CN111485025A - Method for directionally identifying traditional Chinese medicine counterfeit products in Chinese patent medicines - Google Patents

Abstract

The invention discloses a method for directionally identifying Chinese medicinal positive and false products in Chinese patent medicines, which adopts PCR universal primers, adopts Seqman software to splice sequencing result peak graphs by adopting PCR combined with Sanger sequencing technology, searches spliced DNA sequences in NCBI by using B L AST similarity, and simultaneously compares the DNA sequences with a variety with higher similarity search score to realize the authenticity identification of biological components, thereby realizing the identification of various positive and false products of any Chinese medicinal component contained in the Chinese patent medicines.

Description

Method for directionally identifying traditional Chinese medicine counterfeit products in Chinese patent medicines

Technical Field

The invention belongs to a method for directionally identifying traditional Chinese medicine genuineness products in Chinese patent medicines, and particularly relates to a method for identifying traditional Chinese medicine species by sequencing an amplification product after amplifying DNA of a Chinese patent medicine by a PCR (polymerase chain reaction) method.

Background

The Chinese patent medicine is prepared into a Chinese medicinal product with a certain dosage form according to a specified prescription and a preparation process under the guidance of the theory of traditional Chinese medicine and in order to prevent and treat diseases. Along with the increasing demand of Chinese patent medicines, the adulteration of Chinese herbal medicines is frequent. The adulteration of the traditional Chinese medicinal materials not only affects the clinical curative effect of the Chinese patent medicine and damages the healthy development of the Chinese medicine, but also most importantly, the adulterated counterfeit medicinal materials affect the efficacy of the Chinese patent medicine and even possibly harm the health. Therefore, the identification of the genuine, fake and substitute products of each component medicinal material of the Chinese patent medicine is the precondition for ensuring the quality of the Chinese patent medicine.

Because the Chinese patent medicine is prepared by processing a plurality of Chinese medicines through a plurality of processes, the original properties are disappeared, and the medicinal material components contained in the Chinese patent medicine are complex, the authenticity of the Chinese medicinal components in the Chinese patent medicine cannot be identified through a property identification method. The quality of the Chinese patent medicine is controlled by selecting the identification of a plurality of limited chemical components, which provides a large space for the counterfeiting of the Chinese patent medicine, in particular to expensive and famous medicinal materials. At present, with the development of molecular biology technology, molecular biology identification methods gradually become the main means for identifying the authenticity of traditional Chinese medicinal materials, wherein the DNA barcode technology is the most common. The DNA barcode technology is a novel molecular diagnostic technology for species identification by using a standard DNA fragment which is enough variable, easy to amplify and relatively short to represent the species in an organism. The Chinese pharmacopoeia has collected the identification of positive and negative counterfeit drugs such as zaocys dhumnade, bungarus parvus and agkistrodon by PCR method. However, because the Chinese patent medicine is processed by various processes, the DNA fragments of the components of the Chinese patent medicine are low in content, and the identification of the positive and false products of the corresponding Chinese medicine in the Chinese patent medicine is difficult to realize by the methods.

Disclosure of Invention

The invention aims to provide a PCR method combined with a Sanger sequencing technology for directionally identifying traditional Chinese medicine counterfeit products in Chinese patent medicines. The invention adopts a new PCR method to amplify Chinese patent medicine DNA, then carries out sequencing on the PCR amplification product, and identifies the truth of the Chinese medicine by comparing the sequencing result in an NCBI database. By adopting the invention, the identification of the genuine and counterfeit leeches in the rhubarb 17898.

The invention adopts the following technical scheme:

the method for directionally identifying the traditional Chinese medicine counterfeit in the Chinese patent medicine comprises the following steps: extracting DNA of the Chinese patent medicine as a template, carrying out two rounds of PCR amplification, and then sequencing the PCR reaction solution; and performing sequence splicing on the sequencing peak images, and then comparing in an NCBI database to finish the identification of the traditional Chinese medicine counterfeit products in the Chinese patent medicines.

In the technical scheme, the Chinese patent medicine is ground in water and then centrifuged, precipitates are washed by sterile water and then DNA is extracted by a DNA extraction kit, the extraction of the Chinese patent medicine DNA is completed, in two rounds of PCR amplification, a primer for the first round of PCR amplification is a COI universal primer, a primer for the second round of PCR amplification is a traditional Chinese medicine specific universal primer in the Chinese patent medicine, the first round of PCR amplification is a 25 mu L reaction system, and the second round of PCR amplification is a 25 mu L reaction system.

Preferably, the Chinese patent medicine is rhubarb 17898; rhubarb 17898is a prescription drug prepared by mixing prepared rhubarb, ground beetle, leech, gadfly, grub (fried), dried lacquer, peach kernel, bitter apricot kernel, baical skullcap root, rehmannia root, white paeony root and liquoric root according to a certain dosage, and the medicinal leech recorded in Chinese pharmacopoeia (2015 edition) only comprises Whitmaniapigra, leech willow (Whitmania acranulata) and Japanese leech (Hirudo nipponia). In recent years, with the continuous development of leech Chinese medicinal preparations, leeches become one of popular Chinese medicinal materials. Along with the circulation of leech counterfeit products such as poecilobdella manillensis, leech and the like in the market, a rapid, simple, convenient and universal method is urgently needed to be established for identifying the authenticity of leeches, enhancing the quality control of Chinese patent medicines of rhubarb 17898. The conventional method for identifying the leech mainly depends on character identification, but the leech in the Chinese patent medicine of Dahuang 17898 cannot be identified through the character after being processed for many times, and the Chinese patent medicine of Dahuang 17898 is processed, so that DNA fragments are fragmented, the leech content is low, meanwhile, the Chinese patent medicine of Dahuang 17898 contains four animal medicinal materials which can be amplified into target fragments by universal primers, and the conventional DNA bar code technology cannot realize the directional identification of the components of the Dahuang 17898.

In the technical scheme, in two rounds of PCR amplification, primers for the first round of PCR amplification are L C01490 and L C02198, and primers for the second round of PCR amplification are COI924F and COI924R, wherein the primers have a decisive influence on the amplification result, the invention creatively designs a common leech primer for the second round of amplification, can successfully identify 5 leeches such as whitmania pigra, poecilobdella manillensis, whitmania pigra, hirudo and Japanese medicinal leech, and can be used for identifying the genuine and fake products of leeches in the Chinese patent medicine named Dahuang 17898.

In the technical scheme, the first round of PCR amplification is a 25 mu L reaction system, preferably a template 1 mu L with the concentration of 10-50 ng/mu L, the second round of PCR amplification is a 25 mu L reaction system, preferably a first round of PCR reaction solution is 1 mu L, the first round of PCR amplification is performed by 94 ℃ pre-denaturation for 5 min, 94 ℃ denaturation for 1min, 45 ℃ annealing for 1min 30s, 72 ℃ extension for 1min 30s, circulation for 5 times, 94 ℃ denaturation for 1min, 50 ℃ annealing for 1min 30s, 72 ℃ extension for 1min, circulation for 40 times, finally 72 ℃ extension for 5 min, and the second round of PCR amplification is performed by 94 ℃ pre-denaturation for 5 min, 94 ℃ denaturation for 1min, 45 ℃ annealing for 1min 30s, 72 ℃ extension for 1min 30s, circulation for 5 times, 94 ℃ denaturation for 1min, 50 ℃ annealing for 1min, 72 ℃ extension for 1min, circulation for 40 times, and finally 72 ℃ extension for 5 min.

The primer sequences related to the method of the invention are as follows:

the invention relates to a method for directionally identifying traditional Chinese medicine counterfeit products in Chinese patent medicines, which comprises the following steps of extracting DNA of the Chinese patent medicines as a template, carrying out two-round PCR amplification, sequencing a PCR reaction solution, splicing a sequencing peak diagram, and comparing in an NCBI (national center of health) database to finish the detection of the traditional Chinese medicines in the Chinese patent medicines and the identification of the counterfeit products, wherein the disclosed PCR technology can effectively amplify a leech DNA sequence in a rhubarb 17898worm pill, is simple, convenient, rapid and sensitive to operate, and simultaneously combines with a Sanger sequencing technology to sequence an amplification product, and compares a sequencing result with B L AST in the NCBI database to effectively identify the authenticity of leech in the rhubarb 17898worm pill.

