CN111450251B - Application of MTHFD1 inhibitor in inhibiting and killing virus - Google Patents

Application of MTHFD1 inhibitor in inhibiting and killing virus Download PDF

Info

Publication number
CN111450251B
CN111450251B CN202010208551.2A CN202010208551A CN111450251B CN 111450251 B CN111450251 B CN 111450251B CN 202010208551 A CN202010208551 A CN 202010208551A CN 111450251 B CN111450251 B CN 111450251B
Authority
CN
China
Prior art keywords
virus
mthfd1
influenza
inhibitor
disease
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Active
Application number
CN202010208551.2A
Other languages
Chinese (zh)
Other versions
CN111450251A (en
Inventor
谭旭
崔进
谭文杰
黄保英
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Tsinghua University
Original Assignee
Tsinghua University
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Tsinghua University filed Critical Tsinghua University
Priority to CN202010208551.2A priority Critical patent/CN111450251B/en
Priority to PCT/CN2020/082809 priority patent/WO2021189517A1/en
Publication of CN111450251A publication Critical patent/CN111450251A/en
Application granted granted Critical
Publication of CN111450251B publication Critical patent/CN111450251B/en
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Images

Classifications

    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K45/00—Medicinal preparations containing active ingredients not provided for in groups A61K31/00 - A61K41/00
    • A—HUMAN NECESSITIES
    • A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01N—PRESERVATION OF BODIES OF HUMANS OR ANIMALS OR PLANTS OR PARTS THEREOF; BIOCIDES, e.g. AS DISINFECTANTS, AS PESTICIDES OR AS HERBICIDES; PEST REPELLANTS OR ATTRACTANTS; PLANT GROWTH REGULATORS
    • A01N43/00—Biocides, pest repellants or attractants, or plant growth regulators containing heterocyclic compounds
    • A01N43/02—Biocides, pest repellants or attractants, or plant growth regulators containing heterocyclic compounds having rings with one or more oxygen or sulfur atoms as the only ring hetero atoms
    • A01N43/04—Biocides, pest repellants or attractants, or plant growth regulators containing heterocyclic compounds having rings with one or more oxygen or sulfur atoms as the only ring hetero atoms with one hetero atom
    • A01N43/22—Biocides, pest repellants or attractants, or plant growth regulators containing heterocyclic compounds having rings with one or more oxygen or sulfur atoms as the only ring hetero atoms with one hetero atom rings with more than six members
    • A—HUMAN NECESSITIES
    • A23—FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
    • A23L—FOODS, FOODSTUFFS, OR NON-ALCOHOLIC BEVERAGES, NOT COVERED BY SUBCLASSES A21D OR A23B-A23J; THEIR PREPARATION OR TREATMENT, e.g. COOKING, MODIFICATION OF NUTRITIVE QUALITIES, PHYSICAL TREATMENT; PRESERVATION OF FOODS OR FOODSTUFFS, IN GENERAL
    • A23L33/00—Modifying nutritive qualities of foods; Dietetic products; Preparation or treatment thereof
    • A23L33/10—Modifying nutritive qualities of foods; Dietetic products; Preparation or treatment thereof using additives
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/33—Heterocyclic compounds
    • A61K31/335—Heterocyclic compounds having oxygen as the only ring hetero atom, e.g. fungichromin
    • A61K31/365—Lactones
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
    • A61P31/12—Antivirals
    • A—HUMAN NECESSITIES
    • A23—FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
    • A23V—INDEXING SCHEME RELATING TO FOODS, FOODSTUFFS OR NON-ALCOHOLIC BEVERAGES AND LACTIC OR PROPIONIC ACID BACTERIA USED IN FOODSTUFFS OR FOOD PREPARATION
    • A23V2002/00—Food compositions, function of food ingredients or processes for food or foodstuffs
    • Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
    • Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
    • Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
    • Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
    • Y02A50/30—Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • General Health & Medical Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Animal Behavior & Ethology (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Engineering & Computer Science (AREA)
  • Epidemiology (AREA)
  • Dentistry (AREA)
  • Food Science & Technology (AREA)
  • Pest Control & Pesticides (AREA)
  • Agronomy & Crop Science (AREA)
  • Wood Science & Technology (AREA)
  • Zoology (AREA)
  • Environmental Sciences (AREA)
  • Mycology (AREA)
  • Nutrition Science (AREA)
  • Plant Pathology (AREA)
  • Polymers & Plastics (AREA)
  • Virology (AREA)
  • Communicable Diseases (AREA)
  • Oncology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Organic Chemistry (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)

Abstract

The invention relates to the technical field of medicines, and particularly discloses application of an MTHFD1 inhibitor in inhibiting and killing viruses. Experiments show that MTHFD1 is a potential broad-spectrum antiviral target, and the inhibitor (particularly carolacton and derivatives thereof) can effectively and broadly inhibit the proliferation of viruses (such as influenza viruses, coronaviruses, mumps viruses, Zika viruses and the like), and has a very good application prospect in the field of antiviral.

