CN112442453B - Ormokodak yeast for degrading biogenic amine and application of same in white spirit brewing - Google Patents

Ormokodak yeast for degrading biogenic amine and application of same in white spirit brewing Download PDF

Info

Publication number
CN112442453B
CN112442453B CN202011477625.9A CN202011477625A CN112442453B CN 112442453 B CN112442453 B CN 112442453B CN 202011477625 A CN202011477625 A CN 202011477625A CN 112442453 B CN112442453 B CN 112442453B
Authority
CN
China
Prior art keywords
yeast
hjm
biogenic amine
kodamaea ohmeri
white spirit
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Active
Application number
CN202011477625.9A
Other languages
Chinese (zh)
Other versions
CN112442453A (en
Inventor
邹永芳
郭辉祥
余东
王晓平
张明
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Shede Liquor Co ltd
Original Assignee
Shede Liquor Co ltd
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Shede Liquor Co ltd filed Critical Shede Liquor Co ltd
Priority to CN202011477625.9A priority Critical patent/CN112442453B/en
Publication of CN112442453A publication Critical patent/CN112442453A/en
Application granted granted Critical
Publication of CN112442453B publication Critical patent/CN112442453B/en
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Classifications

    • A—HUMAN NECESSITIES
    • A23—FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
    • A23L—FOODS, FOODSTUFFS, OR NON-ALCOHOLIC BEVERAGES, NOT COVERED BY SUBCLASSES A21D OR A23B-A23J; THEIR PREPARATION OR TREATMENT, e.g. COOKING, MODIFICATION OF NUTRITIVE QUALITIES, PHYSICAL TREATMENT; PRESERVATION OF FOODS OR FOODSTUFFS, IN GENERAL
    • A23L27/00—Spices; Flavouring agents or condiments; Artificial sweetening agents; Table salts; Dietetic salt substitutes; Preparation or treatment thereof
    • A23L27/50—Soya sauce
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12G—WINE; PREPARATION THEREOF; ALCOHOLIC BEVERAGES; PREPARATION OF ALCOHOLIC BEVERAGES NOT PROVIDED FOR IN SUBCLASSES C12C OR C12H
    • C12G3/00—Preparation of other alcoholic beverages
    • C12G3/02—Preparation of other alcoholic beverages by fermentation
    • C12G3/021—Preparation of other alcoholic beverages by fermentation of botanical family Poaceae, e.g. wheat, millet, sorghum, barley, rye, or corn
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12G—WINE; PREPARATION THEREOF; ALCOHOLIC BEVERAGES; PREPARATION OF ALCOHOLIC BEVERAGES NOT PROVIDED FOR IN SUBCLASSES C12C OR C12H
    • C12G3/00—Preparation of other alcoholic beverages
    • C12G3/02—Preparation of other alcoholic beverages by fermentation
    • C12G3/021—Preparation of other alcoholic beverages by fermentation of botanical family Poaceae, e.g. wheat, millet, sorghum, barley, rye, or corn
    • C12G3/022—Preparation of other alcoholic beverages by fermentation of botanical family Poaceae, e.g. wheat, millet, sorghum, barley, rye, or corn of botanical genus Oryza, e.g. rice
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12J—VINEGAR; PREPARATION OR PURIFICATION THEREOF
    • C12J1/00—Vinegar; Preparation or purification thereof
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N1/00—Microorganisms, e.g. protozoa; Compositions thereof; Processes of propagating, maintaining or preserving microorganisms or compositions thereof; Processes of preparing or isolating a composition containing a microorganism; Culture media therefor
    • C12N1/14—Fungi; Culture media therefor
    • C12N1/16—Yeasts; Culture media therefor

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • Engineering & Computer Science (AREA)
  • Health & Medical Sciences (AREA)
  • Zoology (AREA)
  • Genetics & Genomics (AREA)
  • Wood Science & Technology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Biochemistry (AREA)
  • Mycology (AREA)
  • Food Science & Technology (AREA)
  • Biotechnology (AREA)
  • Polymers & Plastics (AREA)
  • Botany (AREA)
  • Nutrition Science (AREA)
  • Medicinal Chemistry (AREA)
  • Tropical Medicine & Parasitology (AREA)
  • Virology (AREA)
  • Biomedical Technology (AREA)
  • Microbiology (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)

Abstract

The invention belongs to the technical field of biological fermentation, and particularly relates to an omega yeast capable of degrading biogenic amine in a white spirit brewing process and application thereof. The Kyoto yeast, kodamaea ohmeri HJM, has been deposited in China Center for Type Culture Collection (CCTCC) No. 2020297 in the year 2020, and has a deposit address of university of Wuhan, china. The application of the Kodak yeast HJM in reducing the biogenic amine content in the food field. The yeast is harmless bacteria selected from Daqu, and has high temperature and ethanol tolerance, acid resistance and sugar resistance; can degrade biogenic amine in white spirit distiller's yeast well, and improve the production safety of white spirit.