Drawings

FIG. 1 shows the result of agarose gel electrophoresis of genomic DNA of rhubarb \17898;

FIG. 2 shows the result of agarose gel electrophoresis of the first round PCR product;

FIG. 3 shows the result of PCR amplification of 14 copies of rhubarb 17898;

FIG. 4 shows the amplification results of 9 dry drugs by PCR according to the present invention;

FIG. 5 shows the result of PCR amplification on 7 parts of dried leech.

Detailed Description

The method for directionally identifying the traditional Chinese medicine counterfeit products in the Chinese patent medicines comprises the following steps: extracting DNA of the Chinese patent medicine as a template, carrying out two rounds of PCR amplification, and then sequencing the PCR reaction solution; and performing sequence splicing on the sequencing peak images, and then comparing in an NCBI database to finish the detection of the traditional Chinese medicines in the Chinese patent medicines and the identification of positive and false products. The method is characterized in that the method for identifying the leech in the Chinese rhubarb 17898 pellet and identifying the true and false product is as follows: extracting DNA of rhubarb 17898 as a template, performing two rounds of PCR amplification, and sequencing the PCR reaction solution; and then, the sequencing peak images are subjected to sequence splicing and then are compared in an NCBI database, so that the detection of leeches in the rhubarb 17898 and the identification of positive and false products are completed.

In the steps, firstly, sterile deionized water is used for soaking the finished rhubarb pill in a 1.5ml centrifugal tube for softening, and then a tissue grinder is used for crushing the finished medicine. Centrifuging the finished medicine solution (the precipitate is about 0.1ml in a 1.5ml centrifuge tube after centrifugation), washing with sterile deionized water, extracting DNA by using a column type deep processing product genome DNA extraction kit (B518264-0050), and digesting with digestive enzyme for 2 h.

In the steps, firstly, L C01490 and L C02198 are used for carrying out a first round of PCR amplification reaction on the DNA of the finished rhubarb pill preparation on a (Hangzhou Langzhou A300) PCR instrument, wherein the reaction system 25 mu L comprises 1 mu L of 10 mu M of each of the 2 × Taq master mix 12.5 mu L gene universal primers, 1 mu L of the DNA template of the finished rhubarb pill preparation (10-50 ng/mu L), and sterile deionized water is supplemented to 25 mu L, the amplification reaction program comprises pre-denaturation at 94 ℃ for 5 min, denaturation at 94 ℃ for 1min, annealing at 45 ℃ for 1min 30s, extension at 72 ℃ for 1min for 30s, circulation for 5 times, denaturation at 94 ℃ for 1min, annealing at 50 ℃ for 1min for 30s, extension at 72 ℃ for 1min, circulation for 40 times, and finally, a negative control which is not added with the template is set in the experiment at the same time of the extension at 72 ℃ for 5 min.

Then, a second round of PCR is carried out on the first round of PCR amplification products by adopting a self-designed common primer which can identify whitmania pigra, hirudo nipponica, hirudo manillensis and hirudo poecilobii, namely COI924, a reaction system 25 mu L comprises 2 × Taqmaster Mix 12.5 mu L924 upstream and downstream primers 10 mu M each 1 mu L, a first round of PCR reaction solution 1 mu L and sterile deionized water which is supplemented to 25 mu L, the amplification reaction program is pre-denatured at 94 ℃ for 5 min, denatured at 94 ℃ for 1min, annealed at 45 ℃ for 30s, extended at 72 ℃ for 1min for 30s, cycled for 5 times, denatured at 94 ℃ for 1min, annealed at 50 ℃ for 1min for 30s, extended at 72 ℃ for 1min, cycled for 40 min, finally extended at 72 ℃ for 5 min, a negative control without adding a template is simultaneously set in an experiment, the PCR products are analyzed by 2% agarose gel electrophoresis, gel electrophoresis is carried out under the conditions of 120v and 200mA, gel electrophoresis is carried out under the conditions of focusing, the size is adjusted by a focusing system, and the gel is scanned by a zoom light source, and is carried out by a camera at about 400 bp.

In the step of PCR reaction sequencing, the second round of PCR amplification products are sent to be subjected to gold witness sequencing, forward and reverse primers are adopted for forward and reverse sequencing, sequence splicing is carried out on a sequencing peak diagram by seqman software, then comparison is carried out in an NCBI database, meanwhile, comparison of individual COI sequences is carried out on leech varieties with high similarity search scores, and leech varieties are judged, and the conventional technology is adopted.

9 parts of dried leech medicinal materials used in the experiment are all from the drug inspection and detection center in Suzhou city, 14 parts of Chinese patent drug rhubarb 17898 are also collected and provided by the drug inspection and detection center in Suzhou city, and related reagents are the existing products except primers; the amplification reaction was performed on a (Hangzhou Langzhou A300) PCR instrument.

Example one PCR amplification of rhubarb 17898

1. Firstly, respectively soaking 14 parts of rhubarb \17898finishedinsect pills in 1.5ml of a centrifugal tube by using sterile deionized water for softening, then crushing the finished insect pills by using a tissue crushing instrument, centrifuging the finished insect pills, precipitating the precipitates at the position of 0.1ml of the centrifugal tube of 1.5ml after centrifugation, washing the precipitates twice by using sterile deionized water, and extracting DNA by using a raw column type deep processing product genome DNA extraction kit (Suzhou Pridel Biotechnology Co., Ltd., B518264-0050), wherein the DNA of the rhubarb \17898isobtained after digestive enzyme digestion for 2 hours. Because the Chinese patent medicine is processed by various processes, DNA of the components is fragmented, DNA fragments extracted by rhubarb \17898are concentrated below 450bp, as shown in figure 1, lanes 1-6 are the results of electrophoresis of 6 parts of genome DNA of rhubarb \17898 (YP 0295, YP0163, YP0253, YP0284, YP0226 and YP 0194), and lane M is a marker of 1000 bp.

2. The extracted Dahuang 17898 pill DNA is respectively used as a template, the Dahuang 17898 pill finished medicine DNA is subjected to first round PCR by primers L C01490 and L C02198, a reaction system 25 mu L comprises 1 mu L of 2 × Taq master Mix 12.5 mu L gene universal primers 10 mu M, 1 mu L of Dahuang 17898 pill finished medicine DNA template (diluted to 50 ng/mu L) 1 mu L, sterile deionized water is supplemented to 25 mu L, an amplification reaction program is 94 ℃ pre-denatured 5 min, 94 ℃ denatured 1min, 45 ℃ annealed 1min 30s, 72 ℃ extended 1min 30s, 5 times of circulation, 94 ℃ denatured 1min, 50 ℃ annealed 1min 30s, 72 ℃ extended 1min, 40 times of circulation, finally 72 ℃ extended 5 min, a first round PCR product is obtained, a negative control without adding a template is set in an experiment, the YP 898 min is adopted for annealing at 50 ℃, the medium YP 30s, 72 ℃ extended 1min is subjected to a PCR, a PCR product is subjected to a PCR under a common YP 896-8 nm gel electrophoresis condition, and a PCR amplification reaction is carried out, and a PCR is carried out on a PCR under a PCR reaction system, wherein, a PCR is carried out on a PCR (a PCR) under about 10 bp, a PCR) under a PCR, a PCR product is obtained by a PCR, a PCR reaction system, a PCR is marked by taking a PCR, a PCR (no YP) under a PCR) under about 10, a PCR-8 shows that a PCR amplification system, a PCR-18 shows that a PCR, a PCR is carried out, a PCR-18, a PCR is carried out under a PCR, a PCR is carried out, a PCR-8, a PCR (a PCR is carried out under a PCR, a PCR is obviously, a PCR is carried out under a PCR, a PCR product, a PCR is carried out under.

