CN111455029A - Primer composition, reagent, detection method and system for realizing accurate typing of vitamin D receptor TaqI sites based on probe method - Google Patents
Primer composition, reagent, detection method and system for realizing accurate typing of vitamin D receptor TaqI sites based on probe method Download PDFInfo
- Publication number
- CN111455029A CN111455029A CN202010325748.4A CN202010325748A CN111455029A CN 111455029 A CN111455029 A CN 111455029A CN 202010325748 A CN202010325748 A CN 202010325748A CN 111455029 A CN111455029 A CN 111455029A
- Authority
- CN
- China
- Prior art keywords
- probe
- vitamin
- receptor
- taqi
- accurate typing
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/6858—Allele-specific amplification
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Engineering & Computer Science (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Health & Medical Sciences (AREA)
- Biophysics (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Immunology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Analytical Chemistry (AREA)
- Physics & Mathematics (AREA)
- Biotechnology (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention provides a primer composition, a reagent, a detection method and a system for realizing accurate typing of a vitamin D receptor TaqI site based on a probe method. The primer composition for realizing accurate typing of the vitamin D receptor TaqI site based on the probe method is a primer and a probe which are designed according to the polymorphism of the vitamin D receptor gene TaqI (rs731236) SNP site; the reagent, the detection method and the system for realizing the accurate typing of the vitamin D receptor TaqI site based on the probe method are respectively the reagent, the method and the system which adopt the primer composition for realizing the accurate typing of the vitamin D receptor TaqI site based on the probe method. The primer composition for realizing accurate typing of the TaqI site of the vitamin D receptor based on the probe method solves the technical problems of expensive equipment, aerosol pollution, complicated steps and the like in the TaqI site polymorphism detection in the prior art.
Description
Technical Field
The invention relates to the field of gene detection, in particular to a primer composition, a reagent, a detection method and a system for realizing accurate typing of a vitamin D receptor TaqI site based on a probe method.
Background
The vitamin D receptor gene (VDR) receptor is positioned at 12q13.11, has a total length of 63.5kb and 11 exons, has an mRNA length of 4,775nt, encodes a Vitamin D Receptor (VDR) protein consisting of 428 amino acid residues, is a nuclear hormone receptor of vitamin D3, and is also a second receptor of cholic acid. VDR belongs to a transcriptional regulator, is a member of the steroid hormone/thyroid hormone receptor superfamily, and functions as a ligand-induced replication factor. The regulation of gene expression by the protein is mainly realized through a series of metabolic reaction pathways, including an immune reaction pathway and a tumor activation pathway.
A plurality of domestic and foreign researches prove that the VDR gene and metal ions such as calcium are absorbed and metabolized in vivo, so that the VDR gene has obvious relevance to diseases such as fracture, osteoporosis, vitamin D dependent rickets II and the like. TaqI (rs731236) is associated with breast cancer, lung cancer, multiple sclerosis, type II diabetes, tuberculosis susceptibility, asthma, severe chronic periodontitis of Chinese Han nationality, idiopathic low citric acid uropathy of Yunnan white population, etc. TaqI (rs731236) is located at 47844974 position of chromosome 12, and has three genotypes of TT, CT and CC.
Currently, the commonly used detection methods for the TaqI (rs731236) polymorphism include:
1. after PCR-based amplification and single base extension, SNP genotyping was performed using either MassARRAY or a generation sequencer. The existing equipment is expensive; after PCR amplification and single base extension, one round of enzyme digestion is needed, the steps are complicated, and the investment of manpower and reagent consumables is large; the PCR amplification product needs to be uncapped, so that the indoor aerosol pollution is easily caused, and the accuracy of the result is influenced.
2. Two forward primers and one reverse primer are utilized, after PCR amplification, product bands distinguished according to the sizes of fragments are seen under ultraviolet light through gel electrophoresis, and the genotype of a target SNP locus is judged according to the existence of the bands. The same problem of aerosol contamination exists; in the step of result judgment, gel electrophoresis is needed, and various complicated steps such as glue preparation, sample application, glue running, imaging and the like are involved, so that errors are easy to occur, and the labor investment is large; and the result is presented in the form of pictures, and the interpretation process depends on subjective factors, so that errors are easy to occur.
Disclosure of Invention
In order to solve the technical problems of expensive equipment, aerosol pollution, complicated steps and the like existing in TaqI site polymorphism detection in the prior art, the invention provides the primer composition for realizing accurate typing of the TaqI site of the vitamin D receptor based on a probe method.
