CN111518792A - Beta-glucosidase mutant TLE of penicillium oxalicum 16 and application thereof - Google Patents

Beta-glucosidase mutant TLE of penicillium oxalicum 16 and application thereof Download PDF

Info

Publication number
CN111518792A
CN111518792A CN202010456548.2A CN202010456548A CN111518792A CN 111518792 A CN111518792 A CN 111518792A CN 202010456548 A CN202010456548 A CN 202010456548A CN 111518792 A CN111518792 A CN 111518792A
Authority
CN
China
Prior art keywords
gly
ala
leu
val
asn
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Granted
Application number
CN202010456548.2A
Other languages
Chinese (zh)
Other versions
CN111518792B (en
Inventor
赵喜华
王可心
黄秋霞
李汉昕
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Jiangxi Normal University
Original Assignee
Jiangxi Normal University
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Jiangxi Normal University filed Critical Jiangxi Normal University
Priority to CN202010456548.2A priority Critical patent/CN111518792B/en
Publication of CN111518792A publication Critical patent/CN111518792A/en
Application granted granted Critical
Publication of CN111518792B publication Critical patent/CN111518792B/en
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/14—Hydrolases (3)
    • C12N9/24—Hydrolases (3) acting on glycosyl compounds (3.2)
    • C12N9/2402—Hydrolases (3) acting on glycosyl compounds (3.2) hydrolysing O- and S- glycosyl compounds (3.2.1)
    • C12N9/2405—Glucanases
    • C12N9/2434—Glucanases acting on beta-1,4-glucosidic bonds
    • C12N9/2445—Beta-glucosidase (3.2.1.21)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/80—Vectors or expression systems specially adapted for eukaryotic hosts for fungi
    • C12N15/81—Vectors or expression systems specially adapted for eukaryotic hosts for fungi for yeasts
    • C12N15/815—Vectors or expression systems specially adapted for eukaryotic hosts for fungi for yeasts for yeasts other than Saccharomyces
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P19/00—Preparation of compounds containing saccharide radicals
    • C12P19/14—Preparation of compounds containing saccharide radicals produced by the action of a carbohydrase (EC 3.2.x), e.g. by alpha-amylase, e.g. by cellulase, hemicellulase
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P7/00—Preparation of oxygen-containing organic compounds
    • C12P7/02—Preparation of oxygen-containing organic compounds containing a hydroxy group
    • C12P7/04—Preparation of oxygen-containing organic compounds containing a hydroxy group acyclic
    • C12P7/06—Ethanol, i.e. non-beverage
    • C12P7/08—Ethanol, i.e. non-beverage produced as by-product or from waste or cellulosic material substrate
    • C12P7/10—Ethanol, i.e. non-beverage produced as by-product or from waste or cellulosic material substrate substrate containing cellulosic material
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Y—ENZYMES
    • C12Y302/00—Hydrolases acting on glycosyl compounds, i.e. glycosylases (3.2)
    • C12Y302/01—Glycosidases, i.e. enzymes hydrolysing O- and S-glycosyl compounds (3.2.1)
    • C12Y302/01021—Beta-glucosidase (3.2.1.21)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P2203/00—Fermentation products obtained from optionally pretreated or hydrolyzed cellulosic or lignocellulosic material as the carbon source
    • Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
    • Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
    • Y02E—REDUCTION OF GREENHOUSE GAS [GHG] EMISSIONS, RELATED TO ENERGY GENERATION, TRANSMISSION OR DISTRIBUTION
    • Y02E50/00—Technologies for the production of fuel of non-fossil origin
    • Y02E50/10—Biofuels, e.g. bio-diesel

Abstract

The invention relates to β -glucosidase mutant TLE of penicillium oxalicum 16 and application thereof, wherein the amino acid sequence of β -glucosidase mutant TLE is SEQ ID NO. 3, and the nucleic acid sequence of the coding gene is SEQ ID NO. 4, β -glucosideThe optimal reaction temperature of the enzyme mutant TLE is 65 ℃, and the catalytic efficiency constant isk cat/K m983.68mM are achieved‑1S‑1Glucose inhibitory StrengthK appm/K IThe value is 0.35 (when 20mmol/L glucose), which is 1.22 times and 0.3 times of the original enzyme respectively, the glucose tolerance is improved by 263%, higher product tolerance and higher activity are shown, and the β -glucosidase mutant TLE can be applied to the fields of feed, medicine, food, chemical industry, energy and the like.