Sucking 1 mu L first round PCR product (14 parts) as a template, respectively, taking COI924F and COI924R as upstream and downstream primers to carry out second round amplification, taking 2 × Taq master Mix 12.5 mu L924 primer upstream and downstream primers 10 mu L respectively, taking 1 mu L as a second round PCR system 25 mu L, and supplementing sterile deionized water to 25 mu L. the PCR reaction program comprises pre-denaturation at 94 ℃ for 5 min, denaturation at 94 ℃ for 1min, annealing at 45 ℃ for 1min 30s, extension at 72 ℃ for 1min 30s, circulation for 5 times, denaturation at 94 ℃ for 1min, annealing at 50 ℃ for 1min 30s, extension at 72 ℃ for 1min, circulation for 40 times, final extension at 72 ℃ for 5 min, analyzing the PCR product by using 2% agarose gel electrophoresis, carrying out gel electrophoresis for 30min under 120v and 200mA, then placing the gel under a300 nm light source of a gel imaging system, carrying out focusing and scanning, and analyzing the product as a zoom scanning, wherein the result is a common electrophoresis lane, and the result is a result of a PCR product obtained by using a conventional technology, and the general electrophoresis lane 14 bp detection method is shown in a control, wherein the PCR product, and the result is that the positive control of a yellow 14 bp, and the PCR product is obtained by adding a sample represented by a yellow region indicated by adding a standard PCR detection method, wherein the general PCR detection method, and.

3. The second round of PCR products are subjected to forward and reverse sequencing by Jinweizhi company, Suzhou, and a peak diagram is subjected to sequence splicing by seqman software, the spliced DNA sequence is searched in an NCBI database by using B L AST similarity, and simultaneously, the single COI sequence is compared with a variety with higher similarity search score, and sequencing results are shown in a nucleotide and amino acid sequence table of the specification:

the sequences 5 to 10 are YP0295, YP0163, YP0252, YP0193, YP0253 and YP0239 respectively;

the sequences 11 to 16 are YP0284, YP0279, YP0142, YP0226, YP0049 and YP 0194;

sequence 17 YP0157 and sequence 18 YP 0202.

The sequencing comparison result is shown in a table 1, and 5 parts of 14 parts of rhubarb 17898 in total are detected to contain fake leeches including poecilobdella manillensis and whitmania pigra.

Table 1. rheum officinale 17898

EXAMPLE two PCR amplification of dried leech drug DNA

1. Crushing 9 parts of dried leech medicinal materials (B, C, I, O, U, W, X, VYZ2 and VYZ 1) into powder by using a Tiangen tissue crusher, respectively, taking about 0.1 g of the powder, and extracting total DNA of the dried leech medicinal materials by using a blood/cell/tissue genome DNA extraction kit (Suzhou Pridel Biotechnology Co., Ltd.), wherein the digestion is carried out by digestive enzyme for 2 hours to obtain 9 parts of dried leech medicinal material DNA.

2. Respectively taking the total DNA of the dried leech medicinal materials extracted as templates, and carrying out first round PCR by using primers L C01490 and L C02198, wherein a reaction system 25 mu L comprises 2 × Taq master Mix 12.5 mu L gene universal primers 10 mu M each 1 mu L, a dried leech medicinal material DNA template (diluted to 50 ng/mu L) 1 mu L, and sterile deionized water supplemented to 25 mu L, wherein the amplification reaction procedure comprises the steps of pre-denaturation at 94 ℃ for 5 min, denaturation at 94 ℃ for 1min, annealing at 45 ℃ for 1min 30s, extension at 72 ℃ for 1min 30s, circulation for 5 times, denaturation at 94 ℃ for 1min, annealing at 50 ℃ for 1min, extension at 72 ℃ for 1min, circulation for 40 times, and extension at 72 ℃ for 5 min to obtain a first round PCR product, and the size of the product is about 650 bp;

the first round of PCR products (9 parts) of 1 mu L are respectively taken as templates, the second round of amplification is carried out by taking COI924F and COI924R as upstream and downstream primers, the second round of PCR system 25 mu L is that 2 × Taq master Mix 12.5 mu L924 primers and upstream and downstream primers are respectively 1 mu L at 10 mu M, the first round of PCR products 1 mu L are supplemented to 25 mu L by sterile deionized water, the PCR reaction procedures are that 94 ℃ is used for pre-denaturation for 5 min, 94 ℃ is used for denaturation for 1min, 45 ℃ is used for annealing for 1min 30s, 72 ℃ is used for extension for 1min, the cycle is carried out for 5 times, 94 ℃ is used for denaturation for 1min, 50 ℃ is used for annealing for 1min for 30s, 72 ℃ is used for extension for 40 times, finally 72 ℃ is used for extension for 5 min, the PCR products are analyzed by 2% agarose gel electrophoresis under the conditions of 120v and 200mA, then the gel is subjected to gel electrophoresis under the light source of 300nm of an imaging system, the conditions of sequencing, focusing and scanning and the amplification is specifically scanned and analyzed by a zoom technology, the conventional electrophoresis, the PCR products show that the result shows that the result of the corresponding to the PCR product, the corresponding to.

TABLE 2 comparison of COI Universal primers with the results of PCR for dried leech drug identification

The 9 dried leech medicinal materials adopted in the experiment are subjected to character identification by professional personnel of medical examination, and five leeches including whitmania pigra, hirudo nipponica, poecilobdella manillensis, hirudo manillensis and hirudo nipponica are subjected to PCR amplification and sequencing verification through COI universal primers (primers L C01490 and L C02198). after the 9 dried medicinal materials are amplified and sequenced through PCR by adopting the COI924 specific universal primers designed by the invention, compared with the identification result of leeches by the traditional DNA bar code technology based on mitochondrial COI sequences, the identification results of the two methods are consistent (Table 2), and therefore, the COI924 specific universal primers can be used for identifying the positive and false leeches in the 'Dahuang 17898pill'.

The results of the amplification sequences of the COI universal primers are shown in the nucleotide and amino acid sequence table of the specification:

the sequences 19-27 are respectively whitmania pigra 1B, whitmania manillensis 2W, 3X, whitmania pigra 4C, 5U, 6O, 7I, whitmania clavata 8VYZ2 and hirudo nipponica 9 VYZ 1.

The PCR method of the invention shows the amplification sequencing result of dried leech medicine materials in the nucleotide and amino acid sequence table of the specification:

sequences 28 to 36 are respectively: 1B of whitmania pigra, 2W and 3X of poecilobdella manillensis, 4C, 5U, 6O and 7I of whitmania pigra, 8VYZ2 of potmania pigra and 9 VYZ1 of hirudo nipponica.

Comparative example 1

1. Crushing 7 parts of dried leech medicinal materials (B, C, I, U, W, X, VYZ2, shown in table 2) into powder by using a Tiangen tissue crusher, taking about 0.1 g of the powder respectively, and extracting total DNA of the dried leech medicinal materials by using a blood/cell/tissue genome DNA extraction kit (Suzhou prader Biotechnology, Ltd.), wherein the digestion is carried out for 2h by using digestive enzyme to obtain 7 parts of dried leech medicinal material DNA.

2. Respectively taking the total DNA of the dried leech medicinal materials extracted as templates, and carrying out first round PCR by using primers L C01490 and L C02198, wherein a reaction system 25 mu L comprises 2 × Taq master Mix 12.5 mu L gene universal primers 10 mu M each 1 mu L, a dried leech medicinal material DNA template (diluted to 50 ng/mu L) 1 mu L, and sterile deionized water supplemented to 25 mu L, wherein the amplification reaction procedure comprises the steps of pre-denaturation at 94 ℃ for 5 min, denaturation at 94 ℃ for 1min, annealing at 45 ℃ for 1min 30s, extension at 72 ℃ for 1min 30s, circulation for 5 times, denaturation at 94 ℃ for 1min, annealing at 50 ℃ for 1min, extension at 72 ℃ for 1min, circulation for 40 times, and extension at 72 ℃ for 5 min to obtain a first round PCR product, and the size of the product is about 650 bp;

3. sucking 1 mu L of the first round PCR product (7 parts) as a template, respectively, and taking COIAF (AGATGAGGCACCAGCTATATGT) and COIAR (ACGTGATCAGCTATGTTAGGCT) as upstream and downstream primers to carry out second round amplification, wherein the amplification reaction program comprises pre-denaturation at 94 ℃ for 5 min, denaturation at 94 ℃ for 1min, annealing at 45 ℃ for 1min 30s, extension at 72 ℃ for 1min 30s, circulation for 5 times, denaturation at 94 ℃ for 1min, annealing at 50 ℃ for 1min 30s, extension at 72 ℃ for 1min, circulation for 40 times, and extension at 72 ℃ for 5 min to finish the second round PCR.