Description

Ormokodak yeast for degrading biogenic amine and application of same in white spirit brewing
Technical Field
The invention belongs to the technical field of biological fermentation, and particularly relates to a strain of biogenic amine degrading Kodak yeast and application thereof in white spirit brewing.
Background
Biogenic Amines (BAs) are a class of organic compounds of low molecular mass with bioactive nitrogen content, known collectively as Biogenic Amines, which are widely present in living cells and are the normal active components within the cell. Biogenic amine is generated by free amino acid under the action of decarboxylase, or can be generated after aldehyde is aminated; meanwhile, biogenic amine can be oxidized and degraded under the action of amine oxidase. Biogenic amines are widely used in foods rich in proteins and amino acids such as fermented dairy products, seafood, meats, and alcoholic beverages. Fan Wenlai et al detected nine biogenic amines in white spirit for the first time using gas chromatography: putrescine, cadaverine, methylamine, ethylamine, pyrrolidine, isopentylamine, cyclohexylamine, cycloheptylamine, cyclopentylamine. Trace biogenic amine is beneficial to the body and promotes metabolism and growth and development of human body, but excessive ingestion of biogenic amine by human body can produce toxic effects, such as reactions of headache, blood pressure change, palpitation, respiratory disturbance and the like, and seriously threatens even life. Therefore, reducing the content of biogenic amine in food and improving the safety of food are important for human health.
The current method for controlling biogenic amine in food mainly comprises the steps of adding additives, irradiating, controlling sanitary conditions and the like, and the addition of microorganism degrading biogenic amine in fermented products to reduce the biogenic amine content of the food is also a common method. However, the reported articles mainly screen strains with biogenic amine degradation from cheese, fermented bean curd, fermented meat products and bean paste, and the strain for degrading biogenic amine in wines, especially white wine, has not been reported yet.
The solid white spirit in China belongs to distilled liquor, but the biogenic amine is mainly from the fermentation process as the fermented liquor such as yellow wine, beer and the like. Therefore, if strains which can degrade biogenic amine generated in the process of brewing white wine are bred, the biogenic amine content in white wine can be obviously reduced, and the strain has important significance for producing healthier and safer white wine products.
Disclosure of Invention
The invention aims at providing the yeast strain of the Kodak-Omeid for degrading biogenic amine. The Kodak yeast HJM is harmless bacteria screened from solid white spirit Daqu, and has high temperature and ethanol tolerance, acid resistance and sugar resistance; can degrade biogenic amine (methylamine, ethylamine, cyclopentylamine, putrescine, cyclohexylamine, cadaverine, cycloheptylamine, isopentylamine and pyrrolidine) generated in the fermentation process of white wine, the degradation rate can reach 96.07%, and the food safety of white wine can be obviously improved.
Another object of the present invention is to provide the use of the above-mentioned yeast HJM for brewing white spirit.
In order to achieve the above purpose of the present invention, the specific technical scheme of the present invention is as follows:
the Kyoto yeast Kodamaea ohmeri HJM is preserved in China Center for Type Culture Collection (CCTCC) No. M2020297 in the year 2020, 7 and 9, and has a preservation address of university of Wuhan, wuhan; post code of preservation address: 430072.
as a preferred embodiment in the present application, a microbial preparation containing the above-mentioned Kodak yeast HJM is prepared.
As a preferred embodiment of the present application, the viable count of the Kodak yeast HJM per gram or per milliliter of the preparation is not less than 1X 10 6 CFU。
As a preferred embodiment of the present application, the microbial agent is a liquid microbial agent or a solid microbial agent.
As a preferred embodiment in the present application, the use of the said kodak yeast HJM for reducing biogenic amine content in the food field.
As a preferred embodiment in the present application, the food is white spirit, soy sauce, vinegar or fish gravy.
As a better implementation mode in the application, the method for preparing the distiller's yeast of the white spirit by using the Kodak yeast HJM.
As a better embodiment in the application, the application of the Kodak yeast HJM in reducing the biogenic amine content in white spirit is provided.
As a better implementation mode in the application, the Kodak yeast HJM is harmless bacteria screened from solid white spirit Daqu, and has high temperature and ethanol tolerance and good acid resistance; the maximum tolerance of the Kodak yeast HJM to the temperature is 43 ℃; ethanol tolerance was 14% maximum; the highest acid tolerance was 2; has higher glucose tolerance, and still grows well when the glucose concentration reaches 600 g/L.
As a better implementation mode in the application, the method has the advantages that the biological amine generated in the fermentation process of the white wine is well degraded by the Kodak yeast HJM, and the highest degradation rate can reach 96.07%; the biogenic amines include, but are not limited to, methylamine, ethylamine, cyclopentylamine, putrescine, cyclohexylamine, cadaverine, cycloheptylamine, isopentylamine, and pyrrolidine.