Description

Beta-glucosidase mutant TLE of penicillium oxalicum 16 and application thereof
Technical Field
The invention relates to a beta-glucosidase mutant TLE of penicillium oxalicum 16 and application thereof, and particularly belongs to the technical field of enzyme engineering.
Background
Beta-glucosidase can hydrolyze a substrate into beta-D-glucose and corresponding aglycone, but because the original beta-glucosidase has poor enzymological characteristics, such as low catalytic activity, poor glucose tolerance and high catalytic temperature, the beta-glucosidase is difficult to be applied to a plurality of fields of feed, medicine, food, chemical industry, energy and the like.
The beta-glucosidase of penicillium oxalicum 16 has an uninhibited activity against furan derivatives and phenolic compounds and an excellent tolerance against high concentrations of KCl, NaCl and ethanol, however, the optimum temperature of wild type 16BGL is about 70 ℃, and its activity and glucose tolerance are low. The mutant TLE is obtained through a molecular modification technology, has high catalytic efficiency and high glucose tolerance, can meet the requirements of various fields such as feed, medicine, food, chemical industry, energy and the like, and has good application prospect.
Disclosure of Invention
The invention aims to provide a beta-glucosidase mutant TLE of penicillium oxalicum 16 and application thereof. According to the invention, through high-throughput screening, a mutant TLE with higher glucose tolerance and higher activity at a lower temperature is finally obtained, and the constitutive expression Pichia pastoris GS115 engineering bacteria is reconstructed, so that a foundation is laid for realizing the application of the engineering bacteria.
The amino acid sequence of the beta-glucosidase mutant TLE of penicillium oxalicum 16 is SEQ ID NO: 3, the nucleic acid sequence of the coding gene is SEQ ID NO: 4; the beta-glucosidase of the penicillium oxalicum 16 is SEQ ID NO: 1, wherein the 280 th methionine of the amino acid sequence is mutated into threonine, the 484 th valine is mutated into leucine, and the 589 th aspartic acid is mutated into glutamic acid.
The coding gene is inserted into a vector pGAPZaA at the Not I and EcoRI insertion sites to obtain a recombinant vector pGAPZaA-TLE.
After the recombinant vector pGAPZaA-TLE is linearized by Bgl II restriction endonuclease, the recombinant vector is electrically transferred to pichia pastoris GS115 to obtain the recombinant pichia pastoris GS115 engineering bacteria.
The recombinant pichia pastoris GS115 engineering bacteria are used for producing a beta-glucosidase mutant TLE.
The beta-glucosidase mutant TLE is applied under the conditions that the reaction temperature is 30-70 ℃ and the pH is 3-6.
The invention has the beneficial effects that the mutant TLE is obtained through a molecular modification technology, the optimum reaction temperature of the mutant TLE is 65 ℃, and the catalytic efficiency constant k is 65 DEG, wherein the mutant TLE is &lTt transfer = &/T &gTt-glucosidase mutant TLEcat/Km983.68mM are achieved-1S-1Glucose inhibitory Strength Kappm/KIThe value is 0.35 (when 20mmol/L glucose), which is 1.22 times and 0.3 time of the original enzyme respectively, the glucose tolerance of the enzyme is improved by 263 percent, higher catalytic efficiency and high glucose tolerance are shown, and the enzyme can be applied to the fields of feed, medicine, food, chemical industry, energy and the like, and has good application prospect.
Drawings
FIG. 1 is a graph showing the relative activities of the original enzyme and the mutant TLE at different temperatures in example 4 of the present invention;
FIG. 2 is a graph showing the cellulosic ethanol yields of the original enzyme, control and mutant TLEs of example 5 of the present invention;
in the figure: the control was no addition of any beta-glucosidase.
Detailed Description
