CN111518721B

CN111518721B - Screening of cyanide degrading bacterial strain and its application in food production

Info

Publication number: CN111518721B
Application number: CN202010366102.0A
Authority: CN
Inventors: 吴群; 徐岩; 沈婷
Original assignee: SUQIAN JIANGNAN UNIVERSITY INDUSTRY TECHNOLOGY INSTITUTE; Jiangnan University
Current assignee: SUQIAN JIANGNAN UNIVERSITY INDUSTRY TECHNOLOGY INSTITUTE; Jiangnan University
Priority date: 2020-04-30
Filing date: 2020-04-30
Publication date: 2021-12-28
Anticipated expiration: 2040-04-30
Also published as: CN111518721A

Abstract

The invention discloses screening of cyanide degrading bacterial strain and application thereof in food production, belonging to the field of wine brewing and food safety. The invention provides bacillus subtilis CGMCC NO.19042 capable of degrading cyanide generated in grain food fermentation, which can grow in an environment with KCN as a unique nitrogen source, has a cyanide degradation rate of 99.1%, and has good degradation capability on cyanide generated in a white spirit fermentation process. The bacterial strain of the invention is applied to the preparation of distilled liquor and other foods, and can reduce the content of cyanide to a certain extent.

Description

Screening of cyanide degrading bacterial strain and its application in food production

Technical Field

The invention relates to screening of cyanide degrading bacterial strain and application thereof in food production, belonging to the field of wine brewing and food safety.

Background

A metabolic byproduct and cyanide are inevitably generated in the fermentation process of the traditional cereal food. The production of cyanide is mainly composed of two aspects, firstly from the presence of the cereal raw material as its own defense mechanism and, in addition, from the production of urea by the microbial metabolism during fermentation.

Cyanide means containing CN^－The group compounds are classified into inorganic cyanides and organic cyanides. According to the requirements of the GB 2757-2012 standard of national standard distilled liquor for food safety and compound liquor thereof, the limit standard of cyanide (calculated as HCN) in the white spirit is less than or equal to 8.0 mg/L. Cyanide has a low boiling point and is readily converted to the carcinogen urethane during distillation and storage. Depending on the source of cyanide: the method mainly comprises the following steps of (1) decomposing raw materials and urea, wherein the existing method for controlling cyanide in white spirit mainly comprises the following steps: (1) raw material treatment and (2) reduction of urea content.

As early as 1991 in the raw material treatment, Panwei researches a method for eliminating cyanide in the production of liquid-state cassava liquor, mainly solarizes and ventilates cassava raw materials before warehousing to ensure that a part of hydrocyanic acid volatilizes automatically, and the method is also suitable for the treatment of the liquor raw materials; in the cooking process, multi-row waste gas is saccharified by the bran koji, so that harmful substances such as hydrocyanic acid and the like can be effectively discharged, and certain enzyme systems contained in the bran koji can also have a certain decomposition effect on the hydrocyanic acid. However, excessive measures such as increased venting during the solarization or cooking process may cause problems such as loss of nutrients and flavor.

At present, there is no report about screening and utilization of strains for directly degrading cyanide in a white spirit system, researches about cyanide degradation are mainly related to cyanide in soil or water, and besides chemical treatment, biological cyanide degradation is mainly carried out by pathogenic strains such as Klebsiella oxytoca, Nocardia, Arthrobacter, Pseudomonas putida, Pseudomonas marginalis, Pseudomonas aeruginosa, Rhodococcus erythropolis and Rhodococcus rhodochrous, and the strains cannot be applied to fermented foods.

Therefore, the strain which can degrade cyanide and adapt to various food production environments is obtained, and has important effects on the production of fermented food and the food safety.

Disclosure of Invention

In order to solve the problems, the invention provides a Bacillus subtilis strain which is preserved in China general microbiological culture collection center in 2019 in 11 months and 27 days, wherein the preservation number is CGMCC NO.19042, and the preservation address is No. 3 of Xilu No.1 Beijing north Chen of the rising area in Beijing.