The application of the strain of the biogenic amine degrading omega yeast in the preparation of the white spirit Daqu drug comprises the following steps: crushing wheat, adding water, mixing, inoculating Kodamaea ohmeri HJM to the material in an inoculation amount of 8-12%, pressing to form, placing in a room, airing and removing moisture, turning over, stacking, turning over, warehousing and storing, and culturing to obtain the Daqu medicated leaven.
The application of the strain of the biogenic amine degrading omega yeast in white spirit brewing comprises the following steps:
1) Preparing Kodamaea ohmeri HJM into strain;
2) Starter propagation: crushing wheat, adding water for powder wetting and mixing, inoculating the strain in the step 1) into the material according to the inoculation amount of 8-12%, then compacting and forming, placing in a room, airing and discharging moisture, turning over the yeast, combining the piles, turning over the piles, warehousing and storing all the process steps, and culturing to obtain the Daqu medicinal yeast.
3) Steaming and gelatinizing at least one grain of rice, sorghum, glutinous rice, corn and wheat, when the temperature of the grain tank is reduced to 20-25 ℃ after the rice is discharged from a steamer and the water is filled, adding the Daqu powder prepared in the step 2), stirring uniformly, and then putting the mixture into a cellar for fermentation, discharging the cellar, and distilling to obtain wine.
Preferably, the yeast powder of step 2) is added in an amount of 10-30% of the total weight of the fermented grain lees in the cellar.
Further, the specific preparation process of the strain in the step 1) comprises the following steps: separating Kodamaea ohmeri HJM strain, rejuvenating, preferably, and performing multi-stage seed expansion culture by YPD liquid culture medium to obtain strain.
The YPD liquid culture medium multistage seed expansion culture process comprises the following steps: 130-160 g of wheat is weighed, 1L of distilled water is added for soaking overnight, boiling is carried out for 50-70 min, the wheat extract is obtained by filtering, and peptone, yeast extract powder and glucose are added into the wheat extract. Preferably, the peptone is added in an amount of 10g/L, 5g/L of yeast extract powder and 20g/L of glucose by volume of the wheat extract. Then, the preferable Kodamaea ohmeri HJM is inoculated into YPD liquid culture medium according to the inoculation amount of 5-10%, and is cultured for 24-48 h under the conditions of 25-35 ℃ and 160-180 r/min.
And further, in the step 2), the yeast drying and moisture removing means that when the temperature of the yeast blank is increased to 30-35 ℃, doors and windows are opened, moisture is removed, the room temperature is reduced, a grass curtain is uncovered, the upper layer and the lower layer of the yeast blank are turned over once, and when the temperature of the yeast blank is reduced to 20-25 ℃, the doors and windows are closed.
The turning-over is to perform the turning-over and ventilation at random when the temperature of the yeast blank rises to 30-35 ℃ again after the yeast is aired and dehumidified, so that the yeast blank is subjected to heat preservation and fermentation for 8-12 days within the temperature range of 30-50 ℃, and finally the yeast is prepared by warehousing and storage.
Compared with the prior art, the invention has the following positive effects:
the screened Kyoto yeast HJM has good temperature tolerance.
And (II) the screened chrysotoxus aureobasis HJM has good ethanol tolerance and can grow well under the condition of high ethanol mass concentration.
(III) the screened chrysotoxus aureobasidium HJM has good acid tolerance.
(IV) the screened up Kyoto Aureobasidium pullulans HJM has higher glucose tolerance, and still grows well when the glucose concentration reaches 600 g/L.
(V) the screened up Kodak yeast HJM can degrade biogenic amine (methylamine, ethylamine, cyclopentylamine, putrescine, cyclohexylamine, cadaverine, cycloheptylamine, isopentylamine and pyrrolidine) generated in the fermentation process of white wine well, the degradation rate can reach 96.07%, and the safety of white wine foods can be obviously improved.
Drawings
FIG. 1 is a graph showing the degradation of biogenic amine in a wheat fermentation substrate by Kluyveromyces fragrans Kodamaea ohmeri HJM in example 2;
wherein, 1, methylamine; 2. ethylamine; 3. cyclopentylamine; 4. putrescine; 5. cyclohexylamine; 6. cadaverine; 7. cycloheptylamine; 8. isopentylamine; 9. pyrrolidine.
FIG. 2-1 shows colony morphology (A) and optical microscopy (B) of the Kyoto yeast Kodamaea ohmeri HJM selected in example 1.
FIG. 2-2 is a colony electron micrograph of the Kyoto yeast Kodamaea ohmeri HJM selected in example 1.
FIG. 3 is a graph showing the growth of the Kluyveromyces Omeracil Kodamaea ohmeri HJM of example 1 under various pH conditions.
FIG. 4 is a graph showing the growth of the Kluyveromyces Omerdianus Kodamaea ohmeri HJM of example 1 under different sugar concentrations.
FIG. 5 is a graph showing the growth of the Kluyveromyces Omerkii Kodamaea ohmeri HJM of example 1 under different temperature conditions.
FIG. 6 is a graph showing the growth of the Kluyveromyces Omerkii Kodamaea ohmeri HJM of example 1 under different ethanol concentrations.
FIG. 7 is a phylogenetic tree constructed by the adjacency method based on 26S rDNA homology.
The specific embodiment is as follows:
the present invention will be described in further detail with reference to the following specific embodiments in order to make the objects, technical solutions and advantages of the present invention more apparent, but it should not be construed that the scope of the above subject matter of the present invention is limited to only the following examples.
The reference herein to the yeast Kodak Kodamaea ohmeri HJM, accession number: china center for type culture Collection; preservation date: 2020, 7, 9; the preservation number is CCTCC NO: M2020297, and the preservation address is China, university of Wuhan; post code of preservation address: 430072.