The present invention will be further described with reference to the drawings and examples so that those skilled in the art can understand the present invention, but the present invention is not limited to the following embodiments.
Example 1
Obtaining beta-glucosidase
This example used Trizol test by TarkaraThe agent and the reverse transcription kit take penicillium oxalicum 16 as a material, and carry out inoculation, induction culture and mycelium collection on the penicillium oxalicum 16. Total RNA is extracted by a Trizol method, and then reverse transcription is carried out to obtain cDNA. By using a conventional PCR method, through a specific primer SP 5-GAATTCAAGGATCTTGCCTACTCTCCCCCCT-3 '(underlined is EcoR I restriction enzyme cleavage site) and XM 5'GGCGGCCGCCTCAATGGTGATGGTGATGATGCTGCACCTTGGGCAGATCGGCTGAAAG-3' (the straight line is Not I restriction enzyme cutting site, the wavy line is 6 histidine labels), amplifying β -glucosidase gene by taking cDNA as a template, connecting to a constitutive expression vector pGAPZaA to obtain a recombinant vector, and sequencing the recombinant vector to obtain the nucleotide sequence of the recombinant vector shown as SEQ ID NO. 2 and the coded amino acid sequence shown as SEQ ID NO. 1.
Example 2
Discovery of beta-glucosidase mutant gene
And (3) performing directed evolution technology on the nucleotide sequence of SEQ ID NO: 2, carrying out molecular modification to obtain a mutant gene, connecting the mutant gene with a constitutive expression vector pGAPZaA to obtain a recombinant vector, carrying out panel color screening and 96-well plate high-throughput screening to obtain a mutant TLE with higher activity and high glucose tolerance, and sequencing the mutant TLE to obtain a nucleotide sequence of the mutant TLE, wherein the nucleotide sequence is shown as SEQ ID NO: 4, and the coded amino acid sequence is shown as SEQ ID NO: 3, respectively.
Experimental example 3
Preparation of beta-glucosidase mutant TLE
The directed evolution conditions were 3. mu.L of 10 × PCR buffer, 3. mu.L of dNTP, and 0.5mmol/L of MnCl20.3 μ M of the upstream primer SP, 0.3 μ M of the downstream primer XM, 5U of Taq DNA polymerase, 5ng of β -glucosidase DNA template, sterile deionized water to 30 μ L.
The mutant genes from directed evolution were ligated into the vector pGAPZ. alpha.A, then transformed into E.coli Top10 and plated on LB plates containing bleomycin, and all positive mutants from LB plates were recovered into 250mL Erlenmeyer flasks containing 25mLLB (pH 7.5) containing 50. mu.g/mL bleomycin at 37 ℃ for 4-6h at 120 rpm. Extracting a recombinant vector of the escherichia coli Top10, carrying out enzyme digestion, electrically transferring the recombinant vector after enzyme digestion into pichia pastoris GS115, then coating a transformant into a YPG (pH6.5) plate containing 5g of glucose, 0.15% of esculin, 1.5% of ferric ammonium citrate and 100ug/mL of bleomycin, and culturing at 30 ℃ for 48-96 h.
All positive mutants with large black circles around them were screened from the first round of screening for the second round of screening. The selected positive mutants were inoculated into 96-well plates containing 100. mu.L LYPG liquid medium and 100. mu.g/mL bleomycin, and cultured at 30 ℃ for 48 hours. The bacterial liquid was centrifuged at 10000rpm for 5 minutes, and the supernatant and the precipitate were separately stored. mu.L of the diluted supernatant was mixed with 25. mu.L of 1% salicin (dissolved in 50mM citrate buffer, pH5) in a 96-well plate at 50 ℃ for 15 minutes. Then, 50 μ l of dns was added to the mixture to terminate the reaction. The reaction mixture was boiled for another 10 minutes and then cooled at room temperature. Finally, the OD of the mixture at 540nm was determined using a microplate reader.
