WO2013123974A1

WO2013123974A1 - New inhibitors of influenza a and b viruses acting by disrupting pa and pb1 subunit interactions of heterotrimeric viral rna polymerase

Info

Publication number: WO2013123974A1
Application number: PCT/EP2012/052914
Authority: WO
Inventors: Arianna Loregian; Giorgio Palu'; Giulia MURATORE; Gabriele Cruciani; Oriana Tabarrini
Original assignee: Universita' Degli Studi Di Padova
Priority date: 2012-02-21
Filing date: 2012-02-21
Publication date: 2013-08-29

Abstract

The present application discloses new compounds able to interfere with the interactions of the PA and PB1 subunits of viral RNA polymerase. Said compounds are particularly advantageous for use in treatment of influenza by A and B types viruses in humans and animals.

Description

New inhibitors of influenza A and B viruses acting by disrupting PA and PB1 subunit interactions of heterotrimeric viral RNA polymerase

Field of the invention

The present invention relates to small molecule inhibitors of the influenza A and B viruses replication and the therapeutic use thereof as anti-influenza A and B agents.

Background of the invention

Influenza viruses are the cause of yearly epidemics and occasional pandemics that represent a significant challenge to public health.

In fact, influenza A (FluA) and B (FluB) viruses cause highly infectious respiratory diseases, characterized by high morbidity and significant mortality. Both viruses are responsible for seasonal epidemics, which affect up to 20% of the population and result in hundreds of thousands of deaths each year (Salomon R & Webster RG, 2009). At irregular intervals, antigenically novel strains of FluA provoke pandemic outbreaks with higher attack rates and potentially more severe disease. The 1918 "Spanish" pandemic remains the worst example, causing upwards of 50 million deaths. Thus, both types of virus pose a large threat to public health.

Influenza infections can be controlled by vaccination and antiviral drugs. However, vaccines need regular updating because the virus is antigenically labile, and are not always protective.

Only two classes of drugs are currently approved for the treatment of influenza: M2 ion channel blockers (adamantanes, in particular amantadine and rimantadine) and neuraminidase (NA) inhibitors (in particular oseltamivir and zanamivir ) (De Clerq E, 2006).

Adamantanes inhibit FluA replication by blocking virus entry. However, they have no activity against FluB viruses and are often associated with serious side effects and suffer from rapid emergence of drug-resistant viruses as well (Hayden FG, Hay AJ, 1992).

Neuraminidase inhibitors block the release of virions after budding from the host cell (Colman PM et al., 1983). They exhibit activity against both FluA and FluB viruses but can also cause side effects and be nullified by resistance (de Jong MD et al., 2005). In addition, they must be administered within few hours from infection and cannot be used in children below 12 years-old.

Also ribavirin is known as inhibitor of RNA viruses (Sidwell RW et al., 1972), but it is only approved for treatment of human respiratory syncytial virus infections.

Thus, there is a clear need to develop novel influenza virus inhibitors, preferably directed against other viral targets.

The influenza virus RNA polymerase is a heterotrimeric complex of three virus- encoded proteins all essential for viral RNA synthesis (Salomon & Webster ref. cit). PB1 is the nucleic acid polymerase and forms the backbone of the complex (Biswas SK, Nayak DP, 1994; Digard P et al., 1989). PB2 and PA play accessory roles, best defined for viral transcription (Guilligay D et al., 2008; Yuan P et al., 2009; Dias A et al., 2009). The three polymerase subunits bind each other non- covalently in a set of interactions that are essential for polymerase function. Although the polymerase forms a globular structure (Torreira E et al., 2007), the primary protein-protein interactions are via the N-terminus of PB1 with the C- terminus of PA (Perez DR, Donis RO, 1995; Ohtsu Y et al., 2002; Gonzalez S et al., 1996) and the C-terminus of PB1 with the N-terminus of PB2 (Gonzalez S et al. ref. cit; Poole EL et al., 2007). In contrast to the viral glycoproteins, the polymerase is highly conserved between different viral strains (Salomon & Webster ref. cit). Thus, inhibition of these interactions represents an attractive strategy for the development of drugs with broad efficacy against all influenza virus strains.