Description

Application of MTHFD1 inhibitor in inhibiting and killing virus
Technical Field
The invention relates to the technical field of medicines, in particular to application of an MTHFD1 inhibitor (particularly carolacton and derivatives thereof) in inhibiting and killing viruses.
Background
Many important infectious diseases in humans are caused by viruses. These diseases include rabies, smallpox, polio, hepatitis, pneumonia, yellow fever, immunodeficiency and various encephalitis diseases, many of which are highly contagious and produce acute discomfort and are often fatal, others such as rubella and cytomegalovirus cause congenital malformations. Coronaviruses are a large family of viruses known to infect the upper Respiratory and gastrointestinal tracts of mammals and birds, which can cause colds and more Severe diseases such as Middle East Respiratory Syndrome (MERS) and Severe Acute Respiratory Syndrome (SARS).
On 10.2.2020, the coronavirus research group (CSG) of the international committee for classification of viruses published the latest paper on the platform of preprinting of life science paper on the name of new coronavirus, which was formally renamed from "2019-nCov" to "SARS-CoV 2". The world health organization formally named the Disease caused by this Virus as COVID-19(Corona Virus Disease 2019).
Although the situation of the current domestic epidemic situation is changed well and the 'zero clearing' of cases is realized in a plurality of cities, except China, epidemic situations occur in more than one hundred and fifty countries and regions (such as Italy, Iran, Spain and the like) in the global scope, input cases occur in many places in China, the work of epidemic situation prevention and control cannot be relaxed, and the research and development of corresponding antiviral drugs are particularly important.
Methylenetetrahydrofolate dehydrogenase 1 (NADP + dependent)1, MTHFD1) encodes only a single protein with the activity of 3 enzymes (5,10 methylenetetrahydrofolate dehydrogenase, 5,10 methenyltetrahydrofolate cyclohydrolase and 10 formate tetrahydrofolate synthetase), which play a crucial role in folate metabolism. There is no report on the antiviral study of MTHFD 1.
Disclosure of Invention
The invention provides an application of an MTHFD1 inhibitor in preparing a product for inhibiting and/or killing viruses.
Specifically, the MTHFD1 inhibitor may be an antibody or an antigen-binding fragment thereof, an interfering RNA, or a small molecule compound.
Specifically, the antigen-binding fragment may be selected from: fab, Fab ', F (ab)2, Fv, dsFv, scFv, Fd and Fd' fragments, and the like.
Specifically, the interfering RNA may be selected from: siRNA, dsRNA, shRNA, airRNA, miRNA and combinations thereof.
In one embodiment of the present invention, the small molecule compound may be selected from: methotrexate, pemetrexed, trimetrexate, edatrexate, lometrexol, 5-fluorouracil, pralatrexate, aminopterin and one or more of its salts, solvates, stereoisomers, ethers, esters, prodrugs, and the like.
In another embodiment of the present invention, the small molecule compound may have the following structure:
Figure BDA0002422019140000031
wherein the content of the first and second substances,
Figure BDA0002422019140000032
represents a single or double bond;
R1、R3and R4Independently selected from: H. C1-C12 alkyl, C7-C12 aryl;
R2selected from: H. C1-C12 alkyl, C7-C12 aromatic hydrocarbon group and OR8(ii) a Wherein R is8Selected from: H. C1-C12 alkyl, C7-C12 aryl;
R5、R6and R7Independently selected from: H. C1-C12 alkyl.
In one embodiment of the invention, R1Is H.
In another embodiment of the invention, R1Selected from C1-C6 alkyl, especially C1-C3 alkyl; in one embodiment of the invention, R1Is methyl.
In one embodiment of the invention, R3Is H.
In another embodiment of the invention, R3Selected from C1-C6 alkyl, especially C1-C3 alkyl; in one embodiment of the invention, R3Is methyl.
In one embodiment of the invention, R4Is H.
In another embodiment of the invention, R4Selected from C1-C6 alkyl, especially C1-C3 alkyl; in one embodiment of the invention, R4Is methyl.
In one embodiment of the invention, R2Is OR8。
In one embodiment of the invention, R2Is OH.
Specifically, R5Selected from C1-C6 alkyl, especially C1-C3 alkyl; in one embodiment of the invention, R5Is methyl.
Specifically, R6Selected from C1-C6 alkyl, especially C1-C3 alkyl; in one embodiment of the invention, R6Is methyl.
Specifically, R7Selected from C1-C6 alkyl, especially C1-C3 alkyl; in one embodiment of the invention, R7Is methyl.
In one embodiment of the present invention, the bond connecting C-15 and C-16 is a single bond, and C-15 and C-16 are saturated with hydrogen atoms.
In another embodiment of the present invention, the bond linking C-15 and C-16 is a double bond.
In one embodiment of the present invention, the bond connecting C-7 and C-8 is a single bond, and C-7 and C-8 are saturated with hydrogen atoms.
In another embodiment of the present invention, the bond linking C-7 and C-8 is a double bond.
Specifically, the MTHFD1 inhibitor has the following structure:
Figure BDA0002422019140000041
wherein R is1、R2、R3、R4、R5、R6And R7Having the above definitions of the invention.
Specifically, the MTHFD1 inhibitor has the following structure:
Figure BDA0002422019140000051
wherein R is1、R2、R5、R6And R7Having the above definitions of the invention.
More specifically, the above MTHFD1 inhibitor has the following structure:
Figure BDA0002422019140000052
wherein R is2、R5、R6And R7Having the above definitions of the invention.
In one embodiment of the present invention, the MTHFD1 inhibitor has the following structure:
Figure BDA0002422019140000053
specifically, the above MTHFD1 inhibitor is carolacton, which has the following structure:
Figure BDA0002422019140000061
specifically, the above-mentioned MTHFD1 inhibitor may also have the following structure:
Figure BDA0002422019140000062
Figure BDA0002422019140000071
the Carolacton derivative of the present invention can be obtained by, for example, the method described in WO2018220176a 1.
Specifically, the virus may be selected from the group consisting of adenoviridae, herpesviridae (e.g., EBV), papovaviridae, picornaviridae, poxviridae (e.g., variola virus), hepadnaviridae (e.g., hepatitis B virus), coronaviridae (e.g., HCoV-229E, HCoV-OC43, HCoV-NL63, HCoV-HKU1, SARS-CoV, MERS-CoV, SARS-CoV-2, etc.), Ponaviridae, filoviridae (e.g., Ebola virus), orthomyxoviridae (e.g., influenza virus), paramyxoviridae, retroviridae (e.g., HIV), reoviridae, rhabdoviridae (e.g., rabies virus), flaviviridae, etc.
In one embodiment of the present invention, the virus is a coronavirus, specifically HCoV-229E, HCoV-OC43, HCoV-NL63, HCoV-HKU1, SARS-CoV, MERS-CoV, SARS-CoV-2, and the like.
In another embodiment of the present invention, the virus is an orthomyxovirus, such as an influenza virus (e.g., influenza a virus, influenza b virus, influenza c virus, etc.).
In another embodiment of the present invention, the virus is a paramyxovirus, such as Human Parainfluenza Virus (HPV) type 1, HPV type 2, HPV type 3, HPV type 4, Sendai virus, mumps virus, measles virus, respiratory syncytial virus, Newcastle disease virus, and the like.
In another embodiment of the present invention, the virus is a flavivirus, such as dengue virus, Zika virus, Japanese encephalitis virus, chikungunya virus, yellow fever virus, hepatitis C virus, West Nile virus, and the like.
In particular, the above products may be used for diagnostic or therapeutic purposes, but also for non-diagnostic or therapeutic purposes.
Specifically, the inhibition and/or killing of the above viruses may be performed in vivo or in vitro.
In one embodiment of the present invention, the above product is a pharmaceutical composition.
In particular, in the above pharmaceutical compositions, the MTHFD1 inhibitor may be used as the sole active ingredient, or may be used in combination with one or more other active ingredients for the same or different indications, wherein the MTHFD1 inhibitor and the other active ingredients may be formulated for simultaneous, separate or sequential administration (simultaneous or sequential administration).
Specifically, the pharmaceutical composition further comprises pharmaceutically acceptable auxiliary materials.