Analyzing the PCR product by 2% agarose gel electrophoresis, and performing gel electrophoresis for 30min under the conditions of 120v and 200 mA; then, the gel is scanned and analyzed by adjusting zooming, focusing and aperture under a300 nm light source of a gel imaging system, specifically, the detection result is shown in fig. 5 (dried leech medicinal materials corresponding to lanes 1-7 are B, C, I, U, W, X, VYZ2 in sequence) by agarose gel electrophoresis in the conventional technology, and the sequencing result is shown in a nucleotide and amino acid sequence table of the specification:

sequences 39 to 42 are respectively: c (actually, the hirudo broadloom whitmania primer is subjected to PCR sequencing, I (actually, the hirudo broadloom whitmania primer is subjected to PCR sequencing), U (actually, the hirudo broadloom whitmania primer is subjected to PCR sequencing, the Poecilobdella manillensis is subjected to PCR sequencing), and W (actually, the Poecilobdella manillensis is subjected to PCR sequencing, and the Poecilobdella broadloom whitmania primer is subjected to PCR sequencing).

When the primers used in the two PCR rounds are the COIA primers, although the dried leech medicinal materials can amplify target bands (about 400 bp), the sequencing result of partial amplification products is inconsistent with the result of the actual sample variety. If C and I are actually the leeches, the erroneous result of PCR sequencing of the COIA primer is identified as the whitmania pigra; u is actually the leech, and the Poecilobdella manillensis is identified by the false PCR sequencing result of the COAA primer; w is actually poecilobdella manillensis, and the COIA primer is wrongly identified as whitmania pigra. The two rounds of primers are shown to have a decisive influence on the detection results.

Comparative example No. two

1. Firstly, respectively soaking 14 parts of rhubarb \17898ina 1.5ml centrifugal tube by using sterile deionized water, then crushing the finished product by using a tissue crusher, centrifuging the finished product solution, precipitating the precipitate at the position of 0.1ml of the centrifugal tube after centrifugation, washing the precipitate twice by using sterile deionized water, and extracting DNA by using a column type deep processing product genome DNA extraction kit (Suzhou Pridel Biotechnology Co., Ltd., B518264-0050), wherein digestive enzyme is digested for 2 hours to obtain rhubarb 17898.

2. Respectively carrying out a first round of PCR on the extracted rhubarb 17898 pill DNA by using primers L C01490 and L C02198, carrying out a first round of PCR on the rhubarb 17898 pill finished medicine DNA by using primers L C01490 and L C02198, wherein a reaction system 25 mu L Taq master Mix 12.5 mu L, a COI gene universal primer upstream and downstream primer 10 mu M each 1 mu L, and the rhubarb 17898 pill finished medicine DNA template (diluted to 50 ng/mu L) 1 mu L, and sterile deionized water is supplemented to 25 mu L. the amplification reaction procedure is 94 ℃ pre-denaturation 5 min, 94 ℃ denaturation 1min, 45 ℃ annealing 1min 30s, 72 ℃ extension 1min 30s, 5 times of cycle, 94 ℃ denaturation 1min, 50 ℃ annealing 1min 30s, 72 ℃ extension 1min, cycle 40 times of cycle, and finally 72 ℃ extension 5 min, obtaining a first round of PCR product, absorbing the first round of PCR product, absorbing 1min, carrying out a first round of PCR, carrying out a second round of PCR amplification by using a conventional electrophoresis under conditions of a 10 ℃ agarose gel electrophoresis, carrying out a conventional electrophoresis under a 10 mu 94 ℃ electrophoresis, a 10 min, a PCR under a 10 min, a PCR under a conventional condition of a 10 ℃ denaturation 5 min, a 10 min, a temperature of a PCR, a temperature of a PCR, a PCR amplification reaction system, a temperature of a 10 mu extension 5 min, a temperature of a 5 min, a temperature of a PCR, a temperature.

The primer sequences involved in the above examples and comparative methods are as follows:

the PCR method identifies the leech variety by Sanger sequencing of an amplification product, and compares a sequencing result in an NCBI database to determine the leech variety, and in order to ensure identification accuracy, the PCR method establishes 5 kinds of leech COI databases through PCR amplification and sequencing results of 9 kinds of dry medicinal material COI universal primers for sequence comparison of identification results of Chinese patent medicines in the research.

In addition, the method for identifying the authenticity of leeches by measuring the activity of leech antithrombin enzyme specified in Chinese pharmacopoeia can be still applicable to the identification of dried leech medicinal materials, but for the 14 processed Chinese patent medicines, the result shows that the thrombin activity of the genuine products of whitmania pigra is 2.8-39.1/U, and the thrombin activity of the counterfeit products of poecilobdella manillensis and whitmania pigra is 2.9-27.8/U, so the method of the pharmacopoeia cannot realize the identification of the genuine and counterfeit leeches in the Chinese patent medicines. The invention also discloses a method for effectively identifying the leech true and false products in the Chinese patent medicine for the first time, and fills the blank in the field of the prior art.

Therefore, the present invention establishes a new PCR method aiming at improving the sensitivity and specificity of PCR detection. The first round PCR primer of PCR is a COI universal primer, the primer can at least amplify COI sequences corresponding to four animal drugs of ground beetle, leech, Tabanus and grub, and the sizes of amplified fragments are basically consistent; in order to pertinently identify the genuine products of the species of the leech in the rhubarb 17898, the primers used in the second round of PCR amplification are creatively designed, leech components in the rhubarb 17898 can be amplified in the amplification product of the COI primers, fourteen rhubarb 17898 samples can be detected, and finally, the amplification products are analyzed by combining a sequencing technology, so that the identification of 2 genuine products and 3 most common counterfeit products of the leech which is the animal medicine in the traditional Chinese medicine rhubarb 17898 is realized.

Sequence listing

<110> Suzhou Prorem Biotechnology Ltd

<120> method for directionally identifying traditional Chinese medicine counterfeit products in Chinese patent medicines