A recent study, in fact, has shown that a small peptide of 25 amino acids corresponding to the region of PB1 which binds PA is able to inhibit the activity of viral polymerase and the viral replication (Ghanem et al., 2007), thus proving that the inhibition of PA and PB1 interaction could represent a possible anti-viral strategy for influenza viruses. Nevertheless peptides are not easy to manage for therapeutic purposes, again, proving the need to find out other possible agents able to interfere with the interaction between PA and PB1 .

Recently, two crystallographic structures of a truncated form of PA bound to a PB1 -derived peptide have been published (Obayashi E et al., 2008; He X et al., 2008). These structures revealed that the PA-PB1 binding interface consists of an N-terminal 3io helix from PB1 that binds into a hydrophobic groove in the C- terminus of PA. Importantly, the structures showed that relatively few residues drive binding of PB1 to PA, suggesting the potential for small molecule-mediated inhibition.

Summary of the invention

One purpose of the present invention is to provide new inhibitors of the influenza viruses able to specifically act on the PA and PB1 subunit interactions of the viral RNA polymerase and representing an improved and/or an alternative to known influenza anti-viral agents.

A further purpose is to provide new inhibitors exhibiting a high specificity against the influenza viruses A and B and low cytotoxicity.

For these purposes the inventors have conducted an extensive search aimed at finding out small molecule compounds able to effectively and specifically inhibit growth of influenza A and B viruses in cultured cells through targeting an assembly interface of the viral RNA-dependent RNA polymerase. Using the existing crystal structure of the primary protein-protein interface between the PB1 and PA subunits of the influenza A virus polymerase previously mentioned, the inventors have conducted an in silico screen to identify potential small molecule inhibitors. Selected compounds were then screened for their ability to inhibit the interaction between PB1 and PA in vitro using an ELISA-based assay and in cells, to inhibit nuclear import of a binary PB1 -PA complex as well as transcription by the full viral ribonucleoprotein complex. Two compounds emerged as effective inhibitors with IC₅₀ values in the low micromolar range and negligible cytotoxicity. Of these, one compound also acted as a potent replication inhibitor of a variety of influenza A virus strains in Madin-Darby Canine Kidney (MDCK) cells, including H3N2 and H1 N1 seasonal and 2009 pandemic strains. Importantly, this included an Oseltamivir-resistant isolate.

Therefore, it is a first object of the present invention a compound selected from methyl 2-amino-4-(1 ,3-benzodioxol-5-yl)-1 -(3-chloro-2-methylphenyl)-5-oxo- 1 ,4,5,6,7,8-hexahydroquinoline-3-carboxylate and N-(3-carbamoyl-5,6-dihydro-4H- cyclopenta[b]thiophen-2-yl)-7-(difluoromethyl)-5-phenylpyrazolo[1 ,5-a]pyrimidine- 3-carboxamide and pharmaceutically acceptable salts and derivatives thereof acting by disrupting PA and PB1 subunit interactions of viral RNA polymerase for use as anti-viral agents for treating the influenza in humans and animals.

It is a further object of the present invention the use of said compounds for the preparation of compositions for the treatment of influenza in humans and animals. Yet, it is an object of the present invention a composition comprising a compound selected from methyl 2-amino-4-(1 ,3-benzodioxol-5-yl)-1 -(3-chloro-2- methylphenyl)-5-oxo-1 ,4,5,6,7,8-hexahydroquinoline-3-carboxylate and N-(3- carbamoyl-5,6-dihydro-4H-cyclopenta[b]thiophen-2-yl)-7-(difluoromethyl)-5- phenylpyrazolo[1 ,5-a]pyrimidine-3-carboxamide and pharmaceutically acceptable salts and derivatives thereof acting by disrupting PA and PB1 subunit interactions of viral RNA polymerase in combination with at least one pharmaceutically acceptable vehicle and /or excipient for use for therapy of the influenza in humans and animals.