The invention provides a method for culturing bacillus subtilis AYS-4, which is characterized in that the bacillus subtilis AYS-4 is inoculated into a culture medium for culture.

In one embodiment of the invention, the concentration of ethanol in the medium is not higher than 35mg/100 mL.

In one embodiment of the present invention, the culture temperature is 20 to 55 ℃.

In one embodiment of the present invention, the pH in the medium is 3.0 to 7.0.

In one embodiment of the invention, the NaCl concentration is not higher than 16%.

The invention provides a composition containing bacillus subtilis AYS-4.

In one embodiment of the invention, the composition comprises Bacillus subtilis AYS-4 and a dietetically acceptable carrier.

In one embodiment of the invention, the composition is a bacillus subtilis solid/liquid inoculant.

In one embodiment of the invention, the microbial inoculum comprises the viable cells of the bacillus subtilis and a cell protective agent.

In one embodiment of the invention, the composition contains a concentrate of ≧ 1X 10⁵CFU/g, or bacteria concentration is more than or equal to 1 × 10⁵CFU/mL of Bacillus subtilis AYS-4.

In one embodiment of the invention, the composition is a koji containing Bacillus subtilis AYS-4.

In one embodiment of the invention, the composition is a composition containing a concentrate of ≧ 1X 10⁵CFU/g fermented grains of Bacillus subtilis AYS-4.

In one embodiment of the invention, the koji comprises one or more of wheat, barley, pea and adzuki bean.

In one embodiment of the invention, the liquid microbial inoculum contains an A or B culture medium.

In one embodiment of the invention, the preparation method of the solid microbial inoculum comprises the steps of inoculating the bacillus subtilis AYS-4 into a culture medium, activating for 2-3 generations at the temperature of 30-40 ℃, and allowing the strain concentration to reach 1.0 multiplied by 10⁶When the viable count is more than CFU/mL, centrifuging at 2000-6000 rpm for 15-25 min, removing supernatant, sequentially adding buffer solution and cryoprotectant in sterile environment until the cell concentration is not less than 1.0 × 10⁶And (5) performing vacuum freeze drying treatment when cfu/mL is reached to obtain the microbial inoculum.

In one embodiment of the invention, the buffer is double distilled water or phosphate buffer solution, and the cryoprotectant is trehalose or skim milk powder.

In one embodiment of the invention, the buffer solution is a 0.1-1M phosphate buffer solution with a pH value of 5-8, and the cryoprotectant is 5-20% (w/v) trehalose and/or skim milk powder.

In one embodiment of the present invention, the buffer is 0.2M phosphate buffer with pH 7, and the cryoprotectant is 10-15% (w/v) trehalose or skim milk powder.

In one embodiment of the invention, the liquid bacterial agent is prepared by inoculating Bacillus subtilis AYS-4 into a liquid bacterial agent culture medium, and culturing at 30-40 ℃ for 20-25 h to make the final concentration of the strain in the culture medium 1.0 × 10⁷～1.0×10⁹CFU/mL; the formula of the liquid bacterial agent culture medium is A or B; wherein the content of the first and second substances,

a: the yeast extract comprises, by g/L, 4-6 parts of yeast powder, 9-11 parts of peptone, 9-11 parts of NaCl and the balance of water;

b: the method comprises the following steps of taking sorghum serving as a raw material for brewing white spirit as a culture medium: after being crushed, sorghum is mixed according to the ratio of 1 (3-5) w/v of raw materials to water, the mixture is cooked for 40-50 min at the temperature of 100-110 ℃, saccharifying enzyme 45-55 units/g of raw materials is added after cooling, the mixture is kept for 2-10h at the temperature of 55-65 ℃, filtering is carried out, and the filtrate obtained by centrifugation is adjusted to have the sugar degree of 95-105 Bx and the pH value of 4.0-4.8.

The invention also provides a solid microbial inoculum which is bran koji.