A primer composition for realizing accurate typing of a vitamin D receptor TaqI site based on a probe method comprises a primer and a probe which are designed according to polymorphism of a vitamin D receptor gene TaqI (rs731236) SNP site, and the sequence is as follows:
VDR gene TaqI (rs731236) forward amplification primer:
CGTGCCCACAGATCGTCCTG；
VDR gene TaqI (rs731236) reverse amplification primer:
GATGTACGTCTGCAGTGTGTTGG；
VDR gene TaqI (rs731236) genotype T probe:
5’-GCTGATTGAGGCCATCCA-3’；
VDR gene TaqI (rs731236) genotype C probe:
5’-GCTGATCGAGGCCATCCA-3’。
the fluorescent group at the 5 'end of the genotype T probe is VIC, and the quenching groups at the 3' end of the genotype T probe are Quencher and MGB. The fluorescent group at the 5 'end of the genotype C probe is FAM, and the quenching group at the 3' end of the genotype C probe is Quencher and MGB.
The primer and the probe exist in the form of mixed solution, and the proportion is as follows: (the forward amplification primer: the reverse amplification primer: the genotype T probe: the genotype C probe: water) ═ 10:10:4:4: 192).
A reagent for realizing accurate typing of a vitamin D receptor TaqI site based on a probe method comprises a primer composition for realizing accurate typing of the vitamin D receptor TaqI site based on the probe method and a reagent required for performing Q-PCR reaction.
A detection method for realizing accurate typing of a vitamin D receptor TaqI site based on a probe method comprises the following steps:
the method comprises the following steps: extracting to obtain DNA of a sample to be detected;
step two: and (3) carrying out reaction on the DNA of the sample to be detected and the reagent for realizing accurate typing of the TaqI site of the vitamin D receptor based on the probe method according to the step operation of Q-PCR reaction.
A system for realizing accurate typing of a vitamin D receptor TaqI site based on a probe method comprises the following steps:
the extraction module is used for extracting and obtaining DNA of a sample to be detected;
and the detection module is used for carrying out reaction on the DNA of the sample to be detected and the reagent for realizing accurate typing of the TaqI site of the vitamin D receptor based on the probe method according to the step operation of Q-PCR reaction.
Compared with the prior art, the primer composition for realizing accurate typing of the vitamin D receptor TaqI site based on the probe method is designed according to the polymorphism of the vitamin D receptor gene TaqI (rs731236) SNP site, the primer probe combination of the sequences is used for adjusting the GC content of the primer to be 59 +/-2% according to the rules of AT interchange and GC interchange under the condition of non-specific amplification, and the adjusted Tm peak value of the primer is single. The detection can be completed by one-step Q-PCR, and the method has the advantages that:
1. simple and efficient: performing Q-PCR reaction once, wherein the operation is simple, and the time is 2-3 hours; 2. the popularization is strong, the related main equipment is a real-time fluorescence quantitative PCR instrument, the price is relatively low, and most of mechanisms can be equipped; 3. the result is accurate, and the result is presented in a digital form, is not influenced by subjective judgment, and is objective and real; 4. the compatibility is good, the result can be directly accessed into a corresponding table for fast interpretation, and the sample processing capability is strong; 5. the pollution risk is small, cover opening is not needed after PCR is finished, aerosol cannot be generated, and false positive cannot be caused.
In addition, since the Quencher is a Quencher, when it and a fluorophore are present on one DNA strand at the same time, the fluorophore cannot emit fluorescence. Thus, normally, the device cannot detect a fluorescent signal. When the Q-PCR reaction is carried out, the probe is specifically combined to the SNP site, the DNA polymerase contained in the reaction liquid cuts the probe from the target fragment into the reaction liquid, and the fluorescent gene on the corresponding probe is separated from the quenching group Quencher and captured by equipment, so that the specific genotype of the target SNP is detected.
Drawings
FIG. 1 is a graph showing Melt Curve obtained by detecting the primer composition for realizing accurate typing of a vitamin D receptor TaqI site based on a probe method provided by the invention;
FIG. 2 is a diagram showing the effect of typing a site polymorphism obtained by detecting the primer composition for realizing accurate typing of a vitamin D receptor TaqI site based on a probe method provided by the invention;
FIG. 3 is a tabular form diagram of FIG. 2;
FIG. 4 is a graph showing Melt cut results from prior art testing;
FIG. 5 is a graph showing the effect of typing of a site polymorphism detected by a conventional technique.
Detailed Description
The technical solutions in the embodiments of the present invention will be clearly and completely described below with reference to the drawings in the embodiments of the present invention, and it is obvious that the described embodiments are only a part of the embodiments of the present invention, and not all of the embodiments.