Positive mutants with higher OD values were selected from the second round of selection for further screening, inoculated into liquid medium containing 25mLYPG (pH6.5) and cultured at 30 ℃ for 2 days, containing 100. mu.g/mL of bleomycin. Then, the bacterial solution was centrifuged at 10000g for 15 minutes to obtain a supernatant. According to the DNS method, a mutant TLE with higher activity and high glucose tolerance is obtained.
Example 4
Characterization of the enzymatic Properties of the beta-glucosidase and its mutant TLE
And (3) measuring enzyme activity: taking 50 μ L of enzyme solution after appropriate dilution, adding 450 μ L of 1% salicin (salicin is dissolved in 50mM citrate buffer solution with pH5.0 in advance), mixing well, reacting at 50 deg.C for a while, finally adding 500 μ L of DNS reagent to terminate the reaction, boiling the reactant in boiling water for 10-15min, cooling to room temperature, and detecting OD value at 540nm with spectrophotometer.
Measurement of optimum temperature: the β -glucosidase and its mutant TLE were reacted with 50mM acetate buffer containing salicin, pH5 at various temperatures (35-80 ℃ for 30 minutes), respectively, and its activity was measured by DNS method.
Glucose tolerance was determined by taking 25. mu.L of diluted 16BGL or its mutant and different concentrations of 4-nitrophenyl- β -D-glucoside (pNPG) and glucose, mixing, adding citric acid buffer at pH5.0 to a total volume of 500. mu.L, after reacting for 15 minutes at 50 ℃, adding an equal volume of 10% (w/V) sodium carbonate to the mixture to terminate the reaction and obtain the OD of the mixture at 420nm, wherein the final concentrations of pNPG were 0.1, 0.2, 0.4, 0.6, 0.8 and 1mmol/L, respectively, and the final concentrations of glucose were controlled to 0, 20 and 40mmol/L, respectively, according to the Lineweaver-Burk reciprocal diagram, V was calculated using Michaelis-Menten equation (1) and competitive inhibition equation (2)max，KmAnd KI(glucose inhibition constant).
Figure BDA0002509432930000041
Figure BDA0002509432930000042
As can be seen from Table 1 and FIG. 1, the catalytic efficiency constant k of the mutant TLEcat/Km983.68mM are achieved-1S-1Glucose inhibitory Strength Kappm/KIThe value of 0.35 (at 20mmol/L glucose) is 1.22 times and 0.3 times that of the original enzyme (glucose tolerance of this mutant is improved by 263%), representing higher product tolerance and activity.
TABLE 1 molecular dynamics constants and glucose-inhibited molecular dynamics constants
Figure BDA0002509432930000043
Example 5
Application of beta-glucosidase mutant TLE in production of cellulosic ethanol
Taking a 250mL conical flask, shaking, adding 10g of microcrystalline cellulose as a substrate, 20IU of filter paper enzyme solution, 0.06mg of beta-glucosidase or mutant TLE thereof and an equal amount of saccharomyces cerevisiae UV-20 fermented for 48 hours, and then fixing the volume to 100 mL. The control was not added with any β -glucosidase, and the rest was unchanged.
And (3) performing static culture in an incubator at 40 ℃, taking 1mL of bacterial liquid every 12h, centrifuging, taking supernatant, and detecting the alcohol concentration by using a potassium dichromate method.
As shown in FIG. 2, after 120 hours of fermentation, the mutant TLE produced 6.15g/L of cellulosic ethanol, which was 9.52% and 21.78% higher than the β -glucosidase and control of Penicillium oxalicum 16, respectively. Therefore, the mutant TLE has potential application value in cellulosic ethanol production.
Sequence listing
<110> university of Master in Jiangxi
<120>1, beta-glucosidase mutant TLE of penicillium oxalicum 16 and application
<141>2020-03-20
<160>4
<170>SIPOSequenceListing 1.0
<210>1
<211>842
<212>PRT
<213>Original enzyme from Penicillium oxalicum 16
<400>1
Lys Asp Leu Ala Tyr Ser Pro Pro Phe Tyr Pro Ser Pro Trp Ala Thr
1 5 10 15
Gly Glu Gly Glu Trp Ala Glu Ala Tyr Lys Lys Ala Val Asp Phe Val
20 25 30
Ser Gly Leu Thr Leu Ala Glu Lys Val Asn Ile Thr Thr Gly Ala Gly
35 40 45
Trp Glu Gln Glu Arg Cys Val Gly Glu Thr Gly Gly Val Pro Arg Leu