<160>42

<170>SIPOSequenceListing 1.0

<210>1

<211>25

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>1

ggtcaacaaa tcataaagat attgg 25

<210>2

<211>26

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>2

taaacttcag ggtgaccaaa aaatca 26

<210>3

<211>20

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>3

gctaaaactg gtaatgataa 20

<210>4

<211>19

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>4

taattggtgg gtttggtaa 19

<210>5

<211>391

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>5

ttaattggtg gggtttggta attgactttt accattaata attggtgccc cagatatagc 60

ttttcctcga ttaaataatt ttaggttttg attacttcca ccatcattaa ctatattggt 120

aagatcatca atagttgaaa atggtgttgg tacaggatga actatttatc cgccattagc 180

tgatagcatt tctcattcag ggccatgtgt agatatagct attttttcat tacatatagc 240

tggtgcatct tctattttag gttctttaaa ttttatttct actattgtta atatacgaac 300

taagggaata ggaaatgaac gagttccatt atttgtttga tctgtagtaa ttactactat 360

tttattatta ttatcattac crgttttagc a 391

<210>6

<211>380

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>6

taattggtgg ggtttggtaa ttgactccta ccattaatgg taggggccgt agatatatcg 60

tttcctcgtc tgaataactt aagattttgg ttactacccc cttcaataat catattgctt 120

aggtcatcct taattgaggg tggtgtaggt gcagggtgaa ccctttatcc tccactatca 180

gactccgtat ctcattcagg cccatccgtt gacatagcca tcttttcatt acatatagct 240

ggtgcctcat ctattttagg gtcattaaat tttatttcga ctattataaa tatacgaact 300

aaaggaataa caactgaacg agtaccatta tttgtttggt cagttgttat tactactatt 360

ttattattgt tatcattacc 380

<210>7

<211>390

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>7

ttaattggtg gggtttggta attgactcct accattaatg gtaggggccg tagatatatc 60

gtttcctcgt ctgaataact taagattttg gttactaccc ccttcaataa tcatattgct 120

taggtcatcc ttaattgagg gtggtgtagg tgcagggtga accctttatc ctccactatc 180

agactccgta tctcattcag gcccatccgt tgacatagcc atcttttcat tacatatagc 240

tggtgcctca tctattttag ggtcattaaa ttttatttcg actattataa atatacgaac 300

taaaggaata acaactgaac gagtaccatt atttgtttgg tcagttgtta ttactactat 360

tttattattg ttatcattac agttttagca 390

<210>8

<211>391

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>8

ttaattggtg ggtttggtaa ttgactccta ccattaatgg taggggccst agatatatcg 60

tttctcgatc tgaataactt aagattttga gttactaccc ccttcaataa tcatattgct 120

taggtcatcc ttaattgagg gtggtgtagg tgcagggtga accctttatc ctccactatc 180

agactccgta tctcattcag gcccatccgt tgacatagcy atcttttcat tacatatagc 240

tggtgcctca tctattttag ggtcattaaa ttttatttck actattataa atatacgaac 300

taaaggaata acaactgaac gagtaccatt atttgtttgg tcagttgtta ttactactat 360

tttattattg ttatcattac aggttttagc a 391

<210>9

<211>391

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>9

ttaattggtg gggtttggta attgactcyt accattaatg gtaggggccg tagatatatc 60

gtttcctcgt atgaataact taagattttg gttactaccc ccttcaataa tcatattggt 120

taggtcatcc ttaattgaaa awggtgtagg ggcagggtga aaccytttat cctccmwtat 180

cagactccrt atctcattca ggcccatscg ttgacatagc yatcttttca ttacatatag 240

ctggtgcctc atctatttta gggtcattaa attttatttc kactattrta aatatacgaa 300

ctaaaggaat aacaamtgaa cgagtaccat tatttgtttg rtcagttgtt attactacta 360

ttttattatt gttatcatta cagttttagc a 391

<210>10

<211>390

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>10

ttaattggtg ggtttggtaa ttgactttta ccattaataa ttggtgcccc agatatagct 60

tttcctcgat taaataattt taggttttga ttacttccac catcattaac tatattggta 120

agatcatcaa tagttgaaaa tggtgttggt acaggatgaa ctatttatcc gccattagct 180

gatagcattt ctcattcagg gccatgtgta gatatagcta ttttttcatt acatatagct 240

ggtgcatctt ctattttagg ttctttaaat tttatttcta ctattgttaa tatacgaact 300

aagggaatag gaaatgaacg agttccatta tttgtttgat ctgtagtaat tactactatt 360

ttattattat tatcattacc agttttagca 390

<210>11

<211>389

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>11

taattggtgg gtttggtaat tgactcctac cattaatggt aggggccgta gatatatcgt 60

ttcctcgtct gaataactta agattttggt tactaccccc ttcaataatc atattgctta 120

ggtcatcctt aattgagggt ggtgtaggtg cagggtgaac cctttatcct ccactatcag 180

actccgtatc tcattcaggc ccatccgttg acatagccat cttttcatta catatagctg 240

gtgcctcatc tattttaggg tcattaaatt ttatttckac tattataaat atacgaacta 300

aaggaataac aactgaacga gtaccattat ttgtttggtc agttgttatt actactattt 360

tattattgtt atcattacca gttttagca 389

<210>12

<211>378

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>12

ttaattggtg ggtttggtaa ttgactccta ccattaatgg taggggccgt agatatatcg 60

tttcctcgtc tgaataactt aagattttgg ttactacccc cttcaataat catattgctt 120

aggtcatcct taattgaggg tggtgtaggt gcagggtgaa ccctttatcc tccactatca 180

gactccgtat ctcattcagg cccatccgtt gacatagcca tcttttcatt acatatagct 240

ggtgcctcat ctattttagg gtcattaaat tttatttcga ctattataaa tatacgaact 300

aaaggaataa caactgaacg agtaccatta tttgtttggt cagttgttat tactactatt 360

ttattattgt tatcatta 378

<210>13

<211>392

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>13

ttaattggtg ggtttggtaa ttgactcctg ccattaatgg taggagccgt agatatatca 60

tttcctcgat ctgaataatt taagattttg gttactaccc ccttcaataa tcatattgct 120

takgtcatct ttaattgagg gtggtgtagg tgcagggtga accctttatc ccccactatc 180

akactccgta tctcattcag gmccatccgt tgacatagcc atcttctcat tacatatagc 240

tggtgcctca tctattttag ggtcattaaa ttttatttck actattataa atatacgaac 300

taaagggata acaactgaca cgartaccat tatttgtttg gtcagttgtt attactacta 360

ttttattatt attatcatta ccggttttag ca 392

<210>14

<211>389

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>14

ttaattggtg ggtttggtaa ttgactttta ccattaataa ttggtgcccc agatatagmt 60

tttcctcgat taaataattt taggttttga ttacttcccc atcattaact atattggtaa 120

gatcatcaat agttgaaaat ggtgtwggta caggatgaac tatttatccg ccattagctg 180

atagcatttc tcattcaggr ccatgtgtag atatagctat yttttcatta catatagctg 240

gtgcatcttc tattttaggt tcwttaaatt ttatttctac tattgtwaat atacgaacta 300

arggaatarg aaatgaacga gttccattat ttgtttgatc tgtagtaatt actactattt 360

tattattatt atcattaccg gttttagca 389

<210>15

<211>390

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>15

ttaattggtg ggtttggtaa ttgattaatt cctttaataa ttggtgcacc agatatagca 60

ttycctcgac ttaataacct aagattttga ttaytacccc catcaataat tatrttagtt 120

ttttctgcat ttgtagaaaa tggtgtaggr actggatgaa cagtataccc tccattagca 180

tataatattg cccattcygg accatcrgta gatatrgcta tyttctcgtt acatttagca 240

ggagcgtcat ctattttagg ctcrttaaac tttatctcya ctgtagcaaa tatacgatga 300

aaaggtataa cattagaccg ratyccttta tttatttgat cagtagttat tactaccgta 360

ctacttctat tatcattacc gttttagcan 390

<210>16

<211>391

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>16

ttaattggtg gggtttggta attgattaat tccattaata attggwgcac cagatatagc 60

attyyctcgw cttrataacy tragattttg attactaccc ccatcaataa ttatattagt 120

tttttcwgca ttwgtwgaaa rtggtgtagg gacwggatga acagtatayc ctccattakc 180

akataatatt kcycattcmg gaccatcsgt agatatagct atcttctcrt tacatwtagc 240