The primer composition for realizing accurate typing of the vitamin D receptor TaqI site based on a probe method comprises the following components:
VDR gene TaqI (rs731236) forward amplification primer:
CGTGCCCACAGATCGTCCTG (corresponding to SEQ No.1 of the sequence Listing);
VDR gene TaqI (rs731236) reverse amplification primer:
GATGTACGTCTGCAGTGTGTTGG (corresponding to SEQ No.2 of the sequence Listing);
VDR gene TaqI (rs731236) genotype T probe:
5'-GCTGATTGAGGCCATCCA-3' (corresponding to SEQ No.3 of the sequence Listing);
VDR gene TaqI (rs731236) genotype C probe:
5'-GCTGATCGAGGCCATCCA-3' (corresponding to SEQ No.4 of the sequence Listing).
Wherein, the fluorescent group at the 5 'end of the genotype T probe is VIC, and the quenching group at the 3' end is Quencher and MGB. The fluorescent group at the 5 'end of the genotype C probe is FAM, and the quenching group at the 3' end of the genotype C probe is Quencher and MGB.
The reagent for realizing accurate typing of the vitamin D receptor TaqI site based on the probe method comprises a primer composition for realizing accurate typing of the vitamin D receptor TaqI site based on the probe method and a reagent required by Q-PCR, and specific components of the primer composition and the reagent are detailed in the detection method below.
The detection method for realizing accurate typing of the vitamin D receptor TaqI locus based on the probe method comprises the following steps:
1. and (3) extracting DNA. 94 portions of DNA (S1 to S94) were extracted using the Crude DNA Extraction Kit (for Blood) (Vazyme) according to the procedure described in the specification, and stored at-20 ℃ for use.
2. A Q-PCR amplification system was prepared. SNP typing reaction is adopted in a reagent of ChamQ Geno-SNP Probe MasterMix (Vazyme), which is as follows:
| reagent | Volume (mu L) |
| TaqProbe 2X Q-PCR Mastermix | 10.0 |
| Primer&Probe Mix | 2.0 |
| nuclease free water | 3.0 |
| Template | 5.0 |
| |
20 |
Wherein, the Primer & Probe Mix is the Primer composition for realizing accurate typing of the vitamin D receptor TaqI sites based on the Probe method. The components were mixed with double distilled water at a concentration of 100pmol/ul in a ratio of 10:10:4:4:192 (water) (see below).
| Primer probe | Concentration of | Volume (mu L) |
| TaqI (rs731236) Forward primer | 100pmol/ul | 5.0ul |
| TaqI (rs731236) reverse primer | 100pmol/ul | 5.0ul |
| TaqI (rs731236) genotype T probe | 100pmol/ul | 2.0ul |
| TaqI (rs731236) genotype C probe | 100pmol/ul | 2.0ul |
| ddH2O | 96.0ul |
3. And (5) Q-PCR amplification. The following procedure was followed using an Applied Biosystems QuantStudio 5 apparatus:
4. and outputting the result. As shown in FIGS. 1 to 3, the results are the Melt cut display chart, the effect chart of the site polymorphism typing and the tabular form thereof, respectively.
In FIG. 2, the upper left part (blue) represents homozygous TT type, the middle part (green) represents heterozygous CT type, and the lower right part (red) represents homozygous CC type.
Please refer to FIG. 4 and FIG. 5, which are the Melt cut display graph and the polymorphism typing effect graph, respectively, obtained by the detection in the prior art. Compared with the prior art, the primer composition for realizing accurate typing of the vitamin D receptor TaqI sites based on the probe method is adopted for detection, and the obtained peak diagram is single and has good specificity. The success rate of successful typing also increased from around 91% to nearly 100%.
A system for realizing accurate typing of a vitamin D receptor TaqI site based on a probe method comprises the following steps:
the extraction module is used for extracting and obtaining DNA of a sample to be detected;
the detection module is used for enabling the DNA of the sample to be detected and the reagent for realizing accurate typing of the TaqI site of the vitamin D receptor based on the probe method to react according to the step operation of Q-PCR reaction and outputting a reaction result;
and an apparatus capable of automatically performing Q-PCR operation. The detection module detects the DNA of the sample to be detected by relying on the equipment according to the detection method for realizing accurate typing of the TaqI site of the vitamin D receptor based on the probe method; and the results are displayed as visual data.