50 55 60
Gly Met Trp Gly Met Cys Met Gln Asp Ser Pro Leu Gly Val Arg Asn
65 70 75 80
Ala Asp Tyr Ser Ser Ala Phe Pro Ala Gly Val Asn Val Ala Ala Thr
85 90 95
Trp Asp Arg Arg Leu Ala Tyr Gln Arg Gly Thr Ala Met Gly Glu Glu
100 105 110
His Arg Asp Lys Gly Val Asp Val Gln Leu Gly Pro Val Ala Gly Pro
115 120 125
Leu Gly Lys Asn Pro Asp Gly Gly Arg Gly Trp Glu Gly Phe Ser Pro
130 135140
Asp Pro Val Leu Thr Gly Val Met Met Ala Glu Thr Ile Lys Gly Ile
145 150 155 160
Gln Asp Ala Gly Val Ile Ala Cys Ala Lys His Phe Ile Met Asn Glu
165 170 175
Gln Glu His Phe Arg Gln Ala Gly Glu Ala Gln Gly Tyr Gly Phe Asn
180 185 190
Ile Ser Gln Ser Leu Ser Ser Asn Val Asp Asp Lys Thr Met His Glu
195 200 205
Leu Tyr Leu Trp Pro Phe Val Asp Ser Val Arg Ala Gly Val Gly Ser
210 215 220
Val Met Cys Ser Tyr Asn Gln Ile Asn Asn Ser Tyr Gly Cys Ser Asn
225 230 235 240
Ser Tyr Thr Leu Asn Lys Leu Leu Lys Gly Glu Leu Gly Phe Gln Gly
245 250 255
Phe Val Met Ser Asp Trp Gly Ala His His Ser Gly Val Gly Asp Ala
260 265 270
Leu Ala Gly Leu Asp Met Ser Met Pro Gly Asp Val Ile Leu Gly Ser
275 280 285
Pro Tyr Ser Phe Trp Gly Thr Asn Leu Thr Val Ser Val Leu Asn Ser
290 295 300
Thr Ile Pro Glu Trp Arg Leu Asp Asp Met Ala Val Arg Ile Met Ala
305 310 315 320
Ala Tyr Tyr Lys Val Gly Arg Asp Arg His Arg Thr Pro Pro Asn Phe
325 330 335
Ser Ser Trp Thr Arg Asp Lys Tyr Gly Tyr Glu His Phe Ile Val Gln
340 345 350
Glu Asn Tyr Val Lys Leu Asn Glu Arg Val Asn Val Gln Arg Asp His
355 360 365
Ala Asn Val Ile Arg Lys Ile Gly Ser Asp Ser Ile Val Met Leu Lys
370 375 380
Asn Asn Gly Gly Leu Pro Leu Thr His Gln Glu Arg Leu Val Ala Ile
385 390 395 400
Leu Gly Glu Asp Ala Gly Ser Asn Ala Tyr Gly Ala Asn Gly Cys Ser
405 410 415
Asp Arg Gly Cys Asp Asn Gly Thr Leu Ala Met Gly Trp Gly Ser Gly
420 425 430
Thr Ala Asn Phe Pro Tyr Leu Ile Thr Pro Glu Gln Ala Ile Gln Asn
435 440 445
Glu Val Leu Asn Tyr Gly Asn Gly Asp Thr Asn Val Phe Ala Val Thr
450 455 460
Asp Asn Gly Ala Leu Ser Gln Met Ala Ala Leu Ala Ser Thr Ala Ser
465 470 475 480
Val Ala Leu Val Phe Val Asn Ala Asp Ser Gly Glu Gly Tyr Ile Ser
485 490 495
Val Asp Gly Asn Glu Gly Asp Arg Lys Asn Met Thr Leu Trp Lys Asn
500 505 510
Gly Glu Glu Leu Ile Lys Thr Ala Thr Ala Asn Cys Asn Asn Thr Ile
515 520 525
Val Ile Met His Thr Pro Asn Ala Val Leu Val Asp Ser Trp Tyr Asp
530 535 540
Asn Glu Asn Ile Thr Ala Ile Leu Trp Ala Gly Met Pro Gly Gln Glu
545 550 555 560
Ser Gly Arg Ser Leu Val Asp Val Leu Tyr Gly Arg Thr Asn Pro Gly
565 570 575
Gly Lys Thr Pro Phe Thr Trp Gly Lys Glu Arg Lys Asp Trp Gly Ser
580 585 590
Pro Leu Leu Thr Lys Pro Asn Asn Gly His Gly Ala Pro Gln Asp Asp
595 600 605
Phe Thr Asp Val Leu Ile Asp Tyr Arg Arg Phe Asp Lys Asp Asn Val
610 615 620
Glu Pro Ile Phe Glu Phe Gly Phe Gly Leu Ser Tyr Thr Lys Phe Glu
625 630 635 640
Phe Ser Asp Ile Gln Val Lys Ala Leu Asn His Gly Glu Tyr Asn Ala
645 650 655
Thr Val Gly Lys Thr Lys Pro Ala Pro Ser Leu Gly Lys Pro Gly Asn
660 665 670
Ala Ser Asp His Leu Phe Pro Ser Asn Ile Asn Arg Val Arg Gln Tyr
675 680 685
Leu Tyr Pro Tyr Leu Asn Ser Thr Asp Leu Lys Ala Ser Ala Asn Asp
690 695 700
Pro Asp Tyr Gly Met Asn Ala Ser Ala Tyr Ile Pro Pro His Ala Thr
705 710 715 720
Asp Ser Asp Pro Gln Asp Leu Leu Pro Ala Ser Gly Pro Ser Gly Gly
725 730 735
Asn Pro Gly Leu Phe Glu Asp Leu Ile Glu Val Thr Ala Thr Val Thr
740 745 750
Asn Thr Gly Ser Val Thr Gly Asp Glu Val Pro Gln Leu Tyr Val Ser
755 760 765
Leu Gly Gly Ala Asp Asp Pro Val Lys Val Leu Arg Ala Phe Asp Arg
770 775 780
Val Thr Ile Ala Pro Gly Gln Lys Leu Arg Trp Thr Ala Thr Leu Asn
785 790 795 800
Arg Arg Asp Leu Ser Asn Trp Asp Val Pro Ser Gln Asn Trp Ile Ile
805 810 815
Ser Asp Ala Pro Lys Lys Val Trp Val Gly Asn Ser Ser Arg Lys Leu
820 825 830
Pro Leu Ser Ala Asp Leu Pro Lys Val Gln
835 840
<210>2
<211>2526
<212>DNA
<213>Original gene from Penicillium oxalicum 16
<400>2
<210>3
<211>842
<212>PRT
<213>Mutant enzyme
<400>3
Lys Asp Leu Ala Tyr Ser Pro Pro Phe Tyr Pro Ser Pro Trp Ala Thr
1 5 10 15