Specifically, the pharmaceutically acceptable excipients may include sweetening agents (specifically, sucrose, xylitol, fructo-oligosaccharide, sodium cyclamate, stevioside, aspartame, etc.), flavoring agents (such as flavors, essences, etc.), mucilage agents (specifically, sodium alginate, acacia, gelatin, methylcellulose, sodium carboxymethylcellulose, etc.), clarifying agents (specifically, chitosan, gelatin, etc.), preservatives (specifically, benzoic acid and its salts, sorbic acid and its salts, parabens series, etc.), disintegrating agents (specifically, low-substituted hydroxypropylcellulose, crospovidone, sodium starch glycolate, croscarmellose sodium, starch, etc.), binders (specifically, hydroxypropylcellulose, hypromellose, povidone, copovidone, pregelatinized starch, etc.), lubricants (specifically, stearic acid, magnesium stearate, sodium fumarate, etc.), and the like, One or more of a wetting agent (specifically, polyoxyethylene sorbitan fatty acid ester, poloxamer, polyoxyethylene castor oil derivative, etc.), a suspending agent (specifically, hypromellose, hydroxypropyl cellulose, povidone, copovidone, sodium carboxymethyl cellulose, methyl cellulose, etc.), a stabilizer (specifically, citric acid, fumaric acid, succinic acid, etc.), a filler (specifically, starch, sucrose, lactose, microcrystalline cellulose, etc.), a binder (specifically, cellulose derivative, alginate, gelatin, polyvinylpyrrolidone, etc.), and the like.
Specifically, the above-mentioned pharmaceutical composition may be in any dosage form or administration form, particularly oral dosage form, and those skilled in the art may select it as the case may be, including, but not limited to, tablets (including sugar-coated tablets, film-coated tablets, sublingual tablets, orally disintegrating tablets, buccal tablets, etc.), pills, powders, granules, capsules (including soft capsules, microcapsules), troches, syrups, solutions, emulsions, suspensions, controlled release preparations (e.g., immediate release preparations, sustained release microcapsules), aerosols, films (e.g., orally disintegrating films, oral mucosa-adhering films), injections (e.g., subcutaneous injections, intravenous injections, intramuscular injections, intraperitoneal injections), intravenous drip injections, transdermal absorption preparations, ointments, lotions, adhesive preparations, suppositories (e.g., rectal suppositories, oral administration forms, etc.), oral preparations, and the like, Pessaries), pellets, nasal preparations, pulmonary preparations (inhalants), eye drops, and the like, oral or parenteral preparations (e.g., intravenous, intramuscular, subcutaneous, intraorgan, intranasal, intradermal, instillation, intracerebral, intrarectal, and the like administration forms, administration to the vicinity of a lesion and administration directly to the lesion).
In another embodiment of the present invention, the above product is a functional food composition.
In particular, the MTHFD1 inhibitor may be used as the sole active ingredient in the functional food composition described above, or may be used in combination with one or more other active ingredients.
Specifically, the functional food composition may further comprise food adjuvants.
Specifically, the functional food composition may be in any form, such as tablets, pills, capsules (e.g., soft capsules, microcapsules), candies (e.g., tabletted candies, gel candies, gum-based candies, etc.), solid beverages (e.g., powders, granules, etc.), liquid beverages, etc.
The above various forms of the functional food composition can be prepared according to conventional production methods in the field of functional foods.
In another embodiment of the present invention, the product is a disinfectant product.
Specifically, the MTHFD1 inhibitor can be used as the sole active ingredient in the disinfectant product, or can be used in combination with one or more other active ingredients (e.g., chlorine-containing disinfectant, alcohol disinfectant, quaternary ammonium salt disinfectant, peroxide disinfectant, etc.).
Specifically, the disinfection product can be a medical disinfection product, and can also be a daily household disinfection product.
Specifically, the disinfection product also comprises disinfection product auxiliary materials, such as one or more of a humectant, an excipient, an aromatizer, a thickener, a pH regulator, a skin feeling regulator, a stabilizer, a buffering agent and the like.
Specifically, the disinfection product can be in any form of spray, powder, solution, gel, paste, jelly and the like related to medical pharmaceutical preparations, can also be made into forms of washing liquid (such as hand sanitizer and laundry detergent), toothpaste, contact lens care solution and the like, and can also be attached to the solid surface of a sanitary or cleaning article in a coating or dipping way, and the sanitary or cleaning article can be a sanitary or cleaning glove, a paper towel or paper, a cotton swab, a dust cover or a medical mask and the like.
In particular, the above disinfectant products can be used for skin, hair, clothes, home furnishings, and the like.
The invention also provides application of the MTHFD1 inhibitor in preparing a medicament for preventing and/or treating diseases or symptoms caused by or related to viral infection.
In particular, in the above applications, the MTHFD1 inhibitor has the structure shown in formula I above; more specifically, the MTHFD1 inhibitor has the structure of formula V, and particularly formula VI, described above in this invention.
Specifically, the disease or condition may include one or more of acute bronchitis, chronic bronchitis, rhinitis, sinusitis, croup, acute bronchiolitis, pharyngitis, tonsillitis, parotitis, laryngitis, tracheitis, asthma, pneumonia, influenza, Zika virus disease, and the like.
In one embodiment of the invention, the disease is COVID-19.
In one embodiment of the present invention, the disease is influenza.
In one embodiment of the present invention, the disease is parotitis.
In one embodiment of the present invention, the disease is Zika virus disease.
The present invention also provides a method for preventing and/or treating a disease or condition caused by or associated with a viral infection, comprising the step of administering to a subject an effective amount of the aforementioned MTHFD1 inhibitor of the present invention.
In particular, in the above applications, the MTHFD1 inhibitor has the structure shown in formula I above; more specifically, the MTHFD1 inhibitor has the structure of formula V, and particularly formula VI, described above in this invention.
Specifically, the disease or condition may include one or more of acute bronchitis, chronic bronchitis, rhinitis, sinusitis, croup, acute bronchiolitis, pharyngitis, tonsillitis, parotitis, laryngitis, tracheitis, asthma, pneumonia, influenza, Zika virus disease, and the like.
In one embodiment of the invention, the disease is COVID-19.
In one embodiment of the present invention, the disease is influenza.
In one embodiment of the present invention, the disease is parotitis.
In one embodiment of the present invention, the disease is Zika virus disease.
Specifically, the subject is an animal; in one embodiment of the present invention, the subject is a mammal, such as human, monkey, ape, cow, horse, pig, seal, etc.; in another embodiment of the present invention, the subject is an avian, such as a chicken.
The invention also provides the use of disruption of MTHFD1 for inhibiting and/or killing viruses. In particular, disruption of MTHFD1 can be achieved by inhibition by antibodies or antigen-binding fragments thereof, interfering RNA or small molecule compounds, or by methods of gene editing (e.g., knocking-out or knocking-down gene disruption of MTHFD1 expression).
The inventor of the invention finds that MTHFD1 is a potential broad-spectrum antiviral target through experiments, and the inhibitor (particularly carolacton) can effectively and broadly inhibit the proliferation of viruses (such as influenza viruses, coronaviruses, mumps viruses, Zika viruses and the like), and has a very good application prospect in the field of antivirus.
Drawings
FIG. 1 shows the results of the knockdown MTHFD1 inhibition of influenza virus replication. The MTHFD1 gene is knocked out in 293T cells by using CRISPR Cas9 technology, then an MTHFD1 knocked-out cell line is infected by influenza virus, and the amount of virus protein is detected by western blot.
FIG. 2 is a diagram showing the function of MTHFD1 gene in a carbon metabolism pathway. The MTHFD1 gene has 3 different catalytic activity enzymes, and the catalytic synthetic products can be used for purine, dTMP and methionine synthesis.
FIG. 3 shows the results that the level of viral replication in the MTHFD1 knockout cell line can be rescued by exogenously added inosine. Inosine, beta-thymidine and 5-methyltetrahydrofolate were supplemented separately in the MTHFD1 gene knock-out 293T cell line, followed by co-infection with influenza virus. Influenza virus protein levels were detected by the western blot method.