In one embodiment of the present invention, the preparation method of the bran koji comprises:

(1) preparation of liquid seed culture: under the aseptic condition, bacillus subtilis AYS-4 is selected to be placed in a test tube filled with a liquid seed culture medium, and is placed on a shaking table to be cultured for 18-28 h at the rotating speed of 150-300 rpm and the temperature of 22-55 ℃, so that a first-grade liquid seed culture is prepared.

(2) Preparation of secondary seed culture: transferring the primary liquid seed culture into a liquid seed culture medium according to the inoculation amount of 5-20 mg/100mL, and culturing for 18-28 h on a shaker at the rotating speed of 150-300 rpm and the temperature of 22-55 ℃ to obtain the secondary liquid seed culture.

(3) Preparation of tertiary seed cultures: and transferring the secondary liquid seed culture into a Kaschin tank filled with a liquid seed culture medium according to the volume of 5-20 mg/100mL, and performing static culture at the temperature of 22-55 ℃ for 18-28 h to obtain the tertiary liquid seed culture.

(4) Inoculating the third-stage liquid seed culture into a sterilized bran solid culture medium in an inoculation amount of 2-10% by volume, culturing at 22-55 ℃ for 1-3 days, and air-drying for 1-3 days to prepare the solid bran koji.

The invention provides a method for degrading cyanide, which is characterized in that the bacillus subtilis AYS-4 is added into a system containing cyanide.

In one embodiment of the invention, the cyanide concentration is no more than 10% of the system.

In one embodiment of the invention, the cyanide concentration is no more than 5% of the system.

In one embodiment of the present invention, the reaction temperature is 20 to 55 ℃ and the pH is 3.0 to 7.0.

The invention provides a method for reducing cyanide content in white spirit, which is characterized in that bacillus subtilis AYS-4 or the composition is added into yeast for making white spirit, stacked fermented grains or fermented grains fermented in a cellar.

In one embodiment of the invention, the composition is in the form of a liquid or solid culture.

In one aspect of the inventionIn an embodiment, the Bacillus subtilis has a final concentration of 1.0 × 10 in Daqu, stacked or pooled fermented grains⁵～1.0×10⁷CFU/g。

In one embodiment of the present invention, the total inoculation amount of the liquid culture is 1-200 mL/kg, and the total inoculation amount of the solid culture is 1-200 g/kg.

The invention provides application of the bacillus subtilis AYS-4, the composition, the method for degrading cyanide, or the method for reducing the content of cyanide in white spirit in preparation of grain fermented food.

In one embodiment of the invention, the use is in the preparation of brewed or distilled liquors.

In one embodiment of the invention, the application is in the preparation of white spirit, yellow wine, soy sauce and vinegar.

In one embodiment of the invention, the application is the application in preparation of Luzhou-flavor Daqu liquor.

The invention has the beneficial effects that:

the invention provides a bacillus subtilis CGMCC NO.19042 capable of efficiently degrading cyanide in fermentation of cereal food, which has the following characteristics:

(1) can grow in an environment with KCN as a unique nitrogen source, and the degradation rate of cyanide can reach 99.1%;

(2) the growth condition is good under the conditions of 55 ℃ and pH 4;

(3) can tolerate 12mg/100mL of ethanol;

(4) can tolerate 12% (w/v) NaCl;

(5) can produce 26 kinds of flavor substances including acid, ester, alcohol, aromatic compound, phenol, furan and aldehyde ketone.

The application of the strain in the fields of distilled liquor and other foods can reduce the content of cyanide: the bacillus subtilis is applied to the process of brewing white spirit, so that the cyanide content in fermented grains and raw wine can be respectively reduced by 51.5 percent and 62.7 percent. Therefore, the bacillus subtilis has good application prospects in food preparation and degradation of cyanide content.

Biological material preservation

The Bacillus subtilis is preserved in 27 months 11 and 2019 and is preserved in the China general microbiological culture Collection center (CGMCC) with the preservation number of CGMCC NO.19042, the preservation address of No. 3 of Naja district Beijing, China institute of sciences and microbiology.

Drawings

FIG. 1 is an electrophoretogram of 16S rDNA fragment obtained by strain amplification.