Gly Glu Gly Glu Trp Ala Glu Ala Tyr Lys Lys Ala Val Asp Phe Val
20 25 30
Ser Gly Leu Thr Leu Ala Glu Lys Val Asn Ile Thr Thr Gly Ala Gly
35 40 45
Trp Glu Gln Glu ArgCys Val Gly Glu Thr Gly Gly Val Pro Arg Leu
50 55 60
Gly Met Trp Gly Met Cys Met Gln Asp Ser Pro Leu Gly Val Arg Asn
65 70 75 80
Ala Asp Tyr Ser Ser Ala Phe Pro Ala Gly Val Asn Val Ala Ala Thr
85 90 95
Trp Asp Arg Arg Leu Ala Tyr Gln Arg Gly Thr Ala Met Gly Glu Glu
100 105 110
His Arg Asp Lys Gly Val Asp Val Gln Leu Gly Pro Val Ala Gly Pro
115 120 125
Leu Gly Lys Asn Pro Asp Gly Gly Arg Gly Trp Glu Gly Phe Ser Pro
130 135 140
Asp Pro Val Leu Thr Gly Val Met Met Ala Glu Thr Ile Lys Gly Ile
145 150 155 160
Gln Asp Ala Gly Val Ile Ala Cys Ala Lys His Phe Ile Met Asn Glu
165 170 175
Gln Glu His Phe Arg Gln Ala Gly Glu Ala Gln Gly Tyr Gly Phe Asn
180 185 190
Ile Ser Gln Ser Leu Ser Ser Asn Val Asp Asp Lys Thr Met His Glu
195 200 205
Leu Tyr Leu Trp Pro Phe Val Asp Ser Val Arg Ala Gly Val Gly Ser
210 215 220
Val Met Cys Ser Tyr Asn Gln Ile Asn Asn Ser Tyr Gly Cys Ser Asn
225 230 235 240
Ser Tyr Thr Leu Asn Lys Leu Leu Lys Gly Glu Leu Gly Phe Gln Gly
245 250 255
Phe Val Met Ser Asp Trp Gly Ala His His Ser Gly Val Gly Asp Ala
260 265 270
Leu Ala Gly Leu Asp Met Ser Thr Pro Gly Asp Val Ile Leu Gly Ser
275 280 285
Pro Tyr Ser Phe Trp Gly Thr Asn Leu Thr Val Ser Val Leu Asn Ser
290 295 300
Thr Ile Pro Glu Trp Arg Leu Asp Asp Met Ala Val Arg Ile Met Ala
305 310 315 320
Ala Tyr Tyr Lys Val Gly Arg Asp Arg His Arg Thr Pro Pro Asn Phe
325 330 335
Ser Ser Trp Thr Arg Asp Lys Tyr Gly Tyr Glu His Phe Ile Val Gln
340 345 350
Glu Asn Tyr Val Lys Leu Asn Glu Arg Val Asn Val Gln Arg Asp His
355 360 365
Ala Asn Val Ile Arg Lys Ile Gly Ser Asp Ser Ile Val Met Leu Lys
370 375 380
Asn Asn Gly Gly Leu Pro Leu Thr His Gln Glu Arg Leu Val Ala Ile
385 390 395 400
Leu Gly Glu Asp Ala Gly Ser Asn Ala Tyr Gly Ala Asn Gly Cys Ser
405 410 415
Asp Arg Gly Cys Asp Asn Gly Thr Leu Ala Met Gly Trp Gly Ser Gly
420 425 430
Thr Ala Asn Phe Pro Tyr Leu Ile Thr Pro Glu Gln Ala Ile Gln Asn
435 440 445
Glu Val Leu Asn Tyr Gly Asn Gly Asp Thr Asn Val Phe Ala Val Thr
450 455 460
Asp Asn Gly Ala Leu Ser Gln Met Ala Ala Leu Ala Ser Thr Ala Ser
465 470 475 480
Val Ala Leu Leu Phe Val Asn Ala Asp Ser Gly Glu Gly Tyr Ile Ser
485 490 495
Val Asp Gly Asn Glu Gly Asp Arg Lys Asn Met Thr Leu Trp Lys Asn
500 505 510
Gly Glu Glu Leu Ile Lys Thr Ala Thr Ala Asn Cys Asn Asn Thr Ile
515 520 525
Val Ile Met His Thr Pro Asn Ala Val Leu Val Asp Ser Trp Tyr Asp
530 535 540
Asn Glu Asn Ile Thr Ala Ile Leu Trp Ala Gly Met Pro Gly Gln Glu
545 550 555 560
Ser Gly Arg Ser Leu Val Asp Val Leu Tyr Gly Arg Thr Asn Pro Gly
565 570 575
Gly Lys Thr Pro Phe Thr Trp Gly Lys Glu Arg Lys Glu Trp Gly Ser
580 585 590
Pro Leu Leu Thr Lys Pro Asn Asn Gly His Gly Ala Pro Gln Asp Asp
595 600 605
Phe Thr Asp Val Leu Ile Asp Tyr Arg Arg Phe Asp Lys Asp Asn Val
610 615 620
Glu Pro Ile Phe Glu Phe Gly Phe Gly Leu Ser Tyr Thr Lys Phe Glu
625 630 635 640
Phe Ser Asp Ile Gln Val Lys Ala Leu Asn His Gly Glu Tyr Asn Ala
645 650 655
Thr Val Gly Lys Thr Lys Pro Ala Pro Ser Leu Gly Lys Pro Gly Asn
660 665 670
Ala Ser Asp His Leu Phe Pro Ser Asn Ile Asn Arg Val Arg Gln Tyr
675 680 685
Leu Tyr Pro Tyr Leu Asn Ser Thr Asp Leu Lys Ala Ser Ala Asn Asp
690 695 700
Pro Asp Tyr Gly Met Asn Ala Ser Ala Tyr Ile Pro Pro His Ala Thr
705 710 715 720
Asp Ser Asp Pro Gln Asp Leu Leu Pro Ala Ser Gly Pro Ser Gly Gly
725 730 735
Asn Pro Gly Leu Phe Glu Asp Leu Ile Glu Val Thr Ala Thr Val Thr
740 745 750
Asn Thr Gly Ser Val Thr Gly Asp Glu Val Pro Gln Leu Tyr Val Ser
755 760 765
Leu Gly Gly Ala Asp Asp Pro Val Lys Val Leu Arg Ala Phe Asp Arg
770 775 780
Val Thr Ile Ala Pro Gly Gln Lys Leu Arg Trp Thr Ala Thr Leu Asn
785 790 795 800
Arg Arg Asp Leu Ser Asn Trp Asp Val Pro Ser Gln Asn Trp Ile Ile
805 810 815
Ser Asp Ala Pro Lys Lys Val Trp Val Gly Asn Ser Ser Arg Lys Leu
820 825 830
Pro Leu Ser Ala Asp Leu Pro Lys Val Gln
835 840
<210>4
<211>2526
<212>DNA
<213>Mutant gene
<400>4