FIG. 4 shows the results of MTHFD1 gene knock-out inhibiting the replication of influenza virus genomic RNA. Wherein, a: after influenza virus infects a control cell (containing a normal MTHFD1 gene) and an MTHFD1 knock-out cell line, sampling at different infection time points, extracting total RNA, performing reverse transcription to obtain cDNA, and detecting the level of influenza virus genome RNA by real time PCR; b: influenza replicon experimental results. The 3 subunits, PB1, PB2 and PA, capable of expressing influenza virus polymerase, and influenza NP proteins were co-transfected simultaneously in control cells or a MTHFD1 knock-out cell line, while plasmids capable of expressing influenza virus negative strand genomic RNA (hemagglutinin fragments) were co-transfected. Samples were taken at various time points post-transfection and protein levels of Hemagglutinin (HA) were detected by western blot. The protein level of HA represents the level of influenza virus genome replication.
FIG. 5 shows the results of siRNA knockdown of MTHFD1 gene to inhibit replication of mumps virus and Zika virus (ZIKV). Wherein, a: the inhibition result of the siRNA to the mumps virus replication after knocking down the MTHFD1 gene; b: inhibition of zika virus replication by siRNA knockdown of MTHFD1 gene; c: knockdown results of siRNA.
FIG. 6 shows the results of the inhibition of replication of mumps virus and Zika virus by shRNA after knocking down MTHFD1 gene. Wherein, a: the shRNA suppresses the replication of mumps virus after knocking down MTHFD1 gene; b: inhibition of shRNA replication against Zika virus after knocking down MTHFD1 gene; c: knockdown results of shRNA.
FIG. 7 shows the result of inhibition of SARS-CoV2 by carolacton, an inhibitor of MTHFD1 gene. Different concentrations of the inhibitor carolacton of the MTHFD1 gene were added to Vero cells and subsequently infected with SARS-CoV 2. And after the virus is infected for 48 hours, collecting the supernatant, extracting virus RNA, and detecting the virus level through RT-qPCR. The left Y-axis represents the level of viral inhibition by the inhibitor. After treatment of cells with the same inhibitor, the toxicity of the drug to the cells was examined by MTT assay, and the right Y-axis represents the cytotoxicity of the inhibitor.
FIG. 8 shows the results of inhibition of Zika virus and mumps virus by carolacton, an inhibitor of MTHFD1 gene. Different concentrations of the inhibitor carolacton of MTHFD1 gene were added to bat kidney cells (PaKi), followed by infection with zika virus and mumps virus, respectively. After 48h of virus infection, the virus infection rate was determined by immunofluorescence. The left Y-axis represents the level of viral inhibition by the inhibitor. After treatment of cells with the same inhibitor, the toxicity of the drug to the cells was examined by MTT assay, and the right Y-axis represents the cytotoxicity of the inhibitor.
Fig. 9 shows the results of inosine rescue experiments, which indicate that the inhibition of mumps virus by carolacton, an inhibitor of MTHFD1 gene, can be counteracted by exogenously added inosine.
FIG. 10 shows the results of inosine rescue experiments, which indicate that the inhibition of Zika virus by carolacton, an inhibitor of MTHFD1 gene, can be counteracted by exogenously added inosine.
Detailed Description
Unless defined otherwise, all scientific and technical terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention pertains.
In the present invention, the term "MTHFD 1 inhibitor" refers to a molecule that has an inhibitory effect on MTHFD1, including but not limited to: inhibiting the activity of MTHFD1, and inhibiting the transcription or expression of MTHFD1 gene. The MTHFD1 inhibitor includes, but is not limited to, an antibody or antigen binding fragment thereof, interfering RNA, small molecule compounds, and the like.
Inhibition of MTHFD1 activity means a decrease in MTHFD1 activity; specifically, MTHFD1 activity was reduced by at least 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 99%, or even 100% compared to prior to inhibition.
The inhibition of the transcription or expression of MTHFD1 gene refers to: the gene of MTHFD1 is not transcribed, the transcription activity of the gene of MTHFD1 is reduced, the gene of MTHFD1 is not expressed, or the expression activity of the gene of MTHFD1 is reduced.
The skilled person can use routine methods to regulate the transcription or expression of MTHFD1 gene, such as gene knock-out, homologous recombination, interfering RNA, etc.
Inhibition of gene transcription or expression of MTHFD1 can be verified by detecting the expression level by PCR, Western Blot, or other experimental means.
Preferably, the transcription or expression of the MTHFD1 gene is reduced by at least 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 99%, in particular the MTHFD1 gene is not expressed at all, compared to the wild type.
In the present invention, the term "alkyl" refers to a hydrocarbon chain radical which is linear or branched and does not contain unsaturated bonds, and which is linked to the rest of the molecule by a single bond. Typical alkyl groups contain 1 to 12, 1 to 8, 1 to 6, or 1 to 3 carbon atoms, such as methyl, ethyl, n-propyl, isopropyl, n-butyl, isobutyl, tert-butyl, n-pentyl, isopentyl, n-hexyl, isohexyl, n-heptyl, isoheptyl, and the like. Alkyl groups may be substituted, for example, if the alkyl group is substituted with cycloalkyl, it is correspondingly "cycloalkylalkyl", such as cyclopropylmethyl; if an alkyl group is substituted with a halogen, it is correspondingly "haloalkyl"; if an alkyl group is substituted with an aryl group, it is correspondingly "aralkyl", such as benzyl, benzhydryl or phenethyl; if an alkyl group is substituted with a heterocyclyl group, then it is correspondingly "heterocyclylalkyl"; and the like.
"arylalkyl" refers to a hydrocarbyl group containing a benzene ring structure; "hydrocarbyl" refers to a group containing only carbon and hydrogen atoms, and generally refers to a radical remaining after a corresponding hydrocarbon has lost one hydrogen atom.
The above groups may be substituted in one or more available positions by one or more suitable groups such as: OR ',' O, SR ', SOR', SO2R'、OSO2R'、OSO3R'、NO2、 NHR'、N(R')2、＝N-R'、N(R')COR'、N(COR')2、N(R')SO2R'、 N(R')C(＝NR')N(R')R'、N3CN, halogen, COR ', COOR', OCOR ', OCOOR', OCONHR ', OCON (R')2、CONHR'、CON(R')2、CON(R')OR'、CON(R')SO2R'、 PO(OR')2、PO(OR')R'、PO(OR')(N(R')R')、C1-C12Alkyl radical, C3-C10Cycloalkyl radical, C2-C12Alkenyl radical, C2-C12Alkynyl, aryl and heterocyclyl, wherein each R' group is independently selected from: hydrogen, OH, NO2、NH2SH, CN, halogen, COH, COalkyl, COOH, C1-C12Alkyl radical, C3-C10Cycloalkyl radical, C2-C12Alkenyl radical, C2-C12Alkynyl, aryl and heterocyclyl. Where these groups are themselves substituted, the substituents may be selected from the foregoing list.
"alkenyl" refers to a straight or branched hydrocarbon chain radical containing at least two carbon atoms, at least one unsaturated bond, and which is attached to the rest of the molecule by a single bond. Typical alkenyl groups contain 2 to 12, 2 to 8, 2 to 6 or 2 to 3 carbon atoms, such as ethenyl, 1-methyl-ethenyl, 1-propenyl, 2-propenyl or butenyl.
"alkynyl" refers to a straight or branched hydrocarbon chain radical containing at least two carbon atoms, at least one carbon-carbon triple bond, and which is attached to the rest of the molecule by a single bond. Typical alkynyl groups contain 2 to 12, 2 to 8, 2 to about 6 or 2 to 3 carbon atoms, such as ethynyl, propynyl (e.g., 1-propynyl, 2-propynyl) or butynyl (e.g., 1-butynyl, 2-butynyl, 3-butynyl).
"cycloalkyl" refers to an alicyclic hydrocarbon. Typical cycloalkyl groups contain 1 to 4 single and/or fused rings, 3 to 18 carbon atoms, such as 3 to 10 carbon atoms or 3 to about 6 carbon atoms, such as cyclopropyl, cyclohexyl.
"aryl" refers to a monocyclic or polycyclic radical, including polycyclic radicals containing monoaryl groups and/or fused aryl groups. Typical aryl groups contain 1 to 3 mono-or fused rings and 6 to 18 carbon ring atoms, preferably 6 to 14 carbon ring atoms, such as phenyl, naphthyl, biphenyl, indenyl, phenanthryl or anthracyl radicals.
"Heterocyclyl" includes heteroaromatic and heteroalicyclic groups containing 1 to 3 single and/or fused rings and 3 to 18 ring atoms. Specifically, heteroaromatic groups and heteroalicyclic groups contain from 5 to about 10 ring atoms. Suitable heteroaryl groups may contain 1, 2 or 3 heteroatoms selected from N, O or S atoms.
The term "salt" is to be understood as any form of the compound according to the invention, wherein said compound is in ionic form or is charged and coupled with an oppositely charged ion (cation or anion) or is in solution. Also included within this definition are quaternary ammonium salts and complexes of the molecule with other molecules and ions, particularly complexes formed by ionic interactions.
The term "solvate" is understood to mean any form of the compound of the invention in which the compound is attached to another molecule by non-covalent bonds (usually a polar solvent), including in particular hydrates and alcoholates, such as methanolate. In particular, solvates are hydrates.