Detailed Description

A screening culture medium: KCN medium (g/L): (NH)₄)₂SO₄ 0.4，NaCl 0.1，K₂HPO₄0.4, glucose 1, yeast extract 1, agar 20; the pH value is 8.0, and KCN solution and nystatin are added into the mixture after sterilization for 2.5mL/L (the concentration is 0.1 g/mL).

LB culture medium: 10g of tryptone, 5g of yeast extract and 5g of NaCl were added to 1L of deionized water, the pH was adjusted to 7.4 with 1mol/L NaOH, and steam sterilization was carried out at 121 ℃ under high pressure for 20 min.

Enrichment culture medium: (NH)₄)₂SO₄ 0.4g，NaCl 0.1g，K₂HPO₄0.4g, 1g of glucose, 1g of yeast extract, sterilization at 121 ℃ for 20min, and addition of KCN until the cyanogen concentration reaches 10 mg/L.

Tris buffer (pH 8.00): 50mL of 0.1mol/L Tris solution was mixed with 29.2mL of 0.1mol/L hydrochloric acid, and 20.8mL of water was added.

Cyanide-tolerant medium: 0.4g (NH)₄)₂SO₄，0.1g NaCl，0.4g K₂HPO₄1g of glucose and 1g of yeast extract are sterilized at 121 ℃ for 20min, and then a KCN solution after filtration sterilization is added to make the cyanogen concentration 10mg/L, 50mg/L and 100 mg/L.

The cyanide detection method comprises the following steps: oxidant (N-chlorosuccinimide-succinimide): dissolving 1g of succinimide in 30mL of ultrapure water, adding 0.1g N-chlorosuccinimide, stirring until the succinimide is dissolved, adding ultrapure water to a constant volume of 100m L, and storing at 4 ℃ in a dark place; developer (barbituric acid-pyridine): 6g of barbituric acid is dissolved in a small amount of ultrapure water, 30mL of pyridine is added, then ultrapure water is added to the solution until the volume is 100mL, and the solution is stored at 4 ℃ in the dark. 1mL of the wine sample was aspirated, 50. mu.L of an oxidizing agent and 50. mu.L of a color developing agent were added, and the mixture was reacted at 25 ℃ for 25min, and the absorbance was measured at 575 nm. The measurement was repeated 3 times to obtain an average value.

Bran leaching juice: wheat bran 200g, high temperature amylase 2,000IU, adding water 800mL, and steaming at 100 deg.C for 10 min. Cooling, adding 100,000IU of alkaline protease, and keeping at 55 deg.C for 30 min; filtering to obtain supernatant, pH6.2, 1 × 10⁵Pa sterilizing for 20min, and adding glucose to final concentration of 10g/L before use.

Extraction of flavor compounds: reference is made to the Fan W L and Qian M C.Characterisation of aroma compounds of Chinese "Wuliangye" and "Jiannanchun" liquors by aroma compounds of analysis [ J]A method of 2695-one 2704, which comprises adding 60g of NaCl to 250mL of fermentation broth, and adding CH₂Cl₂90mL of the extract was extracted three times. After layering, the extract phase was collected and nitrogen was purged to 250 μ L.

GC-MS analysis: the specific steps are as follows: screening of sauce-flavor-producing functional bacteria and research of characteristic flavor compounds thereof, Zunong, Master, Jiangnan university, 2009: separating the sample by a DB-Wax capillary column, wherein the temperature programming condition is as follows: the initial temperature is 50 deg.C, the temperature is kept for 2min, and then the temperature is raised to 230 deg.C at the rate of 6 deg.C/min, and the temperature is kept for 30 min. Sample introduction amount: 1 μ L, not split. Carrier gas: he; flow rate: 2 mL/min; mass spectrometry conditions EI: an ionization source; electron energy: 70 eV; ion source temperature: 230 ℃; scanning range: 30amu to 550 amu.