Claims (5)

1. A beta-glucosidase mutant TLE of penicillium oxalicum 16, characterized in that: the amino acid sequence of the beta-glucosidase mutant TLE is SEQ ID NO: 3, the nucleic acid sequence of the coding gene is SEQ ID NO: 4; the beta-glucosidase of the penicillium oxalicum 16 is SEQ ID NO: 1, wherein the 280 th methionine of the amino acid sequence is mutated into threonine, the 484 th valine is mutated into leucine, and the 589 th aspartic acid is mutated into glutamic acid.
2. The beta-glucosidase mutant TLE of penicillium oxalicum 16 according to claim 1, characterized in that: the coding gene is inserted into a vector pGAPZaA at the Not I and EcoR I insertion sites to obtain a recombinant vector pGAPZaA-TLE.
3. The beta-glucosidase mutant TLE of penicillium oxalicum 16 according to claim 2, characterized in that: after the recombinant vector pGAPZaA-TLE is linearized by Bgl II restriction endonuclease, the recombinant vector is electrically transferred to pichia pastoris GS115 to obtain the recombinant pichia pastoris GS115 engineering bacteria.
4. The beta-glucosidase mutant TLE of penicillium oxalicum 16 according to claim 3, wherein: the recombinant pichia pastoris GS115 engineering bacteria are used for producing a beta-glucosidase mutant TLE.
5. The application of a beta-glucosidase mutant TLE of penicillium oxalicum 16 is characterized in that: the beta-glucosidase mutant TLE is applied under the conditions that the reaction temperature is 30-70 ℃ and the pH is 3-6.
CN202010456548.2A 2020-05-26 2020-05-26 Beta-glucosidase mutant TLE of penicillium oxalicum 16 and application thereof Active CN111518792B (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN202010456548.2A CN111518792B (en) 2020-05-26 2020-05-26 Beta-glucosidase mutant TLE of penicillium oxalicum 16 and application thereof