The term "prodrug" is used in its broadest sense and encompasses derivatives that are convertible in vivo to the compounds of the invention. Examples of prodrugs include, but are not limited to, derivatives and metabolites of the compound, including biohydrolyzable moieties such as biohydrolyzable amides, biohydrolyzable esters, biohydrolyzable carbamates, biohydrolyzable carbonates, biohydrolyzable ureides, and biohydrolyzable phosphate analogs. Preferably, the prodrug having a carboxyl functional group is a lower alkyl ester of a carboxylic acid. The carboxylic acid esters are readily esterified from any carboxylic acid moiety present in the molecule. Prodrugs can generally be prepared by known methods, such as those described in Burger "Medicinal Chemistry and Drug Discovery sixth edition (Donald J. Abraham ed., 2001, Wiley) and" Design and Applications of drugs "(H. Bundgaard ed., 1985, Harwood Academic Publishers).
Any reference herein to a compound is intended to represent such a particular compound, and certain variations or forms thereof. In particular, the compounds referred to herein may have asymmetric centers and thus exist in different enantiomeric or diastereomeric forms. Thus, any given compound referred to herein represents any one of the racemates, one or more enantiomeric forms, one or more diastereomeric forms, and mixtures thereof. Likewise, stereoisomers or geometric isomers of the double bond may also be present, whereby in some cases the molecule may exist as the (E) -isomer or as the (Z) -isomer (trans and cis isomers). If a molecule contains multiple double bonds, each double bond will have its own stereoisomerism, which may be the same or different from that of the other double bonds of the molecule. In addition, the compounds referred to herein may exist as atropisomers. All stereoisomers of the compounds referred to herein, including enantiomers, diastereomers, geometric isomers and atropisomers, and mixtures thereof, are within the scope of the invention.
Furthermore, any of the compounds referred to herein may exist in tautomeric forms. In particular, the term tautomer refers to one of two or more structural isomers of a compound, which isomers are in equilibrium and may be interconverted. Common tautomeric pairs are enamine-imine, amide-imidic acid, keto-enol, lactam-lactam imide, and the like.
Unless otherwise indicated, the compounds of the present invention may also include isotopically-labeled forms, i.e., compounds differing only in the presence of one or more isotopically-enriched atoms. E.g. with replacement of at least one hydrogen atom by deuterium or tritium only, or with enrichment13C or14C instead of at least one carbon, or enriched with15Compounds of the prior art wherein nitrogen of N replaces at least one nitrogen are included within the scope of the present invention.
The compounds described in the present invention or salts, solvates, stereoisomers, ethers, esters thereof are preferably in a pharmaceutically acceptable form. By "pharmaceutically acceptable" is meant that the molecular entities, and compositions comprising the same, do not produce adverse, allergic, or other untoward reactions when properly administered to a subject.
The technical solutions of the present invention will be described clearly and completely with reference to the following embodiments of the present invention, and it should be understood that the described embodiments are only a part of the embodiments of the present invention, and not all of the embodiments. All other embodiments, which can be derived by a person skilled in the art from the embodiments given herein without making any creative effort, shall fall within the protection scope of the present invention.
Example 1
Materials and methods
1. Construction of MTHFD1 knockout cell line
1.1 construction of sgRNA expression vector
sgRNA primer sequences:
forward primer 5'-caccg AAGGGGAGTGGATCAAACCT-3' of sgMTHFD 1-1;
sgMTHFD1-1 reverse primer: 5'-aaac AGGTTTGATCCACTCCCCTT c-3', respectively;
sgMTHFD1-2 forward primer: 5'-caccg GAGGTTATTAGCTGCAGTGA-3', respectively;
sgMTHFD1-2 reverse primer: 5'-aaac TCACTGCAGCTAATAACCTC c-3' are provided.
The synthetic sgRNA primer sequences were phosphorylated by treatment with T4 polynucleotide kinase at 37 ℃ for 30 minutes, denatured at 95 ℃ for 5 minutes, annealed at 1.5 ℃/minute to 25 ℃ to give double-stranded DNA fragments with BsmBI (or BbsI) sticky ends as follows:
forward direction: 5' -CACCGNNNNNNNNNNNNNNNNNNNN;
and (3) reversing: CNNNNNNNNNNNNNNNNNNNNCAAA-5'.
The phosphorylation, denaturation and annealing systems were:
1 μ l of 100 μ M forward oligonucleotide strand;
1 μ l of 100 μ M reverse oligonucleotide strand;
1μl 10×T4Ligation Buffer(NEB)；
6.5μl ddH2O；
0.5 μ l T4 polynucleotide kinase.
The double-stranded DNA fragment is connected with a LentiGuidiepuro vector cut by BmbI, the connection product is transformed into stbl3 competent cells, the competent cells are coated on an LB plate with ampicillin resistance, positive colonies are screened, positive colony plasmids are extracted for analysis and sequencing, and the success of construction of sgRNA expression vectors is determined and named sgMTHFD1-1 and sgMTHFD 1-2.
1.2 construction of MTHFD1 knockout cell line
293T cells plated in 6-well cell culture plates, 7X105Cells per well. After overnight culture, the MTHFD1 sgRNA plasmid and the Cas9 expressing plasmid were transfected. After 48h of transfection, cells were passaged and positive cells transfected and expressing successfully were selected by puromycin and blestic idin. Approximately one week after screening (all untransfected control cells die), the cells were trypsinized, counted and plated in 96-well plates, and 100. mu.M hypoxanthine and 16. mu.M beta-thymidine were added to the medium. After about 2 weeks, cells were grown and transferred to 24-well plates, or 6-well plates. The MTHFD1 protein level was detected by western blot and cell lines that were successfully knocked out were selected for use.
2、Western blot
After the cells were collected, they were lysed on ice using RIPA lysate (Beyotime, P0013C). The supernatant was centrifuged at 12000rpm at 4 ℃ for 10min, and after adding a loading buffer, it was placed in a water bath at 95 ℃ for 10 min. Proteins were separated by 10% SDS-PAGE and transferred to PVDF membrane, 5% skim milk (PBST configuration) blocked for 1h at room temperature, and antibodies to the respective proteins were incubated. anti-MTHFD1(Proteintech, 10794-1-AP), anti- β actin (Easybio, BE0022), anti-PR8M1(Genetex, GTX125928-S), anti-HA (H1N1) (Genetex, GTX 117951-S). Bands of interest were detected by an exposure apparatus using HRP conjugated secondary antibodies.
3、Real time PCR
After RNA was extracted using the kit, cDNA was obtained by reverse transcription. Influenza virus RNA was reverse transcribed using specific primers. A SYBR Green qPCR master mix (Vazyme, Q311-02) was used for real time PCR. Detection was performed using a Bio-Rad CFX96 fluorescent quantitation PCR instrument.
The primer sequences are as follows:
human GAPDH forward primer: 5'-ACAACTTTGGTATCGTGGAAGG-3', respectively;
human GAPDH reverse primer: 5'-GCCATCACGCCACAGTTTC-3', respectively;
influenza forward primer: 5'-TTCTAACCGAGGTCGAAACGTACG-3', respectively;
influenza reverse primer: 5'-ACAAAGCGTCTACGCTGCAG-3', respectively;
influenza virus specific reverse transcription primers: 5 '-AGCRAAAGCAGG-3';
alecto ACTIN forward primer 5'-gccagtctacaccgtctgcag-3';
alecto ACTIN reverse primer 5'-cgtaggaatccttctggcccatg-3';
alecto MTHFD1 forward primer 5'-gggagcgactgaagaaccaag-3';
alecto MTHFD1 reverse primer 5'-tcttcagcagccttcagcttcac-3';
a ZIKV NS5 forward primer 5'-GGTCAGCGTCCTCTCTAATAAACG-3';
ZIKV NS5 reverse primer 5'-GCACCCTAGTGTCCACTTTTTCC-3'.
4. Influenza virus replicon assay
Control 293T cells (MTHFD1 Normal expression) and MTHFD1 knock-out 293T cell lines were plated in 12-well plates, 2X10 per well5A cell. After overnight incubation in medium containing 100. mu.M hypoxanthine and 16. mu.M β -thymidine, 3 subunits of influenza polymerase, PB1, PB2 and PA, and influenza NP protein were transfected, while a plasmid expressing influenza minus-strand genomic RNA (hemaglutinin fragment) was co-transfected. The medium was changed to hypoxanthine and beta-thymidine free medium before transfection, samples were taken at different time points after transfection, and the protein level of Hemagglutinin (HA) was determined by western blot. The protein level of HA represents the level of influenza virus genome replication.
5.MTHFD1 inhibitor assay
5.1 for SARS-CoV2 inhibition experiments, Vero cells were plated in 96-well plates at 10000 cells/well and cultured overnight to form a monolayer of cells. DMEM medium was changed to 2% FBS, and 0, 0.05. mu.M, 0.1. mu.M, 0.2. mu.M, 0.4. mu.M, and 0.8. mu.M carolacton were added, respectively. A total of 100. mu.l of inhibitor-containing medium was added to each well. After 1h of treatment, virus SARS-CoV2 was added and the virus was diluted with 2% FBS DMEM medium in 100. mu.l per well. And collecting the supernatant after 48h of virus infection to extract RNA, and determining the virus amount.