aggagcvtca tctattttag gsgtcattaa actttatctc tactrtarca aatatacgat 300

gaaaaggtat aacattagac cgaatccctt tatttatttg atcagtagtt attactaccg 360

tactacttct attatcatta ccagttttag c 391

<210>17

<211>379

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>17

ttaattggtg gggtttggta attgactcct accattaatg gtaggggccg tagatatatc 60

gtttcctcgt ctgaataact taagattttg gttactaccc ccttcaataa tcatattgct 120

taggtcatcc ttaattgagg gtggtgtagg tgcagggtga accctttatc ctccactatc 180

agactccgta tctcattcag gcccatccgt tgacatagcc atcttttcat tacatatagc 240

tggtgcctca tctattttag ggtcattaaa ttttatttcg actattataa atatacgaac 300

taaaggaata acaactgaac gagtaccatt atttgtttgg tcagttgtta ttactactat 360

tttattattg ttatcatta 379

<210>18

<211>391

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>18

taattggtgg gtttggtaat tgactcatta ccattaatgg taggagccgt agatatatcg 60

tttcctcgat ctgaataatt taagattttg gttactaccc ccttcaataa tcatattgst 120

takgtcatcm ttaattgagg gkggtgtagg tgcagggtga accctttatc ctccaytatc 180

agactcygta tctcattcag gmccatccgt tgacatagcc atcttttcat tacatatagc 240

atggtgcstc atctatttta ggatcattaa attttatttc kactattata aatatacgaa 300

ctaaaggaat aacaamtgaa cgartaccat tatttgtttg gtcagttgtt attactacta 360

ttttattatt gttatcatta ccagttttag c 391

<210>19

<211>682

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>19

aaagatattg gtactttata ctttatttta ggaacgtgat cagctatgtt aggctcttct 60

ataagatcaa ttattcgaat tgaattagca cagccaggaa gattccttgg agacgaccaa 120

ttgtataatt cactagtaac ggctcatggg ttggttataa tcttctttat agttatacca 180

attctaattg gtgggtttgg taattgactc ctgccattaa tggtaggagc cgtagatata 240

tcatttcctc gtctgaataa tttaagattt tggttactac ccccttcaat aatcatattg 300

cttaggtcat ctttaattga gggtggtgta ggtgcagggt gaacccttta tcccccacta 360

tcagactccg tatctcattc aggcccatcc gttgacatag ccatcttctc attacatata 420

gctggtgcct catctatttt agggtcatta aattttattt cgactattat aaatatacga 480

actaaaggga taacaactga acgagtacca ttatttgttt ggtcagttgt tattactact 540

attttattat tattatcatt accagtttta gcagcagcta ttacaatatt acttacagat 600

cgaaatttaa atactacttt ctttgaccct ataggagggg gggatcctat tttgtttcaa 660

catttatttt gattttttgg tc 682

<210>20

<211>694

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>20

gaccaaaaaa tcaaaataag tgctgaaaca atactggatc tccaccacct atagggtcaa 60

agaatgaagt atttaaatta cggtcagtta ataatattgt aatagctgct gctaatactg 120

gtaatgataa taataataaa atagtagtaa ttactacaga tcaaacaaat aatggaactc 180

gttcatttcc tattccctta gttcgtatat taacaatagt agaaataaaa tttaaagaac 240

ctaaaataga agatgcacca gctatatgta atgaaaaaat agctatatct acacatggcc 300

ctgaatgaga aatgctatca gctaatggcg gataaatagt tcatcctgta ccaacaccat 360

tttcaactat tgatgatctt accaatatag ttaatgatgg tggaagtaat caaaacctaa 420

aattatttaa tcgaggaaaa gctatatctg gggcaccaat tattaatggt aaaagtcaat 480

taccaaaacc tccaattaga ataggtatta ccataaagaa aattataata agtccatgtg 540

cagtaattaa ggaattataa agttgatcat ctccaagaaa acttcctggc tgagataatt 600

caacccgaat aatagtactt atagaggatc ttaatatagc agctcaagca cctaagatta 660

aatataaagt cccaatatct ttatgatttg ttga 694

<210>21

<211>685

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>21

gaccaaaaaa tcagaataag tgctgaaata aaactggatc tccaccacct atagaggtca 60

aagaatgaag tattcaaaat tacgatcagt tagtaatatt gtaatagctg ctgctaatac 120

tggtaacgaa agtaataata aaatagtagt aattactaca gatcaaacaa ataatggaac 180

tcgttcattt cctattccct tagttcgtat attaacaata gtagaaataa aatttaaaga 240

acctaaaata gaagatgcac cagctatatg taatgaaaaa atagctatat caacacatgg 300

tcctgaatga gacatactat cagataatgg tggataaata gttcatcctg taccaacacc 360

attttcaacy attgatgatc ttaccaatat agttaacgat ggtggaagta atcaaaacct 420

aaaattattt aatcgaggaa aagctatatc tggcgcacca attattaatg gtaaaagtca 480

attaccaaaa cctccaatta aaataggtat caccataaaa aaaattataa taagcccatg 540

tgcagtaatc aaggaattat aaagttgatc atctccaaga aaactacctg gctgagataa 600

ttcaatccga ataatagtac ttatagagga tcctaatata gcagctcaag cacctaaaat 660

taaatataaa gttccaatat cttta 685

<210>22

<211>711

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>22

gtcaacaaat cataaagata ttggaacatt atattttatt ctaggagctt gatcagctat 60

agctgggaca ggaataagag tattaattcg aattgaatta gctcaacctg gtacgtttct 120

aggtaatgat caaatttata atactattgt aactgcacat ggcttagtaa taattttctt 180

tatagtaata cctattttaa ttgggggttt tggtaattgg ttaatccctt taataattgg 240

tgcaccagat atagcatttc cccgacttaa taacctaaga ttttgattat tacccccatc 300

aataattatg ttagttttct ctgcatttgt agaaaatggt gtaggaactg gatgaacagt 360

ataccctcca ttagcatata atattgccca ctctggacca tcagtagata tggctatttt 420

ctcgttacat ttagcaggag cgtcatctat tttaggctca ttaaacttta tctccactgt 480

agcaaatata cgatggaaag gtataacatt agaccgaatc cctttattta tttgatcagt 540

agttattact accgtactac ttctattatc attaccagta ctagcagcag ctattacaga 600

tattacttac agatcgwaat ttaaatacct cattctttga tcctgctgga ggaggggacc 660

ctattctatt tcaacacttg ttttgatttt ttggtcaccc tggaagttta a 711

<210>23

<211>702

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>23

ttaaacttcc cagggtgacc aaaaaatcaa aacaaatgtt gaaatagaat aggatctcct 60

cctccagcag gatcaaagaa tgatgtgttt aaatttcgat ctgtaagtaa tattgtaatg 120

gctgccgcta atactggcaa tgataataga agtagtacgg tagtaataac tactgatcaa 180

ataaataaag ggattcggtc taatgttata ccttttcatc gtatatttgc tacagtagag 240

ataaagttta atgagcctaa aatagatgat gctcctgcta aatgtaacga gaagatagct 300

atatctaccg atggtccgga atgggcaata ttatatgcta atggagggta tactgttcat 360

ccagtcccta caccattttc tacaaatgca gaaaaaacta atataattat tgatgggggt 420

agtaatcaaa atctcaggtt attaagtcga gggaatgcta tatctggtgc accaattatt 480

aagggaatta atcagttacc aaacccccca attagaatag gtattactat aaagaaaatt 540

attactaaac cgtgtgcagt tacaatagta ttataaattt gatcattacc tagaaacgta 600

ccaggttgag ctaattcaat tcgaattaat actcttatcc ctgttccagc tatagctgat 660

caggccccta gaataaaata taatgttcca atatctttat ga 702

<210>24

<211>683

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>24

tgaccaaaaa atcaaaacaa atgttgaaat agaataggat ctcctcctcc agcaggatca 60

aagaatgatg tgtttaaatt tcgatctgta agtaatattg taatggctgc cgctagtact 120

ggtaatgata atagaagtag tacggtagta ataactactg atcaaataaa taaaggaatc 180

cggtctaatg ttataccttt tcatcgtata tttgctacag tagagataaa gtttaacgag 240

cctaaaatag atgacgctcc tgctaaatgt aacgagaaga tagctatatc taccgatggt 300

ccggaatggg caatattata tgctaatgga gggtatactg ttcatccagt ccctacacca 360

ttttctacaa atgcagaaaa aactaatata attattgatg ggggtagtaa tcaaaatctt 420

aggttattaa gtcgagggaa tgctatatct ggtgcaccaa ttattaaggg aattaatcag 480

ttaccaaaac ctccaattaa aataggtatt actataaaga aaattattac taaaccatgt 540

gcagttacaa tagtattata aatttgatca ttacctagaa acgtgccagg ttgagctaac 600

tcaattcgaa ttaatactct tatccctgtt ccagctatag ctgatcaggc ccctagaata 660

aaatataatg ttccaatatc ttt 683

<210>25

<211>713

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>25

ttaaacttcc agggtgacca aaaaatcaaa acaaatgttg aaatagaata ggatctcctc 60