Example 1: screening and identification of bacillus subtilis AYS-4

(1) Preparing appropriate sample dilution gradient and culturing

Adding 5g of fermented grains and 15mL of sterile physiological saline into a centrifuge tube, shaking and uniformly mixing for 5min, centrifuging at 300g for 3min, taking supernatant, transferring the supernatant into a sterile 50mL centrifuge tube, centrifuging at 9000g for 5min, removing supernatant, and collecting cells.

Adding 10mL sterile physiological saline, shaking, mixing, centrifuging at 9000g for 5min to remove the upper cleaning cells, repeating the above operation for 2 times, and collecting the supernatantThen resuspending the cells with 10mL of physiological saline, mixing well, resuspending and diluting the cells, and diluting the cells to 1.0X 10 cell concentration⁸CFU/mL，1.0×10⁷CFU/mL，1.0×10⁶CFU/mL, spreading the diluted bacterial solution on a 10mg/L KCN plate to obtain a single colony, and culturing at 37 ℃ until the single colony grows out.

(2) Strain screening and preservation

Picking single colony from the plate to 96-well plate medium containing 50mg/L KCN solution, culturing at 37 deg.C, and detecting OD at 24h and 48h respectively₆₀₀And cyanide concentration, and finally selecting a strain with higher bacterial liquid concentration and reduced KCN content; adding the bacterial liquid into 30% sterile glycerol solution, and storing at-80 deg.C.

(3)16S rDNA sequence amplification

Absorbing 100 mu L of inoculum size of a strain preserved at minus 80 ℃, inoculating the strain to an MRS culture medium, placing the strain in an anaerobic condition at 37 ℃, standing and culturing for 20-24 h, absorbing 1mL of bacterial liquid, centrifuging at 6000rpm for 3min, removing supernatant, washing twice, centrifuging to remove supernatant to obtain bacterial sludge, taking the bacterial sludge as a template, and carrying out PCR amplification, wherein the process comprises the following steps:

1) amplification system 20 μ L:

the template amount was 1. mu.L (27F 0.5. mu.L, 1492R 0.5. mu.L), Taq enzyme MasterMix 10. mu.L, ddH₂O is 7. mu.L.

The primers used were 27F: AGAGTTTGATCCTGGCCTCA, 1492R: GGTTACCTTGTTACGACTT.

2) Amplification conditions:

pre-denaturation: 3min at 95 ℃; first-step denaturation: 1min at 94 ℃; and a second step of annealing: 30s at 60 ℃; and a third step of extension: circulating for 30 times from the first step to the third step at 72 ℃ for 2 min; the fourth step is finally extended: 5min at 72 ℃; the fifth step is that: 10min at 12 ℃.

(4) Agarose gel electrophoresis

Weighing 80mL of agarose, adding the agarose into a conical flask, adding 80mL of 1xTAE, heating for 4min in a microwave discontinuous manner until the liquid is clear and transparent, slightly cooling, adding 4 muL of nucleic acid dye, shaking up without bubbles, pouring the mixture into a gel plate groove, cooling for 40min, solidifying, placing the mixture into an electrophoresis groove, exhausting bubbles, sequentially adding PCR amplification products, adding 2 muL of PCR amplification products into each hole, taking out after 120V 15min gel running, placing the mixture into a gel electrophoresis imager for photographing and storing, recording the serial number of a sample with successful PCR, and placing the successful PCR products into a refrigerator at-20 ℃ for storage.

(5) Strain sequence detection and identification

And (3) sending the sample with the successful PCR to an England Weiji (Shanghai) trade company Limited for detection, performing BLAST retrieval in a sequence database (http:// www.ncbi.nlm.nih.gov/BLAST) of the National Center for Biotechnology Information (NCBI) according to the fed-back sequence result, and selecting the strain information with the highest matching degree for result recording.

Through analysis and identification, the taxonomy of the strain provided by the invention is named as Bacillus subtilis.