the percentages used in the examples below, unless otherwise indicated, represent percent by volume.
Example 1: screening of the yeasts
1) Screening saccharomycetes from Daqu, pit mud, white spirit and starter room environment
Respectively weighing 20g of Daqu and 20g of pit mud from a wine production line of a traditional Chinese liquor production enterprise of Suiining, respectively weighing 25ml of Chinese liquor into 225ml of sterile physiological saline, and putting into a shaking table 180r/min to shake for about 30 min; then sucking 25ml supernatant into 225ml sterile physiological saline, and sequentially sucking 1ml into new 9ml sterile physiological saline to obtain 10 -1 、10 -2 、10 -3 …10 -7 Gradient dilutions were then made at 10 -3 、10 -4 、10 -5 、10 -6 、10 -7 200ul of the culture medium was applied to YPD agar medium, cultured at 25 to 35℃for 24 to 48 hours, identified as yeast by morphological identification such as colony and microscopic observation, and then isolated and purified until all the cells were pure. Finally, 16 yeasts are screened out from Daqu, pit mud, white spirit and brewing environment, the numbers are J1, J2 and J3 … J16, and each strain is marked with a strain source.
2) YPD liquid culture-based multistage seed expansion culture
140g of wheat is weighed, 1L of distilled water is soaked overnight, boiled for 60min, and filtered to obtain wheat extract. YPD liquid culture medium is prepared according to 10g/L of peptone, 5g/L of yeast extract powder and 20g/L of glucose. Then, 16 strains Kodamaea ohmeri HJM were inoculated into YPD liquid medium at an inoculum size of 8%, and cultured at 28℃for 48 hours at 180 r/min.
3) Degradation condition of 16 strains of saccharomycete biogenic amine
The 16 yeasts are respectively inoculated into YPD liquid culture media simultaneously containing nine biogenic amines (each biogenic amine content is 100 mg/L), culture conditions are set according to general characteristics of the yeasts, the yeasts are cultured for 2d at 28 ℃ and 180r/min, and the content of residual biogenic amines in the culture media is measured by adopting a high performance liquid chromatography, so that the results show that J5 has the highest degradation rate on the nine biogenic amines, the specific degradation effect on various biogenic amines is shown in a table 1, the degradation effect of the strain on cyclohexylamine is the best, and the degradation rate (%) = (sample group-blank group)/sample group is multiplied by 100%. According to the source, J5 is a strain of yeast selected from Daqu, and is used as a research on subsequent biogenic amine degradation.
TABLE 1 degradation rate of various biogenic amines by the Orthoco
4) Study of whether J5 produces biogenic amine
Inoculating the J5 bacterial liquid into YPD broth culture medium respectively in an inoculum size of 5-8%, culturing for 24h and 48h respectively, and detecting the biogenic amine content by adopting a high performance liquid chromatography. The results showed that no biogenic amine production was detected regardless of the inoculum size and regardless of the incubation time, indicating that the strain itself did not produce biogenic amine.
5) Molecular biological identification of J5
Extracting genomic DNA of J5, wherein the primers are as follows: NL1:5 'GCATATCAAATAAGCGGAGGAAAG 3'; NL4:5'GGTCCGTGTTTCAAGACGG 3', 26SrDNA amplification was performed under the following PCR procedure conditions: pre-deforming at 94 ℃ for 4min, then performing the following circulation, namely deforming at 94 ℃ for 45s, annealing at 55 ℃ for 45s, and extending at 72 ℃ for 1min for 30 circulation; repair extension at 70℃for 10min and termination at 40 ℃. After sequencing to the engineering (Shanghai) stock, the resulting sequences were subjected to BLAST sequence comparison in the NCBI database, identified as Brettanomyces, and designated Kodamaea ohmeri HJM, which was the first time that Brettanomyces were screened from Daqu and subjected to the biogenic amine degradation study.
5) Research on growth characteristics of Kodamaea ohmeri HJM
A series of growth characterization studies were performed on HJM:
(1) temperature tolerance
A. Preparing YPD liquid culture medium from wheat leaching solution, wherein the liquid loading amount of each 250ml triangular flask is 50ml, sterilizing and cooling;
B. activating Kodamaea ohmeri HJM strain inclined plane at 28deg.C for 24 hr, preparing into bacterial suspension and blood cell with 9ml sterile physiological salineCounting by a counting plate and adjusting the concentration of bacterial liquid to 1 multiplied by 10 6 CFU/ml, inoculating each triangular flask according to 6% (volume ratio) of liquid loading amount, and sealing with eight layers of gauze;
C. setting a culture temperature: culturing the triangular flask inoculated with Kodamaea ohmeri HJM bacteria at 25deg.C, 30deg.C, 35deg.C, 40deg.C, 45deg.C with 180r/min constant temperature shaker for 48 hr, counting viable bacteria on YPD agar medium plate, and determining the highest tolerance temperature of the Kyoto yeast, and specifically showing the result in FIG. 3.
As can be seen from FIG. 3, the growth of the Kyoto yeast Kodamaea ohmeri HJM at 30℃is best, the difference between the other temperatures is very remarkable, the growth at 40℃is reduced, and the growth is stopped at 45 ℃.
D. The specific tolerance temperature is not obtained in the set culture temperature, and the test is continued by narrowing the temperature range, namely, the step A, B, C is repeated, and the test is continued at 40-45 ℃. And (3) continuing the test to obtain the strain which grows slightly at 42 ℃ and does not grow any more at 43 ℃, so that the highest tolerance temperature of the obtained Kyoto yeast is 43 ℃.