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN202010456548.2A CN111518792B (en) 2020-05-26 2020-05-26 Beta-glucosidase mutant TLE of penicillium oxalicum 16 and application thereof

Publications (2)

Publication Number Publication Date
CN111518792A true CN111518792A (en) 2020-08-11
CN111518792B CN111518792B (en) 2022-04-01

Family

ID=71912506

Family Applications (1)

Application Number Title Priority Date Filing Date
CN202010456548.2A Active CN111518792B (en) 2020-05-26 2020-05-26 Beta-glucosidase mutant TLE of penicillium oxalicum 16 and application thereof

Country Status (1)

Country Link
CN (1) CN111518792B (en)

Cited By (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2022062501A1 (en) * 2020-09-24 2022-03-31 江南大学 Method for preparing gentiooligosaccharide by catalyzing cellulose by using compound enzyme, and use thereof
CN114703165A (en) * 2022-04-02 2022-07-05 天津科技大学 Beta-glucosidase mutant and application thereof
WO2023225459A2 (en) 2022-05-14 2023-11-23 Novozymes A/S Compositions and methods for preventing, treating, supressing and/or eliminating phytopathogenic infestations and infections

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN105229141A (en) * 2013-03-15 2016-01-06 拉勒曼德匈牙利流动管理有限责任公司 For the expression of the beta-glucosidase enzyme of the hydrolysis of lignocellulose and relevant oligopolymer
US20170145457A1 (en) * 2009-11-06 2017-05-25 Novozymes, Inc. Compositions for saccharification of cellulosic material

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20170145457A1 (en) * 2009-11-06 2017-05-25 Novozymes, Inc. Compositions for saccharification of cellulosic material
CN105229141A (en) * 2013-03-15 2016-01-06 拉勒曼德匈牙利流动管理有限责任公司 For the expression of the beta-glucosidase enzyme of the hydrolysis of lignocellulose and relevant oligopolymer

Non-Patent Citations (3)

* Cited by examiner, † Cited by third party
Title
HANXIN LI等: "Recombinant Penicillium oxalicum 16 β-Glucosidase 1 Displays Comprehensive Inhibitory Resistance to Several Lignocellulose Pretreatment Products, Ethanol, and Salt", 《APPLIED BIOCHEMISTRY AND BIOTECHNOLOGY》 *
易拾: "木质纤维素酶的生产优化、定向进化和生物乙醇应用研究", 《工程科技Ⅰ辑》 *
赵喜华等: "β-葡萄糖苷酶最适温度及耐酸性的定向进化", 《中国生物工程学会》 *

Cited By (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2022062501A1 (en) * 2020-09-24 2022-03-31 江南大学 Method for preparing gentiooligosaccharide by catalyzing cellulose by using compound enzyme, and use thereof
CN114703165A (en) * 2022-04-02 2022-07-05 天津科技大学 Beta-glucosidase mutant and application thereof
WO2023225459A2 (en) 2022-05-14 2023-11-23 Novozymes A/S Compositions and methods for preventing, treating, supressing and/or eliminating phytopathogenic infestations and infections

Also Published As

Publication number Publication date
CN111518792B (en) 2022-04-01

Similar Documents

Publication Publication Date Title
CN111518792B (en) Beta-glucosidase mutant TLE of penicillium oxalicum 16 and application thereof
JP4986038B2 (en) Method for producing highly hydrolyzed cellulase and hemicellulase
CN108291213A (en) The yeast strain of expression and heterologous protein secretion at high temperature
CN107937365B (en) β -galactosidase mutant and preparation method and application thereof
CN108060142B (en) Enzyme for degrading biogenic amine in soy sauce
CN104140959B (en) Novel esterase as well as coding gene and application of esterase
JP4998991B2 (en) Method for producing cellulase
CN112708608B (en) Xylanase mutant and preparation method and application thereof
CN111621490B (en) Beta-glucosidase mutant SVS of penicillium oxalicum 16 and application thereof
CN114107262B (en) High-specific-activity xylanase mutant and application thereof
CN112063605A (en) Method for preparing gentiooligosaccharide by catalyzing cellulose with complex enzyme and application of method
CN104726435B (en) A kind of beta-glucosidase enzyme mutant, its recombinant expression plasmid and the engineered strain of conversion
CN113337495B (en) Method for improving sialic acid yield and application
Han et al. Improved production of fructooligosaccharides (FOS) using a mutant strain of Aspergillus oryzae S719 overexpressing β-fructofuranosidase (FTase) genes
CN103937691A (en) Aspergillus oryzae strain capable of producing beta-fructofuranosidase, as well as culture method and application thereof
CN109777788A (en) A kind of leucine dehydrogenase mutant and its application
JP7388195B2 (en) Trichoderma reesei mutant strain and protein production method
CN114736881B (en) Glucose oxidase GoxM10 mutant A4D with improved acid stability and derivative mutant and application thereof
CN107058263A (en) A kind of high efficiency preparation method of new beta amylase
CN114736880B (en) Mutant D497N of glucose oxidase GoxM10 with improved acid stability as well as derivative mutant and application thereof
CN113817704B (en) Cyclodextrin glucosyltransferase with improved organic solvent tolerance and preparation method thereof
CN107142254B (en) High-glucose-tolerance β -glucosidase mutant and gene and application thereof
CN107022536B (en) Cellulase mutant with high catalytic efficiency, and gene and application thereof
CN116064616A (en) Cellulase gene, cellulase, recombinant vector and application
CN108588062A (en) A kind of method and its application obtaining mutant of trehalose synthetase

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
GR01 Patent grant
GR01 Patent grant