For the zika virus and mumps virus inhibition experiments, bat (p.aleco) kidney cells PaKi were plated in 96-well plates, 3000 cells per well. After overnight incubation, 0, 0.03. mu.M, 0.06. mu.M, 0.125. mu.M, 0.25. mu.M, 0.5. mu.M, 1. mu.M carolacton, respectively, was added. Zika virus and mumps virus were added simultaneously. For inosine rescue experiments, inosine was supplemented at this step. After the virus is infected for 48 hours, the infection rate is detected and analyzed by a high content imaging system.
5.2 cytotoxicity assay of inhibitors (drugs) by MTT assay. Cells were prepared and inhibitors were added according to the procedure of method 5.1. After 48h of further cell culture, the supernatant was discarded, 90. mu.l of fresh medium and 10. mu.l of MTT (Solarbio) were added, and after 4h of further cell culture, the supernatant was discarded, dissolved in 110. mu.l of DMSO, and the OD490nm absorbance was measured.
6. Immunofluorescence detection of viral infection rate
Virus infected cells were fixed with 4% paraformaldehyde solution for 10min at room temperature, permeabilized with 0.2% Triton X-100 for 10min at room temperature, washed 3 times with PBS, incubated zika virus E protein antibody (Millipore, MAB10216), washed 3 times with PBS at 4 ℃ overnight, and incubated with fluorescent secondary antibody AF 488. Nuclei were stained with DAPI. For mumps virus, the virus itself carries GFP, no secondary antibody treatment is required, and direct DAPI-stained DNA is fixed. Infection rates were detected and analyzed by a high content imaging system (Cellomic ArrayScan VTI HCS, Thermo Scientific).
siRNA and shRNA experiments
7.1 siRNA transfection assay
20000 PaKi cells were plated in 12-well plates and cultured overnight, then siRNA was transfected into cells using lipo2000, and after 48h, mumps virus or Zika virus was infected. Mumps virus titer determination by TCID50Method. The level of Zika virus replication was determined by QPCR.
si-MTHFD1 sequence:
a forward direction 5'-GUUCCAAGUGACAUUGAUAUAUCAC-3';
and reverse direction 5'-GUGAUAUAUCAAUGUCACUUGGAACAG-3'.
7.2 shRNA Stable knock-out experiment
Referring to the sgRNA construction method in step 1.1, MTHFD1 shRNA was ligated to EcoRI and AgeI double digested plko.1 vector. After the correct sequencing plasmid was obtained, the shRNA plasmid was co-transfected in 293T by the pmd2.g and psPAX2 two-plasmid lentiviral packaging system, the supernatant was harvested at 48h and seeded onto plated Paki cells. Positive cells with shRNA stably expressed are obtained by screening puromycin after 48 hours. shRNA knockdown effects were detected by western blot. The screened cells were used for mumps virus and zika virus infection experiments. The virus infection rate was determined by immunofluorescence and high content imaging system analysis.
MTHFD1 shRNA sequence:
the forward primer of PaKi shMTHFD1-1 is 5'-ccgg GCACATGGGAATTCCTCTACCctcgagGGTAGAGGAATTCCCATGTGC tttttg-3';
the reverse primer of PaKi shMTHFD1-1 is 5'-AATTCAAAAA GCACATGGGAATTCCTCTACC CTCGAG GGTAGAGGAATTCCCATGTGC-3';
the forward primer of PaKi shMTHFD1-2 is 5'-ccgg GCCTGCTGTCACTTAGGAAATctcgag ATTTCCTAAGTGACAGCAGGC tttttg-3';
PaKi shMTHFD1-2 reverse primer 5'-AATTCAAAAA GCCTGCTGTCACTTAGGAAAT CTCGAG ATTTCCTAAGTGACAGCAGGC-3'.
8. Viral titer determination
10000 PaKi cells were plated in 96-well plates and cultured overnight to form a monolayer. The test virus samples were diluted in 10-fold gradient and added to the cells, 100. mu.l per well. After 96h, CPE was observed according to TCID50The method calculates the virus titer.
Results of the experiment
1. The result of inhibiting the replication of influenza virus after MTHFD1 knockout is shown in figure 1, and influenza virus is infected in two independent 293T cell lines with MTHFD1 knockout respectively, and after 12h, the result of western blot detects that the level of M1 protein of the influenza virus in the knockout cell lines is far lower than that of control cells. Meanwhile, MTHFD1 protein is well knocked out. The MTHFD1 gene is required for the normal replication of influenza virus.
2. Replication of influenza virus in the MTHFD1 knockout cell line could be rescued by exogenously added inosine. MTHFD1 is an important enzyme in the one-carbon metabolic pathway and is capable of catalyzing three-step reactions, the catalyzed products of which are involved in the synthesis of purines, beta-thymidine, and methionine (as shown in figure 2). The following infection with influenza virus with purine, beta-thymidine and 5-methyltetrahydrofolate, respectively, in the MTHFD1 knockout cell line resulted in the rescue of the virus in the hypoxanthine-added experimental group, which was close to the level of the virus in the control group, as shown in FIG. 3. It was shown that the inhibition of the virus by MTHFD1 knock-out was due to the inhibition of purine synthesis.
3. Inhibition of influenza virus genomic RNA replication following MTHFD1 knockout. Since purine is a starting material for viral RNA synthesis, the inventors hypothesized that cellular purine synthesis was blocked after MTHFD1 knock-out, resulting in inhibition of viral RNA synthesis. By detecting the proliferation curve of the genomic RNA after viral infection (as shown in FIG. 4 a), it is found that the viral genomic RNA in the control cell starts to be significantly and continuously increased 4h after infection, while the level of the viral RNA in the MTHFD1 knockout cell line is always at a very low level, which is consistent with the tendency of the genomic RNA replication to be blocked. Subsequently, through an influenza virus replicon experiment, it is further clarified that the MTHFD1 knockout leads to the inhibition of influenza virus genome replication, thereby inhibiting virus proliferation (as shown in FIG. 4 b).
4. Knockdown of MTHFD1 by siRNA or shRNA can significantly inhibit replication of mumps virus and Zika virus. As shown in fig. 5a, after the mumps virus infection after the siRNA knockdown of MTHFD1, the supernatant is taken 48h later to detect the titer, and the reduction of MTHFD1 is found to significantly inhibit the replication formation of the mumps virus. Similarly, the knock-down of MTHFD1 was also found to significantly inhibit Zika virus as measured by QPCR (FIG. 5 b). FIG. 5c shows that siRNA has a good knockdown effect.
Similarly, a cell line with stably knocked-down MTHFD1 was established using shRNA, and then infected with mumps virus or Zika virus, and then the virus infection rate was detected by immunofluorescence and high content imaging analysis systems. The results show that viral infection was significantly inhibited following stable knockdown of MTHFD1 compared to the control (normally expressed MTHFD1) cell line (as shown in figures 6a and 6 b). The western blot results of FIG. 6c show that the shRNA has a very good knockdown effect.
MTHFD1 inhibitors are effective in inhibiting SARS-CoV 2. Different concentrations of MTHFD1 inhibitor (carolacton) were added to Vero cells for 1h, followed by addition of the virus SARS-CoV2, and it was found that carolacton significantly inhibited the replication of SARS-CoV2 (as shown in FIG. 7). The median inhibitory concentration was 0.14. mu.M, which is much less than the concentration responsible for half the toxicity to the cells (greater than 10. mu.M).
An MTHFD1 inhibitor is effective in inhibiting mumps virus and Zika virus. In PaKi cells, different concentrations of MTHFD1 inhibitor (carolacton) were added, and mumps virus or Zika virus was infected, and after 48h infection, carolacton was found to significantly inhibit replication of mumps virus or Zika virus (as shown in FIG. 8). Half the inhibitory concentrations were mumps virus: 0.24. mu.M, Zika virus 0.12. mu.M. In agreement with the results of the previous influenza virus rescue experiments, the inhibitory effect of carolactocton on mumps virus or zika virus was also counteracted by exogenously added inosine (as shown in fig. 9 and 10).
To summarize: MTHFD1 is a potential broad-spectrum antiviral target, and the inhibitor carolacton has good application prospect.
The above description is only for the purpose of illustrating the preferred embodiments of the present invention and is not to be construed as limiting the invention, and any modifications, equivalents and the like that are within the spirit and principle of the present invention are included in the present invention.
The foregoing embodiments and methods described in this disclosure may vary based on the abilities, experience, and preferences of those skilled in the art.
The mere order in which the steps of a method are listed in the present invention does not constitute any limitation on the order of the steps of the method.