(2) Ethanol tolerance
Preparing YPD liquid culture medium with wheat leaching solution, wherein the liquid loading amount of each triangular flask is 50ml, sterilizing, adding 6%, 8%, 10%, 12% and 14% ethanol under aseptic environment, inoculating bacteria liquid according to 6% inoculation amount, culturing at 28deg.C and 180r/min for 48h, and counting viable bacteria on a flat plate, wherein the specific result is shown in figure 4.
As can be seen from fig. 4, as the ethanol concentration increases, the total number of strains grown decreases, the strains grow less when the ethanol concentration is 12%, and the growth stops when the ethanol concentration is 14%. When the ethanol concentration obtained by continuous test is 13%, only a few strains grow, and the highest ethanol tolerance concentration of the Kyoto-be-detected yeast is 14%.
(3) Acid tolerance
YPD liquid culture medium is prepared from wheat leaching liquor, the liquid loading amount of each triangular flask is 50ml, and the pH value of each triangular flask is adjusted by lactic acid to be: 2. 3, 4, 5 and 6, inoculating the bacterial liquid according to the inoculation amount of 6% after sterilization, culturing at 28 ℃ and 180r/min for 48 hours, and counting plate viable bacteria, wherein the specific result is shown in figure 5.
As shown in FIG. 5, the strain growth condition is best when the pH is 6, the total number of strains grown is reduced along with the increase of the environmental acidity, a little strains grow when the pH is 3, and the strains stop growing when the pH is 2, so that the highest acid-resistant pH of the Kyoto-be-detected yeast is 2. Meanwhile, the method also shows that the growth of the Almokodak yeast is inhibited in the peracid environment, but the Almokodak yeast has certain acid resistance and can grow in the acid environment.
(4) Sugar tolerance
YPD liquid culture medium is prepared from wheat leaching liquor, the liquid loading amount of each triangular flask is 50ml, and glucose is directly utilized by yeast, so that glucose is added to adjust the sugar concentration respectively: 100g/L, 200g/L, 300g/L, 400g/L, 500g/L and 600g/L, inoculating the bacterial liquid according to the inoculum size of 6% after sterilization, culturing at 28 ℃ for 48 hours at 180r/min, and counting live bacteria on a flat plate, wherein the specific result is shown in figure 6.
As is clear from FIG. 6, the strain growth decreased with increasing glucose concentration, and the number of viable bacteria decreased relatively at a glucose concentration of 500g/L, but the total number was still 2.95X10 8 CFU/ml, the growth condition is good. Continuing the test, when the glucose concentration is 600g/L, a plurality of strains still grow, and the obtained Kyoto-be-obtained has higher sugar tolerance.
6) High performance liquid phase determination of biogenic amine content
(1) And (3) manufacturing a standard curve: a certain amount of biogenic amine is weighed according to 1000mg/L to prepare standard solution, then 1ml of each biogenic amine single-component standard stock solution is respectively absorbed, the stock solution is placed in a same 10ml volumetric flask, and 0.1mol/L hydrochloric acid solution is used for constant volume to prepare 100mg/L biogenic amine standard mixed use solution.
(2) The derivatization method is described in GB 2016 "determination of biogenic amine in food", and is modified slightly. Taking 1ml of biogenic amine standard series solution into a 15ml centrifuge tube, sequentially adding 1ml of saturated sodium bicarbonate solution and 1ml of 2mol/L sodium hydroxide solution to provide an alkaline environment, 1ml of 10mg/ml dansyl chloride solution, mixing by vortex for 1min, carrying out stopper dark treatment for 30min in a constant-temperature water bath at 40 ℃ for 15min, shaking for one time, taking out, adding 1ml of saturated sodium chloride solution, keeping constant temperature for 10min at 40 ℃ to terminate derivatization, taking out, cooling to room temperature, adding 3ml of multiplied by 2 diethyl ether, shaking for 2min, standing for layering, transferring an upper organic phase to a new 15ml centrifuge tube, combining the two extracts, carrying out water bath nitrogen blow drying at 40 ℃. 1ml of acetonitrile is added to dissolve the residue, and after shaking and mixing, the mixture is filtered through a 0.22um filter membrane to be measured.
(3) Sample pretreatment: 5ml of the fermentation broth was centrifuged at 6000 Xg for 20min in a 15ml centrifuge tube. 1ml of supernatant was treated by derivatization and the same standard.
(4) Chromatographic conditions: the chromatographic column is Angilent ZORBAX SB C column (4.6 x 250mm x 5 um), ultraviolet detection wavelength is 254nm, column temperature is 30 ℃, sample injection amount is 10ul, flow rate is 0.4ml/min, mobile phase A acetonitrile, B ultrapure water and gradient elution program is: :5-70% (A), 15-90% (A), 20-100% (A), 30-65% (A).
Example 2: kodamaea ohmeri HJM degradation of biogenic amine in multi-grain fermented grains
Preparing bacterial liquid:
YPD liquid medium was prepared: weighing 140g of wheat, soaking in 1L of distilled water overnight, boiling for 60min, and filtering to obtain wheat extract; adding peptone, yeast extract powder and glucose into the wheat extract, sterilizing at 121deg.C for 20min, and cooling to obtain the final product.
The Kodak yeast Kodamaea ohmeri HJM was inoculated in an inoculum size of 5% to 100mL of YPD liquid medium, culturing at 30deg.C and 160r/min for 24 hr to obtain bacterial liquid with concentration of 10 6 CFU/ml。
Preparation of Daqu medicine:
crushing wheat, adding water, mixing, inoculating the strain of multi-stage seed expansion culture with YPD liquid culture medium into the material according to 10% of inoculation amount, pressing to form, placing in a chamber, and airing to remove moisture. When the temperature of the curved blank is raised to 33 ℃, the door and window is opened, moisture is removed, the room temperature is reduced, the grass curtain is uncovered, the upper curved blank and the lower curved blank are turned over once, and when the temperature of the curved blank is lowered to 23 ℃, the door and window is closed. After airing and removing moisture, when the temperature of the yeast blank rises to 33 ℃ again, the yeast blank is turned over and ventilated irregularly, so that the yeast blank is subjected to heat preservation and fermentation for 10 days within the temperature range of 30-40 ℃, and finally the yeast is prepared into yeast by stacking, turning over and warehousing (the preparation of yeast is the prior art and is not repeated).
Preparation of multi-grain fermented grains under solid state fermentation conditions:
in order to study the degradation condition of the chrysotoxin by the chrysotoxin amateur Kodamaea ohmeri HJM, an experiment pit and a comparison pit are respectively selected for pit casting.
Experiment cellar: five grains of rice, sorghum, glutinous rice, corn and wheat are crushed according to the ratio of 0.5:6:1:0.5:1:1, and when the temperature of the grain lees is reduced to 23 ℃ after the steamer is discharged with water, adding the prepared Daqu medicine into the yeast powder, stirring uniformly, adding the Daqu powder with the weight of 15% of the total weight of the grain lees after entering a cellar for fermentation, and then entering the cellar for fermentation, discharging from the cellar, and distilling to obtain wine.
Comparison cellar: five grains of rice, sorghum, glutinous rice, corn and wheat are crushed according to the ratio of 0.5:6:1:0.5:1:1, and when the temperature of the grain lees is reduced to 23 ℃ after steaming and steaming, adding common strong aromatic Daqu medicine into yeast powder, stirring uniformly, adding Daqu powder with the weight of 15% of the total weight of the grain lees after fermentation, and then fermenting in a cellar, taking wine after fermentation in the cellar, and distilling.
The comparison pit and the pit-outlet fermented grains of the experimental pit under the solid state fermentation condition are subjected to determination of biogenic amine content, and specific results are shown in table 2, wherein degradation rate (%) = (comparison pit-experimental pit)/comparison pit multiplied by 100%.
TABLE 2 degradation rate of biogenic amine by Ormerkodak Yeast in Multi-grain fermented grains
As shown in Table 3, kodamaea ohmeri HJM bacteria has the best degradation effect on cyclopentylamine in fermented grains, which reaches 96.07%, and the content of other biogenic amine is obviously reduced, which indicates that Kodamaea ohmeri HJM bacteria has obvious degradation effect on biogenic amine generated in the fermentation process of white wine.
Example 3: degradation of HJM in pure sorghum fermented grains to biogenic amine
Preparing bacterial liquid:
same as in example 2
Preparation of Daqu medicine:
crushing wheat, adding water, mixing, inoculating 12% strain in YPD liquid culture medium, pressing, placing in a chamber, and air drying to remove moisture. When the temperature of the curved blank is raised to 35 ℃, the door and window is opened, moisture is removed, the room temperature is reduced, the grass curtain is uncovered, the upper curved blank and the lower curved blank are turned over once, and when the temperature of the curved blank is lowered to 25 ℃, the door and window is closed. After airing and removing moisture, when the temperature of the yeast blank rises to 35 ℃ again, the yeast is turned over and ventilated irregularly, so that the yeast blank is subjected to heat preservation and fermentation for 12 days at the temperature of 35-50 ℃, and finally the yeast is cultivated through the process steps of stacking, turning over and warehousing for storage to obtain the Daqu medicinal yeast. And warehousing and storing to obtain the Daqu medicinal starter.
Preparing sorghum fermented grains under solid state fermentation conditions:
experiment cellar: crushing sorghum, steaming and gelatinizing, adding prepared Daqu medicine into yeast powder when the temperature of the grain lees is reduced to 25 ℃ after taking out of a steamer and adding water, stirring uniformly, adding the yeast powder in an amount which is 30% of the total weight of the grain lees fermented in a cellar, then fermenting in the cellar, taking out of the cellar, and distilling to obtain wine.
Comparison cellar: crushing sorghum, steaming and gelatinizing, adding common strong-flavor Daqu medicine into yeast powder when the temperature of the grain lees is reduced to 25 ℃ after taking out of a steamer and adding water, stirring uniformly, adding the yeast powder in an amount which is 30% of the total weight of the grain lees fermented in a cellar, then fermenting in the cellar, taking out of the cellar, and distilling to obtain wine.
The degradation rate of biogenic amine in the sorghum fermented grains is measured by using the Kodak yeast HJM, and the specific results are as follows:
TABLE 4 degradation rate of the Kaoliang fermented grains by the Kodak Yeast on biogenic amine
As shown in Table 4, kodamaea ohmeri HJM bacteria also have obvious degradation effect on biogenic amine in the sorghum solid fermentation fermented grains.
While the invention has been described in detail with reference to specific embodiments thereof, it will be apparent to one skilled in the art that various changes in form and details can be made therein without departing from the scope of the invention encompassed by the appended claims.