ctccagcagg atcaaagaat gatgtgttta aatttcgatc tgtaagtaat attgtaatgg 120

ctgccgctag tactggtaat gataatagaa gtagtacggt agtaataact actgatcaaa 180

taaataaagg aatccggtct aatgttatac cttttcatcg tatatttgct acagtagaga 240

taaagtttaa tgagcctaaa atagatgacg ctcctgctaa atgtaacgag aagatagcta 300

tatctaccga tggtccggaa tgggcaatat tatatgctaa tggagggtat actgttcatc 360

cagtccctac accattttct acaaatgcag aaaaaactaa tataattatt gatgggggta 420

gtaatcaaaa tctcaggtta ttaagtcgag ggaatgctat atctggtgca ccaattatta 480

agggaattaa tcagttacca aaacctccaa ttaaaatagg tattactata aagaaaatta 540

ttactaaacc atgtgcagtt acaatagtat tataaatttg atcattacct agaaacgtgc 600

caggttgagc taactcaatt cgaattaata ctcttatccc tgttccagct atagctgatc 660

aggcccctag aataaaatat aatgttccaa tatctttatg attttgttga cca 713

<210>26

<211>713

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>26

ttaaactttc agggtgacca aaaaatcaaa ataagtgttg aaataatact ggatctccac 60

cacccattgg atcaaaaaat gaagtattta aattacgatc arttaataac attgtaatag 120

ctgctgctaa tacaggtaat gaaagtaata ataagatagt agtaattaca acagatcaaa 180

caaataatgg aactcgttca ttacttatac cattagttcg catattaata atagtagaaa 240

taaaatttaa agaacctaaa atagatgatg caccagctat atgcaatgaa aagatagcta 300

tatctacaca aggtcctgag tgagaaactc tatcagctaa tggtggataa atagtccatc 360

ctgtaccaac accggattca attattgatg atcttactaa tatagttaat gaaggtggta 420

ataatcaaaa cctaaaatta tttaatcgtg gaaaagccat atctggggca ccaattatta 480

acggtaaaag tcaattacca aacccaccga ttaaaatagg tattactata aaaaaaatta 540

taataagtcc atgtgcagta attaaagaat tataaagttg atcatcccca agaaacctac 600

ctggttgaga taactcaatt cgaataatag ttcttataga ggagcctaat atagctgccc 660

aagcccctag aatcaaatat agagttccaa tatctttatg attttgttga cca 713

<210>27

<211>698

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>27

ttaaacttcc agggtgacca aaaaatcaaa ataagtgttg aaacaaaatt gggtctcccc 60

ctcctatagg atcaaaaaaa gaggtattta gatttcgatc trttaataat atagtaattg 120

ctgcagctaa aacaggtaat gataaaagta gaagaatagt agtaataatt actgaccata 180

caaataatgg aatacgttca gctcttattc cattagttcg tatattaata attgtagaaa 240

taaagtttaa agatcccaaa atagatgatg ccccggctat atgtaatgaa aaaattgcta 300

tgtctactga cggaccagaa tgtgatattg aatctgataa tggcggatat aatgttcatc 360

cagctcctac accaccttca attattgagg aacttagtagtataattata gatggtggta 420

ataatcaaaa gcttagatta ttaagacgtg gaaatgatat atcaactgct ccaactatta 480

atggcaataa tcaatttcca aacccaccaa tcaaaatagg tattactata aaaaaaatta 540

taactaaccc atgagcagtt actaatgaat tatataattg atcatcccct agaaatctac 600

ctggttgagc taactcaata cgaataatgg atcttataga agaacctagt atagatgatc 660

aagcacccaa aataaaatat aatgttccaa tatcttta 698

<210>28

<211>391

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>28

ttaattggtg ggtttggtaa ttgactccta ccattaatgg taggggccst agatatatcg 60

tttctcgatc tgaataactt aagattttga gttactaccc ccttcaataa tcatattgct 120

taggtcatcc ttaattgagg gtggtgtagg tgcagggtga accctttatc ctccactatc 180

agactccgta tctcattcag gcccatccgt tgacatagcy atcttttcat tacatatagc 240

tggtgcctca tctattttag ggtcattaaa ttttatttck actattataa atatacgaac 300

taaaggaata acaactgaac gagtaccatt atttgtttgg tcagttgtta ttactactat 360

tttattattg ttatcattac aggttttagc a 391

<210>29

<211>390

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>29

ttaattggtg ggtttggtaa ttgactttta ccattaataa ttggtgcccc agatatagct 60

tttcctcgat taaataattt taggttttga ttacttccac catcattaac tatattggta 120

agatcatcaa tagttgaaaa tggtgttggt acaggatgaa ctatttatcc gccattagct 180

gatagcattt ctcattcagg gccatgtgta gatatagcta ttttttcatt acatatagct 240

ggtgcatctt ctattttagg ttctttaaat tttatttcta ctattgttaa tatacgaact 300

aagggaatag gaaatgaacg agttccatta tttgtttgat ctgtagtaat tactactatt 360

ttattattat tatcattaca ggttttagca 390

<210>30

<211>391

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>30

ttaattggtg gggtttggta attgactttt accattaata attggtgcgc cagatatagc 60

ttttcctcga ttaaataatt ttaggttttg attacttcca ccatcgttaa ctatattggt 120

aagatcatca atrgttgaaa atggtgttgg tacaggatga actatttatc caccattatc 180

tgatagtatg tctcattcag gaccatgtgt tgatatagct attttttcat tacatatagc 240

tggtgcatct tctattttag gttctttaaa ttttatttct actattgtta atatacgaac 300

taagggaata ggaaatgaac gagttccatt atttgtttga tctgtagtaa ttactactat 360

tttattatta ttatcattac cgttttagca n 391

<210>31

<211>383

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>31

nnttcttaat tggtgggttt ggtaattggt taatcccttt aataattggt gcaccagata 60

tagcatttcc ccgacttaat aacctaagat tttgattatt acccccatca ataattatgt 120

tagttttctc tgcatttgta gaaaatggtg taggaactgg atgaacagta taccctccat 180

tagcatataa tattgcccac tctggaccat cagtagatat ggctattttc tcgttacatt 240

tagcaggagc gtcatctatt ttaggctcat taaactttat ctccactgta gcaaatatac 300

gatggaaagg tataacatta gaccgaatcc ctttatttat ttgatcagta gttattacta 360

ccgtactact tctattatca tta 383

<210>32

<211>381

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>32

tnnttaattg gtgggtttgg taactgatta attcccttaa taattggtgc accagatata 60

gcattccctc gacttaataa cctgagattt tgattactac ccccatcaat aattatatta 120

gttttttctg catttgtaga aaatggtgta gggactggat gaacagtata ccctccatta 180

gcatataata ttgcccattc cggaccatcg gtagatatag ctatcttctc gttacattta 240

gcaggagcat catctatttt aggctcatta aactttatct ctactgtagc aaatatacga 300

tgaaaaggta taacattaga ccgaatccct ttatttattt gatcagtagt tattactacc 360

gtactacttc tattatcatt a 381

<210>33

<211>389

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>33

ttaattggtg ggtttggtaa ttggttaatc cctttaataa ttggtgcacc agatatagca 60

tttccccgac ttaataacct aagattttga ttattacccc catcaataat tatgttagtt 120

ttctctgcat ttgtagaaaa tggtgtaggg actggatgaa cagtataccc tccattagca 180

tataatattg cccactctgg accatcagta gatatggcta ttttctcgtt acatttagca 240

ggagcgtcat ctattttagg ctcattaaac tttatctcca ctgtagcaaa tatacgatgg 300

aaaggtataa cattagaccg aatcccttta tttatttgat cagtagttat tactaccgta 360

ctacttctat tatcattacc agttttagc 389

<210>34

<211>367

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>34

gtttggtaac tgattaattc ccttaataat tggtgcacca gatatagcat tccctcgact 60

taataaccta agattttgat tactaccccc atcaataatt atattagttt tttctgcatt 120

tgtagaaaat ggtgtaggga ctggatgaac agtataccct ccattagcat ataatattgc 180

ccattccgga ccatcggtag atatagctat cttctcgtta catttagcag gagcgtcatc 240

tattttaggc tcgttaaact ttatctctac tgtagcaaat atacgatgaa aaggtataac 300

attagaccgg attcctttat ttatttgatc agtagttatt actaccgtac tacttctatt 360

atcatta 367

<210>35

<211>344

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>35

tggagnnnna tatggcnnnn ncncgatnaa ataatttnag gttttgatta ttaccacctt 60

ctttaattat attaatattc tcatcaacaa ttgaatccgg agctggtaca ggatgaacan 120

tntatccacc attatctgan atagtttctc antcaggacc ttggntanat atagctatct 180

tttcattgcc ttagctggtg catcatctat tttangttct tgaattttat ttcnactatt 240