Claims (14)

1. Use of an MTHFD1 inhibitor for the manufacture of a product for inhibiting and/or killing viruses;
wherein the MTHFD1 inhibitor has the following structure:
Figure 59238DEST_PATH_IMAGE001
wherein the content of the first and second substances,
R2is OR8，R8Selected from: H. C1-C12 alkyl;
R1、R3、R4、R5、R6and R7Independently selected from: H. C1-C3 alkyl.
2. The use of claim 1, wherein said MTHFD1 inhibitor has the structure:
Figure 327409DEST_PATH_IMAGE002
。
3. the use of claim 1, wherein said MTHFD1 inhibitor has the structure:
Figure 381952DEST_PATH_IMAGE003
。
4. the use of claim 1 wherein said MTHFD1 inhibitor is selected from the following structures:
Figure 342955DEST_PATH_IMAGE004
Figure 617204DEST_PATH_IMAGE005
Figure 157907DEST_PATH_IMAGE006
Figure 332536DEST_PATH_IMAGE007
。
5. the use according to any one of claims 1 to 4, wherein the virus is of the family adenoviridae, herpesviridae, papovaviridae, picornaviridae, poxviridae, hepadnaviridae, coronaviridae, potaviridae, filoviridae, orthomyxoviridae, paramyxoviridae, retroviridae, reoviridae, rhabdoviridae or flaviviridae.
6. The use of any one of claims 1 to 4, wherein the virus is an influenza virus.
7. The use of claim 6, wherein the influenza virus is an influenza A virus, an influenza B virus, or an influenza C virus.
8. The use of any one of claims 1 to 4, wherein the virus is selected from the group consisting of: HPV type 1, HPV type 2, HPV type 3, HPV type 4, Sendai virus, mumps virus, measles virus, respiratory syncytial virus, and Newcastle disease virus.
9. The use of any one of claims 1 to 4, wherein the virus is selected from the group consisting of: one or more of HCoV-229E, HCoV-OC43, HCoV-NL63, HCoV-HKU1, SARS-CoV, MERS-CoV, SARS-CoV-2.
10. The use of any one of claims 1 to 4, wherein the virus is selected from the group consisting of: one or more of dengue virus, Zika virus, encephalitis B virus, chikungunya virus, yellow fever virus, hepatitis C virus and west nile virus.
11. Use according to claim 5, wherein the product is a pharmaceutical composition or a disinfectant product.
12. The use according to claim 5, wherein the use is the use of an inhibitor of MTHFD1 in the manufacture of a medicament for the prevention and/or treatment of a disease or condition caused by or associated with a viral infection.
13. The use of claim 12, wherein the disease or condition is selected from the group consisting of: one or more of acute bronchitis, chronic bronchitis, rhinitis, sinusitis, croup, acute bronchiolitis, pharyngitis, tonsillitis, parotitis, laryngitis, tracheitis, asthma, pneumonia, influenza, and Zika virus disease.
14. The use of claim 12, wherein the disease is COVID-19, influenza, mumps or zika virus disease.
CN202010208551.2A 2020-03-23 2020-03-23 Application of MTHFD1 inhibitor in inhibiting and killing virus Active CN111450251B (en)