Example 2: application of bacillus subtilis AYS-4 in degradation of cyanide

The cyanide degradation capability of the bacillus subtilis AYS-4:

inoculating bacillus subtilis AYS-4 bacterial liquid into an enrichment culture medium, and culturing for 8-14 h until the bacterial concentration is 1.0 multiplied by 10⁸CFU/mL。

Taking 100mL of enrichment culture medium to be based on 250mL of shake flask, inoculating 1-2 mL of bacterial liquid after sterilization, culturing for 12h, and culturing to obtain the strain with the concentration of 2.3 multiplied by 10⁸Centrifuging CFU/mL bacterial solution at 12000rpm for 5min, collecting cells after centrifugation, washing the collected cells with physiological saline for 3 times, suspending the washed cells in 10mL Tris buffer solution, adding into a centrifuge tube, adding potassium cyanide solution (prepared from 1 g/L0.1 mol NaOH) and sterile water to total volume of 25mL, and allowing CN to stand for^－The concentration is 50mg/L, the pH is 8.0, the conversion is carried out in a centrifugal tube at 30 ℃ and 120rpm for 6h (the conversion is convenient for centrifugal sampling detection in the process), the degradation rate is respectively measured at 8h, 16h and 24h, and the cyanide degradation rate is measured.

The cyanide degradation of Bacillus subtilis AYS-4 obtained in example 1 after 8h, 16h and 24h conversion in 50mg/L potassium cyanide solution is shown in Table 1, and the results show that: after 8 hours of conversion, the degradation rate of cyanide can reach 79.9%, after 16 hours of conversion, the degradation rate of cyanide can reach 94.2%, and after 24 hours of conversion, the degradation rate of cyanide can reach 99.1%.

TABLE 1 cyanide degradation rate

Comparative example 1: degradation of cyanide by Bacillus subtilis168

The difference between the specific implementation mode and the (1) in the example 2 is that the degradation rate of cyanide in 50mg/L potassium cyanide solution after 8 hours of conversion is 46.8% by replacing the Bacillus subtilis AYS-4 with Bacillus subtilis 168.

Example 3: determination of high-temperature resistance of bacillus subtilis AYS-4

The Bacillus subtilis AYS-4 screened in example 1 was inoculated into 5mL of LB medium so that the final concentration of the strain in the medium was 1.0X 10⁶CFU/mL, respectively at 40 deg.C, 45 deg.C, 50 deg.C, 55 deg.C, 60 deg.C, 65 deg.C under culture for 24h, the results show that the strain grows well at 55 deg.C, and the bacterial concentration (OD) after 24h of culture₆₀₀) Up to more than 1.6. When Bacillus subtilis168 strain was used as a control and cultured at 55 ℃ for the same period of time, the results showed that OD was₆₀₀Only 0.6.

Example 4: determination of ethanol resistance of bacillus subtilis AYS-4

Bacillus subtilis AYS-4 screened in example 1 was inoculated into 5mL of LB medium containing 3, 6, 9, 12, 15mg/100mL of ethanol, respectively, so that the final concentration of the strain in the medium was 1.0X 10⁶CFU/mL, respectively cultured at 37 ℃ for 24h, and the results show that the strain grows well in the environment with the ethanol concentration not higher than 12mg/100mL, and the bacterial concentration (OD) is high after 24h of culture₆₀₀) Up to 2.0 or more. The Bacillus subtilis168 model strain was used as a control, and cultured for the same time in an environment containing 12% ethanol, and the results showed that the concentration (OD) was higher after 24 hours of culture₆₀₀) Only 0.5.

Example 5: performance determination of bacillus subtilis AYS-4 in acid-resistant environment

Bacillus subtilis AYS-4 screened in example 1 was inoculated into 5mL of LB medium (with HCl and N) at pH 2, 3, 4, 5, 6, respectivelypH adjusted by aOH) so that the final concentration of the strain in the medium is 1.0 × 10⁶CFU/mL, respectively cultured at 37 ℃ for 24h, and the results showed that the strain grew well in an environment with pH4 and was concentrated (OD) after 24h of culture₆₀₀) Up to 2.3 or more. The Bacillus subtilis168 strain was used as a control, and cultured for the same time in an environment of pH4, and the results showed that the strain was concentrated (OD)₆₀₀) Only 0.6.