The above description is only an embodiment of the present invention, and not intended to limit the scope of the present invention, and all modifications of equivalent structures and equivalent processes, which are made by the present specification, or directly or indirectly applied to other related technical fields, are included in the scope of the present invention.
Sequence listing
<110> Long alluvial gold region medical laboratory Co., Ltd
<120> primer composition, reagent, detection method and system for realizing accurate typing of vitamin D receptor TaqI site based on probe method
<130>0000
<160>4
<170>SIPOSequenceListing 1.0
<210>1
<211>20
<212>DNA
<213>Artificial sequence
<400>1
<210>2
<211>23
<212>DNA
<213>Artificial sequence
<400>2
gatgtacgtc tgcagtgtgt tgg 23
<210>3
<211>18
<212>DNA
<213>Artificial sequence
<400>3
gctgattgag gccatcca 18
<210>4
<211>18
<212>DNA
<213>Artificial sequence
<400>4
gctgatcgag gccatcca 18
Claims (7)
1. A primer composition for realizing accurate typing of a vitamin D receptor TaqI site based on a probe method comprises a primer and a probe which are designed according to polymorphism of a vitamin D receptor gene TaqI (rs731236) SNP site, and is characterized in that: the sequence is as follows:
VDR gene TaqI (rs731236) forward amplification primer:
CGTGCCCACAGATCGTCCTG；
VDR gene TaqI (rs731236) reverse amplification primer:
GATGTACGTCTGCAGTGTGTTGG；
VDR gene TaqI (rs731236) genotype T probe:
5’-GCTGATTGAGGCCATCCA-3’；
VDR gene TaqI (rs731236) genotype C probe:
5’-GCTGATCGAGGCCATCCA-3’。
2. the primer composition for realizing accurate typing of the vitamin D receptor TaqI site based on the probe method according to claim 1, which is characterized in that: the fluorescent group at the 5 'end of the genotype T probe is VIC, and the quenching groups at the 3' end of the genotype T probe are Quencher and MGB.
3. The primer composition for realizing accurate typing of the vitamin D receptor TaqI site based on the probe method according to claim 1, which is characterized in that: the fluorescent group at the 5 'end of the genotype C probe is FAM, and the quenching group at the 3' end of the genotype C probe is Quencher and MGB.
4. The primer composition for realizing accurate typing of the TaqI site of the vitamin D receptor based on the probe method according to any one of claims 1 to 3, wherein the primer composition comprises the following components in percentage by weight: the primer and the probe exist in the form of mixed solution, and the proportion is as follows: (the forward amplification primer: the reverse amplification primer: the genotype T probe: the genotype C probe: water) ═ 10:10:4:4: 192).
5. A reagent for realizing accurate typing of a vitamin D receptor TaqI site based on a probe method is characterized in that: comprises the primer composition for realizing the accurate typing of the TaqI site of the vitamin D receptor based on the probe method as claimed in any one of claims 1 to 4, and reagents required for carrying out Q-PCR reaction.
6. A detection method for realizing accurate typing of a vitamin D receptor TaqI site based on a probe method is characterized by comprising the following steps:
the method comprises the following steps: extracting to obtain DNA of a sample to be detected;
step two: carrying out reaction on the DNA of the sample to be detected, the primer composition for realizing accurate typing of the TaqI site of the vitamin D receptor based on the probe method as claimed in any one of claims 1 to 4 and a Q-PCR reaction reagent according to the steps of Q-PCR reaction.