Priority Applications (2)

Application Number Priority Date Filing Date Title
CN202010208551.2A CN111450251B (en) 2020-03-23 2020-03-23 Application of MTHFD1 inhibitor in inhibiting and killing virus
PCT/CN2020/082809 WO2021189517A1 (en) 2020-03-23 2020-04-01 Use of mthfd1 inhibitor in inhibiting and killing viruses

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN202010208551.2A CN111450251B (en) 2020-03-23 2020-03-23 Application of MTHFD1 inhibitor in inhibiting and killing virus

Publications (2)

Publication Number Publication Date
CN111450251A CN111450251A (en) 2020-07-28
CN111450251B true CN111450251B (en) 2021-11-26

Family

ID=71670731

Family Applications (1)

Application Number Title Priority Date Filing Date
CN202010208551.2A Active CN111450251B (en) 2020-03-23 2020-03-23 Application of MTHFD1 inhibitor in inhibiting and killing virus

Country Status (2)

Country Link
CN (1) CN111450251B (en)
WO (1) WO2021189517A1 (en)

Families Citing this family (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN116850189B (en) * 2023-06-09 2024-03-26 南京艾明医药有限公司 Application of pramipexole in preparation of medicines for treating HSV-caused diseases
CN116672346B (en) * 2023-06-09 2024-01-30 南京艾明医药有限公司 Application of pramipexole in preparation of medicines for treating diseases caused by VZV

Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US6576622B1 (en) * 1995-03-14 2003-06-10 University Of Medicine & Dentistry Of New Jersey Drug combination for the treatment of viral diseases
WO2004069166A2 (en) * 2003-01-29 2004-08-19 Panacos Pharmaceuticals, Inc. Inhibition of hiv-1 replication by disruption of the processing of the viral capsid-spacer peptide 1 protein
CN105412113A (en) * 2015-11-05 2016-03-23 中国科学院武汉病毒研究所 Application of pemetrexed disodium or pharmaceutically-acceptable salt thereof in preparing medicine for treating or preventing herpes virus infection
WO2016185182A1 (en) * 2015-05-15 2016-11-24 Cambridge Enterprise Limited Detection of t cell exhaustion or lack of t cell costimulation and uses thereof
CN110225755A (en) * 2016-11-14 2019-09-10 分子医学研究中心责任有限公司 The combination of BRD4 inhibitor and antifol is used for treating cancer

Family Cites Families (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN101229380A (en) * 2001-05-15 2008-07-30 福克医药公司 Targeted delivery of drugs for the treatment of viral infections
WO2006047673A2 (en) * 2004-10-27 2006-05-04 Vanderbilt University Mammalian genes involved in infection

Patent Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US6576622B1 (en) * 1995-03-14 2003-06-10 University Of Medicine & Dentistry Of New Jersey Drug combination for the treatment of viral diseases
WO2004069166A2 (en) * 2003-01-29 2004-08-19 Panacos Pharmaceuticals, Inc. Inhibition of hiv-1 replication by disruption of the processing of the viral capsid-spacer peptide 1 protein
WO2016185182A1 (en) * 2015-05-15 2016-11-24 Cambridge Enterprise Limited Detection of t cell exhaustion or lack of t cell costimulation and uses thereof
CN105412113A (en) * 2015-11-05 2016-03-23 中国科学院武汉病毒研究所 Application of pemetrexed disodium or pharmaceutically-acceptable salt thereof in preparing medicine for treating or preventing herpes virus infection
CN110225755A (en) * 2016-11-14 2019-09-10 分子医学研究中心责任有限公司 The combination of BRD4 inhibitor and antifol is used for treating cancer

Non-Patent Citations (4)

* Cited by examiner, † Cited by third party
Title
5-氟尿嘧啶防止尖锐湿庄复发的效果观察;蒙秉新，等;《临床皮肤科杂志》;19961231(第2期);第119页正文左栏第1段 *
THE INHIBITORY EFFECT OF 4-AMINOPTERINE ON INFLUENZA VIRUS PROPAGATION IN TISSUE CULTURE;YOETSU HACHISUKA，等;《Nagoya Journal of Medical Science》;19551231;第31页第1段 *
抗肿瘤及抗AIDS感染药物三甲曲沙;丁黎;《药学进展》;19961231;第20卷(第1期);第50页 *
甲氨蝶呤联合羟氯喹治疗类风湿关节炎伴HBV携带患者的肝脏安全性观察;莫守崎，等;《风湿病与关节炎》;20160131;第5卷(第1期);第15页右栏倒数第1段 *

Also Published As

Publication number Publication date
WO2021189517A1 (en) 2021-09-30
CN111450251A (en) 2020-07-28

Similar Documents

Publication Publication Date Title
Agostini et al. Small-molecule antiviral β-d-N 4-hydroxycytidine inhibits a proofreading-intact coronavirus with a high genetic barrier to resistance
Heylen et al. Drug candidates and model systems in respiratory syncytial virus antiviral drug discovery
Sun et al. The innate immune response to RSV: Advances in our understanding of critical viral and host factors
Perron et al. GS-5806 inhibits a broad range of respiratory syncytial virus clinical isolates by blocking the virus-cell fusion process
CN111450251B (en) Application of MTHFD1 inhibitor in inhibiting and killing virus
JP2020128441A (en) Inhibitor of duplication of influenza virus
Wang et al. Porcine reproductive and respiratory syndrome virus activates lipophagy to facilitate viral replication through downregulation of NDRG1 expression
Zhang et al. Rational design of human metapneumovirus live attenuated vaccine candidates by inhibiting viral mRNA cap methyltransferase
JPH06507150A (en) Methods of using 1,3-oxathiolane nucleoside analogs for the treatment of hepatitis B
ter Ellen et al. Resveratrol and pterostilbene potently inhibit SARS-CoV-2 replication in vitro
Wang et al. A77 1726, the active metabolite of the anti‐rheumatoid arthritis drug leflunomide, inhibits influenza A virus replication in vitro and in vivo by inhibiting the activity of Janus kinases
TW201625573A (en) CHROMENONE anti-viral compounds, pharmaceutical compositions, and methods of use thereof
Shook et al. Recent advances in developing antiviral therapies for respiratory syncytial virus
US9096585B2 (en) Antiviral compounds and uses thereof
Paul et al. Repurposed antiviral drugs for the treatment of COVID-19: syntheses, mechanism of infection and clinical trials
EP4149464A1 (en) Thiol-containing compounds for use in treating coronavirus
WO2017083971A1 (en) Compositions and methods for treatment of influenza
Arnold et al. Peroxisome proliferator-activated receptor-γ agonists inhibit the replication of respiratory syncytial virus (RSV) in human lung epithelial cells
US20240075017A1 (en) Treatment of coronavirus infections using sam cycle inhibitors
JP7369143B2 (en) A therapeutic agent for RNA virus infections comprising a combination of a pyrazine derivative and a compound that increases the amount of pyrazine derivative ribose triphosphate in cells.
CN116782920A (en) Neuropilin and angiotensin converting enzyme 2 fusion peptides for the treatment of viral infections
WO2013123974A1 (en) New inhibitors of influenza a and b viruses acting by disrupting pa and pb1 subunit interactions of heterotrimeric viral rna polymerase
Jain et al. Development of reverse genetic tools to study Chapare and Machupo viruses
CN116549642A (en) P23 protein inhibitor for inhibiting and/or killing virus
US20240109859A1 (en) Enzyme inhibitors and viral infection therapy

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
GR01 Patent grant
GR01 Patent grant