Example 6: determination of salt tolerance of bacillus subtilis AYS-4

The Bacillus subtilis AYS-4 screened in example 1 was inoculated into 5mL LB medium with salinity of 8, 10, 12, 14, 16g/100mL NaCl, respectively, so that the final concentration of the strain in the medium was 1.0X 106CFU/mL, and each was cultured at 37 ℃ for 24h, showing that the strain grew well in an environment with an ethanol concentration of not higher than 12g/100mL, and that the concentration of the strain after 24h of culture (OD) was high₆₀₀) Up to 2.1 or more. The Bacillus subtilis168 model strain was used as a control, and cultured for the same time in an environment containing 12% ethanol, and the results showed that the concentration (OD) was higher after 24 hours of culture₆₀₀) Only 0.5.

Example 7: determination of flavor characteristics produced by bacillus subtilis AYS-4

The strain selected in example 1 was cultured in bran extract. Shaking and culturing at 37 deg.C and 150r/min for 6 d. And (4) taking the fermentation liquor which is not inoculated as a control, and inspecting the characteristics of the flavor substances produced by the strains.

Extracting flavor compounds from the fermentation liquor, and analyzing the flavor compounds by using a GC-MS method.

In the fermentation broth, 26 flavor compounds including acids, esters, alcohols, aromatics, phenols, furans and aldehydes and ketones were co-detected as follows:

TABLE 2 fermentation substance species produced by Bacillus subtilis AYS-4

Example 8: preparation of bacillus subtilis AYS-4 microbial inoculum

(1) Preparing a solid microbial inoculum: inoculating the bacillus subtilis AYS-4 into 10-30 mL of enrichment medium, activating for 2-3 generations at 30 ℃ until the concentration of the strain reaches 1.0 multiplied by 10⁸Centrifuging at 4000rpm for 20min when the viable count is above CFU/mL, removing supernatant, sequentially adding buffer (0.2M phosphate buffer solution with pH of 7) and cryoprotectant (15% (w/v) trehalose and/or skimmed milk powder) in sterile environment until the cell concentration is not lower than 1.0 × 10⁷And (5) performing vacuum freeze drying treatment when cfu/mL is reached to obtain the solid microbial inoculum.

(2) Preparing a liquid microbial inoculum: inoculating Bacillus subtilis AYS-4 into liquid bacterial agent culture medium, and culturing at 37 deg.C for 24 hr to make the final concentration of the strain in the culture medium 1.0 × 10⁸CFU/mL; the formula of the liquid bacterial agent culture medium is A or B; wherein the content of the first and second substances,

a: in g/L, 5 parts of yeast powder, 10 parts of peptone, 10 parts of NaCl and the balance of water;

b: the method comprises the following steps of taking sorghum serving as a raw material for brewing white spirit as a culture medium: pulverizing sorghum, mixing with water at a ratio of 1:4w/v, decocting at 105 deg.C for 45min, cooling, adding diastase 50 units/g, maintaining at 60 deg.C for 2-10h, filtering, and centrifuging to obtain filtrate with sugar degree of 100Bx and pH of 4.5.

Example 9: application of bacillus subtilis AYS-4 in strong aromatic Chinese spirits

Preparation of liquid seed culture: under the aseptic condition, selecting 1 ring of Bacillus subtilis AYS-4 to a 20mL test tube filled with 5mL liquid seed culture medium, and culturing for 24h on a shaking table at the rotation speed of 200rpm and 37 ℃ to obtain a first-level liquid seed culture.

Preparation of secondary seed culture: transferring the primary liquid seed culture into a 500mL shake flask containing 300mL liquid seed culture medium according to the inoculation amount (by volume) of 10%, and culturing on a shaking table at the rotation speed of 200rpm and 37 ℃ for 24h to obtain a secondary liquid seed culture.

Preparation of tertiary seed cultures: transferring the first-level liquid seed culture into a 5L Karschner flask containing 3L of liquid seed culture medium according to the inoculation amount (by volume) of 10%, and performing static culture at 37 ℃ for 24h to obtain a third-level liquid seed culture.