Claims (8)

1. Kodak yeastKodamaea ohmeriHJM, it has been preserved in China center for type culture Collection (CCTCC NO: M2020297) with a preservation address of university of Wuhan, china, and 7 months 9.
2. Comprising the Kodak yeast of claim 1Kodamaea ohmeriHJM.
3. The microbial preparation according to claim 2, wherein the viable count of the Kyoto yeast HJM per gram or per milliliter of the preparation is not less than 1X 10 6 CFU。
4. The microbial preparation of claim 2, wherein the microbial preparation is a liquid microbial preparation or a solid microbial preparation.
5. The yeast of claim 1Kodamaea ohmeriHJM the use of biogenic amines produced during fermentation of white wine, such as methylamine, ethylamine, cyclopentylamine, putrescine, cyclohexylamine, cadaverine, cycloheptylamine, isovalerylamine and pyrrolidine.
6. Use of the yeast of claim 1Kodamaea ohmeriHJM the distiller's yeast for preparing Chinese liquor.
7. The yeast of claim 1Kodamaea ohmeriHJM the yeast strain of the genus KodakKodamaea ohmeriHJM is harmless bacteria selected from solid Chinese liquor Daqu, and the highest tolerance temperature is 43 ℃; the highest tolerated ethanol concentration was 14% and the highest tolerated pH was 2; the growth is good when the glucose concentration reaches 600 g/L.
8. The use according to claim 5, wherein the degradation rate is up to 96.07%.
CN202011477625.9A 2020-12-15 2020-12-15 Ormokodak yeast for degrading biogenic amine and application of same in white spirit brewing Active CN112442453B (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN202011477625.9A CN112442453B (en) 2020-12-15 2020-12-15 Ormokodak yeast for degrading biogenic amine and application of same in white spirit brewing