7. A system for realizing accurate typing of a vitamin D receptor TaqI site based on a probe method is characterized by comprising the following steps:
the extraction module is used for extracting and obtaining DNA of a sample to be detected;
a detection module, which is used for carrying out reaction on the DNA of the sample to be detected, the primer composition for realizing accurate typing of the vitamin D receptor TaqI site based on the probe method as claimed in any one of claims 1 to 4 and a Q-PCR reaction reagent according to the step operation of Q-PCR reaction.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202010325748.4A CN111455029A (en) | 2020-04-23 | 2020-04-23 | Primer composition, reagent, detection method and system for realizing accurate typing of vitamin D receptor TaqI sites based on probe method |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202010325748.4A CN111455029A (en) | 2020-04-23 | 2020-04-23 | Primer composition, reagent, detection method and system for realizing accurate typing of vitamin D receptor TaqI sites based on probe method |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN111455029A true CN111455029A (en) | 2020-07-28 |
Family
ID=71674630
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202010325748.4A Pending CN111455029A (en) | 2020-04-23 | 2020-04-23 | Primer composition, reagent, detection method and system for realizing accurate typing of vitamin D receptor TaqI sites based on probe method |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN111455029A (en) |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101240326A (en) * | 2007-02-06 | 2008-08-13 | 上海主健生物工程有限公司 | Kit for detecting child lead poisioning inheritance susceptible risk |
| CN107287312A (en) * | 2017-07-07 | 2017-10-24 | 深圳市慢性病防治中心 | Molecular beacon probe and primer pair, VDR gene SNP s loci detection methods |
-
2020
- 2020-04-23 CN CN202010325748.4A patent/CN111455029A/en active Pending
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101240326A (en) * | 2007-02-06 | 2008-08-13 | 上海主健生物工程有限公司 | Kit for detecting child lead poisioning inheritance susceptible risk |
| CN107287312A (en) * | 2017-07-07 | 2017-10-24 | 深圳市慢性病防治中心 | Molecular beacon probe and primer pair, VDR gene SNP s loci detection methods |
Non-Patent Citations (2)
| Title |
|---|
| ISMAIL A. ABDUL-HASSAN等: "ASSOCIATION OF VITAMIN D RECEPTOR GENE POLYMORPHISM AT THREE SNPS AND THEIR HAPLOTYPES WITH POLYCYSTIC OVARY SYNDROME RISK IN IRAQI WOMEN" * |
| YOICHI TACHI等: "Relation of Bone Mass to Vitamin D Receptor Gene Polymorphism and Lifestyle Factors in Japanese Female College Students" * |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN108504749B (en) | 29 micro haplotype sites, screening method, composite amplification system and application | |
| CN108913757B (en) | Primer group and detection kit for chromosome aneuploid number abnormality and application thereof | |
| CN110317880B (en) | Molecular marker related to pig feed conversion rate, identification and application thereof | |
| CN106755360B (en) | Nucleic acid, kit and method for detecting human CYP2D6 gene polymorphism | |
| CN110257510A (en) | A kind of primer and probe and kit detecting APOE gene pleiomorphism | |
| CN104017887A (en) | Primer pair as well as probe and kit for detecting human BRAF gene mutation | |
| CN104830852A (en) | Multiplex real-time fluorescent PCR (polymerase chain reaction) method for detecting HLA-B*15:02 alleles | |
| CN111118138A (en) | Kit and method for detecting polymorphism of folate metabolism ability genes MTHFR and MTRR | |
| Jeong et al. | Association of bladder tumors and GA genotype of− 308 nucleotide in tumor necrosis factor-alpha promoter with greater tumor necrosis factor-alpha expression | |
| CN106755320B (en) | Nucleic acid, kit and method for detecting human OPRM1 gene A118G site polymorphism | |
| WO2019127928A1 (en) | Kit for detecting genetic variation in human chromosome 15q11-13 and application thereof | |
| CN104357578A (en) | New deafness associated gene mutation multi-site detecting system and reagent kit | |
| Luthra et al. | TaqMan RT-PCR assay coupled with capillary electrophoresis for quantification and identification of bcr-abl transcript type | |
| CN106834434B (en) | Nucleic acid, kit and method for detecting COX-1, COX-2 and GPIIIa gene polymorphism | |
| CN110564861A (en) | Fluorescence labeling composite amplification kit for human Y chromosome STR locus and InDel locus and application thereof | |
| CN111500700A (en) | Primer composition, reagent, detection method and system for simultaneously realizing accurate multi-site typing of vitamin D receptor based on SNE | |
| CN112176076A (en) | NFAT5 gene molecular marker related to goat growth traits and application thereof | |
| CN110863040A (en) | Method for detecting CYP3A5 gene polymorphism by fluorescent quantitative PCR | |
| CN111455029A (en) | Primer composition, reagent, detection method and system for realizing accurate typing of vitamin D receptor TaqI sites based on probe method | |
| CN110819709A (en) | Method for detecting CYP2C9 and VKORC1 gene polymorphism by fluorescent quantitative PCR (polymerase chain reaction) | |
| CN111593111A (en) | Primer composition, reagent, detection method and system for realizing accurate typing of BsmI (binding site) site of vitamin D receptor based on probe method | |
| CN111394452A (en) | Primer composition, reagent, detection method and system for realizing accurate typing of ApaI locus of vitamin D receptor based on probe method | |
| CN111593097A (en) | Primer composition, reagent, detection method and system for realizing accurate typing of vitamin D receptor Fok1 locus based on probe method | |
| CN105543403A (en) | Method for utilizing buffalo lactation related gene Leptin as molecular marker and application of method | |
| CN111394451B (en) | Insulin resistance gene polymorphism detection primer, application and kit thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination |