinant plasmid is transferred into a competent cell DH5 alpha; the transformed cells are smeared on a bacterial culture plate containing ampicillin and cultured overnight; after picking the bacteria on the flat plate, shaking the bacteria; after PCR identification is carried out on the bacterial liquid, sanger sequencing is carried out on the positive clone bacterial liquid; extracting the plasmid with endotoxin-free plasmid extracting kit;

   (2) Preparing 293T cells before transfection, and adding plasmids containing lentiviruses and various auxiliary plasmids for transfection; centrifuging to remove cell debris after transfection, collecting virus supernatant, filtering, and ultracentrifuging to obtain lentivirus ultracentrifugation liquid.
5. 5. The use according to claim 4,

   the primer for amplifying the full-length linear sequence of the circRalgapa1 is

   F1：5'TGAAAACTCAGATGCAACAAGGATT3'；

   R1：5'CGTTTGTCCCAGGAATTCATTCC3'。
6. 6. The use of claim 4, wherein the endonuclease used for the double-enzyme digestion in step (1) is EcoRI and BamHI; the blank vector is pLCDH-ciR; the helper plasmids in the step (2) are pLP1, pLP2 and pLP/VSVG.
7. 7. The use of claim 4, wherein 293T cells at logarithmic growth phase are trypsinized 24h prior to transfection in step (2), passaged, seeded into six-well plates, and placed at 37 ℃ 5% ₂ The culture box is used for transfection 24 hours when the cell density reaches 70-80%, the cell culture medium is replaced by a serum-free culture medium before transfection, each plasmid DNA solution is added into a sterile centrifuge tube, 10 mu g of the lentivirus plasmid obtained in the step (1) and 5 mu g of each of various helper plasmids pLP1, pLP2 and pLP/VSVG are uniformly mixed with corresponding volumes of Opti-MEM, the total volume is adjusted to be 1.5ml, lipofectamine 2000 is mixed with 1.5ml of Opti-MEM, the mixture is reacted for 5min at room temperature, the diluted plasmid DNA and the diluted Lipofectamine 2000 are uniformly mixed, and the mixture is moved to 293T cells by a pipette gun; and 6h after transfection, replacing the medium with a complete medium, culturing for 48h, collecting cell supernatant rich in lentiviral particles, centrifuging for 10min at 4 ℃ at 2000Xg to remove cell debris, collecting virus supernatant, filtering by using a filter membrane, centrifuging for 120min at 4 ℃ at 82700Xg, and superionizing to obtain lentiviral superionic liquid.
8. 8. The use according to claim 4,

   the lentivirus-mediated circRalgapa1 overexpression vector amplification and identification primers are a pair of circRalgapa1 trans-cyclization site primers F2 and R2, and the sequences are

   F2：5'TCTTGACGAGCTCCTGCAGT3'；

   R2：5'TGGCCCAAGTGATTCACCAGA3'。

Images