The seed liquid culture medium (g/L): 10 parts of beef extract, 10 parts of glucose and 5 parts of NaCl, 7.0 parts of pH, and 1 multiplied by 10 parts of pH⁵Pa sterilizing for 20 min.

Inoculating the second-stage liquid seed culture at an inoculum size of 4 vol% into sterilized bran solid culture medium, culturing at 37 deg.C for 2d, and air drying for 1 day to obtain solid bran koji.

The above bran koji culture medium: bran: water 1: sterilizing at 0.9 and 121 deg.C for 50 min.

Mixing the solid bran koji, steamed grains, spread-cooled cooked grains and Daqu powder uniformly to obtain fermented grains, and fermenting in a tank for 70 days. The yeast consumption is 4 percent (by mass) of the feeding amount.

After the fermentation is finished, detecting the cyanide content in the fermented grains, and the results are shown in tables 3 and 4; mixing fermented grains, filling into a steamer, steaming (the specific preparation steps refer to the literature: Yujoyun' the influence of the production process of the strong aromatic white spirit on quality), preparing raw wine, detecting the content of cyanide in the raw wine, and finding that the fermented grains added with the bacillus subtilis AYS-4 can reduce the content of cyanide in the fermented grains by 51.5% and reduce the content of cyanide in the raw wine by 62.7% during production, which indicates that the purpose of reducing the content of cyanide in the wine can be achieved by adding the strain.

TABLE 3 content of cyanide in fermented grains after strain fortification

TABLE 4 cyanide content of the fortified base liquors of the strains

Note: control was no bacillus subtilis added.

Although the present invention has been described with reference to the preferred embodiments, it should be understood that various changes and modifications can be made therein by those skilled in the art without departing from the spirit and scope of the invention as defined in the appended claims.

Claims

1. A strain of Bacillus subtilis is preserved in China general microbiological culture Collection center (CGMCC) in 11 months and 27 days in 2019, and the preservation number is CGMCC NO. 19042.

2. A composition comprising the bacillus subtilis of claim 1.

3. The composition of claim 2, wherein the composition is a bacillus subtilis preparation, and the bacillus subtilis of claim 1 is present in the preparation at a concentration of not less than 1.0 x 10⁵CFU/mL, or not less than 1X 10⁵CFU/g。

4. The composition of claim 3, wherein the composition is a solid or liquid microbial inoculum.

5. The composition as claimed in claim 4, wherein the liquid microbial inoculum contains A or B;

a: yeast powder 4-6 g/L, peptone 9-11 g/L and NaCl 9-11 g/L;

b: the sorghum is crushed and used as a raw material, the raw material and water are mixed according to the mass volume ratio of 1 (3-5), the mixture is cooked for 40-50 min at 100-110 ℃, saccharifying enzyme 45-55 units/g raw material is added after cooling, the mixture is kept for 2-10h at 55-65 ℃, filtering is carried out, and the filtrate obtained by centrifugation is adjusted to have the sugar degree of 95-105 Bx and the pH value of 4.0-4.8.

6. The composition of claim 3, wherein the composition is a koji or fermented grain.

7. The composition of claim 6, wherein the koji comprises one or more of wheat, barley, pea, adzuki bean.

8. A method for degrading cyanide compounds, characterized in that Bacillus subtilis of claim 1 is added to a system containing cyanide compounds, which is not aimed at the diagnosis or treatment of diseases.

9. A method for reducing cyanide content in liquor, characterized in that Bacillus subtilis of claim 1 or the composition of any one of claims 2 to 6 is added in the form of liquid or solid culture to liquor yeast, stacked fermented grains or fermented grains fermented in a cellar.

10. The method according to claim 9, wherein the total inoculation amount of the liquid culture is 1-200 mL/kg, and the total inoculation amount of the solid culture is 1-200 g/kg.

11. Use of the bacillus subtilis of claim 1, or the composition of any one of claims 2 to 7, or the method of any one of claims 8 to 10 for the preparation of fermented foodstuffs.