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN202011477625.9A CN112442453B (en) 2020-12-15 2020-12-15 Ormokodak yeast for degrading biogenic amine and application of same in white spirit brewing

Publications (2)

Publication Number Publication Date
CN112442453A CN112442453A (en) 2021-03-05
CN112442453B true CN112442453B (en) 2024-02-27

Family

ID=74739111

Family Applications (1)

Application Number Title Priority Date Filing Date
CN202011477625.9A Active CN112442453B (en) 2020-12-15 2020-12-15 Ormokodak yeast for degrading biogenic amine and application of same in white spirit brewing

Country Status (1)

Country Link
CN (1) CN112442453B (en)

Families Citing this family (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN113736673B (en) * 2021-09-15 2023-02-21 四川省农业科学院农产品加工研究所 Korotka yeast strain W5 for high yield of phenyllactic acid and application thereof

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN106036373A (en) * 2016-06-03 2016-10-26 浙江海洋大学 Method for degrading histamine in aquatic products
CN107821971A (en) * 2017-10-19 2018-03-23 云南云雾生物科技有限公司 A kind of thick chilli sauce processing technology based on microbial fermentation technology

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN106036373A (en) * 2016-06-03 2016-10-26 浙江海洋大学 Method for degrading histamine in aquatic products
CN107821971A (en) * 2017-10-19 2018-03-23 云南云雾生物科技有限公司 A kind of thick chilli sauce processing technology based on microbial fermentation technology

Non-Patent Citations (3)

* Cited by examiner, † Cited by third party
Title
1株奥默柯达酵母对鱼露中生物胺的降解特性;王挥;付湘晋;吴伟;吴跃;任佳丽;林亲录;李忠海;中国食品学报;第14卷(第8期);第137-141页 *
食品中生物胺的研究进展;王光强;俞剑;胡健;曹利瑞;夏永军;艾连中;;食品科学;第37期(第01期);第269-278页 *
鱼露中生物胺降解菌的筛选及其特性;杨利昆;付湘晋;胡叶碧;周其中;李滨;;食品科学(第11期);第158-162页 *

Also Published As

Publication number Publication date
CN112442453A (en) 2021-03-05

Similar Documents

Publication Publication Date Title
CN110862947B (en) Bacillus safensis, microbial agent, application and vinegar preparation method
CN108913628B (en) Bacillus solitarius and application thereof
CN110951631B (en) Hansenula polymorpha capable of producing geraniol and fermentation method thereof
CN111961615B (en) Saccharopolyspora capable of reducing biogenic amine and application thereof
CN111019860B (en) Pediococcus acidilactici for reducing biogenic amine and application thereof
CN111979146B (en) Saccharopolyspora and application thereof in food
CN109554265B (en) Sweet fermented-rice low-alcohol beverage and preparation method thereof
CN114107077B (en) Ester-producing yeast strain and application thereof
CN110760471B (en) Acetobacter pasteurianus, microbial agent and application thereof, and vinegar preparation method
CN111979148B (en) Saccharopolyspora composition and application thereof in food
CN111411061B (en) Screening of bacillus licheniformis and application of bacillus licheniformis in food production
CN110184227B (en) Lactobacillus acidophilus and application thereof
CN110408571B (en) Bacillus coagulans and application thereof
CN113249268B (en) Saccharopolyspora rosea for reducing biogenic amine and application thereof
CN111100825A (en) Bacillus and application thereof in industry
CN112442453B (en) Ormokodak yeast for degrading biogenic amine and application of same in white spirit brewing
CN114606152B (en) Bacillus bailii, microbial agent and application thereof
CN112322509B (en) Candida parapsilosis with low temperature resistance and high alcohol yield, and composition and application thereof
CN112094769A (en) Acetobacter pasteurianus subspecies, microbial agent and application thereof
CN108485994B (en) Preparation method and application of compound milk beer freeze-dried fermentation microbial inoculum
CN112715890B (en) Immobilized pickle starter and application thereof
CN113943665B (en) Two strains of wild yeast for degrading biogenic amine and application of two strains of wild yeast in fruit wine brewing
CN113832048B (en) Bacillus amyloliquefaciens for inhibiting soy sauce from forming white film and application thereof
CN109401998B (en) Lactobacillus mindendori for degrading biogenic amine and application thereof
CN113265363B (en) Saccharopolyspora cholerae for reducing biogenic amine and application thereof

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
GR01 Patent grant
GR01 Patent grant