aataatatgc aaactaatgg tttaattaat gaacaatttc tataattgga ttaaccggta 300

gtaataccta ctatctaata ataatattca taaccatttt aaca 344

<210>36

<211>395

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>36

tttttttaat tggtgggttt ggtaattgat tattgccatt aatagttgga gcagttgata 60

tatcatttcc acgtcttaat aatctaagct tttgattatt accaccatct ataattatac 120

tactaagttc ctcaataatt gaaggtggtg taggagctgg atgaacatta tatccgccat 180

tatcagattc aatatcacat tctggtccgt cagtagacat agcaattttt tcattacata 240

tagccggggc atcatctatt ttgggatctt taaactttat ttctacaatt attaatatac 300

gaactaatgg aataagagct gaacgtattc cattatttgt atggtcagta attattacta 360

ctattcttct acttttatca ttaccagttt tagca 395

<210>37

<211>22

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>37

agatgaggca ccagctatat gt 22

<210>38

<211>22

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>38

acgtgatcag ctatgttagg ct 22

<210>39

<211>395

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>39

tatntacgtg atccagctat gttaggctct tctataagat caattattcg aattgaatta 60

gcacagccag gaagattcct tggagacgac caattgtata attcactagt aacggctcat 120

gggttggtta taatcttctt tatagttata ccaattctaa ttggtgggtt tggtaattga 180

ctcctgccat taatggtagg agccgtagat atatcatttc ctcgtctgaa taatttaaga 240

ttttggttac tacccccttc aataatcata ttgcttaggt catctttaat tgagggtggt 300

gtaggtgcag ggtgaaccct ttatccccca ctatcagact ccgtatctca tcaggcccat 360

ccgttgacat agccatcttc tcattacata tagct 395

<210>40

<211>378

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>40

tatgttaggc tcttctataa gatcaattattcgaattgaa ttagcacagc caggaagatt 60

ccttggagac gaccaattgt ataattcact agtaacggct catgggttgg ttataatctt 120

ctttatagtt ataccaattc taattggtgg gtttggtaat tgactcctac cattaatggc 180

aggagccgta gatatatcat ttcctcgtct gaataattta agattttggt tactaccccc 240

ttcaataatc atattgctta ggtcatcttt aattgagggt ggtgtaggtg cagggtgaac 300

cctctatccc ccactatcag actccgtatc tcattcaggc ccatccgttg acatagccat 360

cttctcatta catatagc 378

<210>41

<211>408

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>41

tkttacgtga tccagctatg ttaggctcct ctataagtac tattattcgg attgaattat 60

ctcagccagg tagttttctt ggagatgatc aactttataa ttccttgatt actgcacatg 120

gacttattat aatttttttt atggtgatac ctattttaat tggaggtttt ggtaattgac 180

ttttaccatt aataattggt gcgccagata tagcttttcc tcgattaaat aattttaggt 240

tttgattact tccaccatcg ttaactatat tggtaagatc atcaatagtt gaaaatggtg 300

ttggtacagg atgaactatt tatccaccat tatctgatag ctatgtctca ttcaggacca 360

tgtgttgata tagctatttt ttcattacat atagctggtg cctcatct 408

<210>42

<211>396

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>42

tntacgtgat ccagctatgt taggctcttc tataagatca attattcgaa ttgaattagc 60

acagccagga agattccttg gagacgacca attgtataat tcactagtaa cggctcatgg 120

gttggttata atcttcttta tagttatacc aattctaatt ggtgggtttg gtaattgact 180

cctaccatta atggtaggrg ccgtagatat atcrtttcct cgtctgaata atttaagatt 240

ttggttacta cccccttcaa taatcatatt gcttaggtca tccttaattg agggtggtgt 300

aggtgcaggg tgaacccttt atcctccact atcagactcc gtatctcatc aggcccatcc 360

gttgacatag ccatcttttc attacatata gctggg 396

Claims (10)

1. The method for directionally identifying the traditional Chinese medicine counterfeit in the Chinese patent medicine comprises the following steps: extracting DNA of the Chinese patent medicine as a template, carrying out two rounds of PCR amplification, and then sequencing the PCR reaction solution; and performing sequence splicing on the sequencing peak images, and then comparing in a database to finish the identification of the Chinese medicinal counterfeit products in the Chinese patent medicines.

2. The method for directionally identifying the Chinese medicinal counterfeit drug in the Chinese patent medicine as claimed in claim 1, wherein the Chinese patent medicine is ground in water and then centrifuged, and the precipitate is washed with sterile water and then extracted with a DNA extraction kit to complete the extraction of the DNA of the Chinese patent medicine.

3. The method for the directional identification of the Chinese medicinal counterfeit drug in the Chinese patent medicine according to claim 1, wherein in the two rounds of PCR amplification, the primers for the first round of PCR amplification are COI universal primers; the primers for the second round of PCR amplification are universal primers for detecting the specificity of the traditional Chinese medicine in the Chinese patent medicine.

4. The method for the targeted identification of Chinese medicinal herbs in Chinese patent medicine according to claim 3, wherein the first round of PCR amplification is 25 μ L reaction system and the second round of PCR amplification is 25 μ L reaction system.

5. The method for the targeted identification of the traditional Chinese medicine counterfeit drug in the Chinese patent medicine according to claim 3, wherein the Chinese patent medicine is rheum officinale worm pills.

6. The method for the targeted identification of Chinese medicinal orthodox drugs in Chinese patent medicine according to claim 5, wherein the primers for the first round of PCR amplification are L C01490 and L C02198, and the primers for the second round of PCR amplification are COI924F and COI 924R.

7. The method for targeted identification of Chinese medicinal orthodox drugs in Chinese patent medicine according to claim 6, wherein L C01490 is GGTCAACAAATCATAAAGATATTGG, L C02198 is TAAACTTCAGGGTGACCAAAAAATCA, COI924F is GCTAAAACTGGTAATGATAA, and COI924R is TAATTGGTGGGTTTGGTAA.

8. The method for the targeted identification of Chinese medicinal counterfeit drug in Chinese patent medicine according to claim 3, wherein the first round of PCR amplification is performed by pre-denaturing at 94 ℃ for 5 min, denaturing at 94 ℃ for 1min, annealing at 45 ℃ for 1min for 30s, extending at 72 ℃ for 1min for 30s, and circulating for 5 times; denaturation at 94 deg.C for 1min, annealing at 50 deg.C for 1min and 30s, extension at 72 deg.C for 1min, and circulation for 40 times; finally, extending for 5 min at 72 ℃; the second round of PCR amplification procedure is pre-denaturation at 94 ℃ for 5 min, denaturation at 94 ℃ for 1min, annealing at 45 ℃ for 1min 30s, extension at 72 ℃ for 1min 30s, and 5 cycles; denaturation at 94 deg.C for 1min, annealing at 50 deg.C for 1min and 30s, extension at 72 deg.C for 1min, and circulation for 40 times; finally, extension is carried out for 5 min at 72 ℃.

9. The method for the targeted identification of counterfeit Chinese medicines in Chinese patent medicines as claimed in claim 1, wherein the database is the NCBI database.

10. The application of two PCR reactions in the directional identification of the traditional Chinese medicine counterfeit products in the Chinese patent medicine.

Images