In particular the compound methyl 2-amino-4-(1 ,3-benzodioxol-5-yl)-1 -(3-chloro-2- methylphenyl)-5-oxo-1 ,4,5,6,7,8-hexahydroquinoline-3-carboxylate, the compound N-(3-carbamoyl-5,6-dihydro-4H-cyclopenta[b]thiophen-2-yl)-7-(difluoromethyl)-5- phenylpyrazolo[1 ,5-a]pyrimidine-3-carboxamide, and pharmaceutically acceptable salts and derivatives thereof, can be used as anti-viral agents for the influenza by A and B viruses.

The objects, characteristics and advantages of the present invention will be apparent to those skilled in the art from the following detailed description with the aid of the annexed figures.

Brief description of the figures

Figure 1 shows effects of the compounds on PA-PB1 interactions in a cellular context. {A) Effect of compounds on intranuclear localization of the PA-PB1 complex. HEK 293T cells were transfected with plasmids expressing PB1 (PB1 : NCBI RefSEq. : NP_040985) and a PA-GFP fusion protein (PA: GenBank Accession No: ABO21 708; GFP: GenBank Accession No: ADN93293) in the presence of test compounds or DMSO as a control. Cells transfected with the PA- GFP-expressing plasmid alone served as a negative control. At 24 hr post- transfection, cells were examined by confocal laser scanning microscopy. Individual green (GFP) and blue (TOTO-3 iodide) channels and merged images are shown. (S) Activities of the compounds: compound 1 [methyl 2-amino-4-(1 ,3- benzodioxol-5-yl)-1 -(3-chloro-2-methylphenyl)-5-oxo-1 ,4,5,6,7,8- hexahydroquinoline-3-carboxylate], compound 3 [4-{1 1 -(4-methoxyphenyl)-1 -oxo- 3-[4-(trifluoromethyl)phenyl]-1 ,2,3,4,5,1 1 -hexahydro-10H- dibenzo[b,e][1 ,4]diazepin-10-yl}-4-oxobutanoic acid], compound 5 [N-(3- carbamoyl-5,6-dihydro-4H-cyclopenta[b]thiophen-2-yl)-7-(difluoromethyl)-5- phenylpyrazolo[1 ,5-a]pyrimidine-3-carboxamide] and PB1 _{- 5}-Tat (SEQ ID NO:1 ), in FluA virus minireplicon assays. HEK 293T cells were transfected with plasmids encoding PB1 (PB1 : NCBI RefSeq.: NP_040985), PB2 (PB2: GenBank Accession No: ABO21705), PA (PA: GenBank Accession No: ABO21708), Nucleocapsid Protein (NP: GenBank Accession No: ADY00024) and a firefly luciferase reporter gene (GenBank Accession No: M26194) flanked by the noncoding sequences of A/WSN/33 virus segment 8 (SEQ ID NO:2 and 3). The transfection mixtures also contained a plasmid constitutively expressing Renilla luciferase (Promega E2231 ), which served to normalize variations in transfection efficiency. Luciferase activity was quantified at 24 hr post-transfection. Activity observed with transfection reaction mixtures containing DMSO instead of test compounds was set at 100% and Relative Light Units (RLU) were calculated. Omission of PB2 served as a negative control. Data shown represent the mean ± SD from at least six independent experiments.

Figure 2 shows the antiviral activity of selected compounds. (A) The effects of the indicated compounds compound 1 [methyl 2-amino-4-(1 ,3-benzodioxol-5-yl)-1 -(3- chloro-2-methylphenyl)-5-oxo-1 ,4,5,6,7,8-hexahydroquinoline-3-carboxylate], compound 3 [4-{1 1 -(4-methoxyphenyl)-1 -oxo-3-[4-(trifluoromethyl)phenyl]- 1 ,2,3,4,5,1 1 -hexahydro-10H-dibenzo[b,e][1 ,4]diazepin-10-yl}-4-oxobutanoic acid], compound 5 [N-(3-carbamoyl-5,6-dihydro-4H-cyclopenta[b]thiophen-2-yl)-7- (difluoromethyl)-5-phenylpyrazolo[1 ,5-a]pyrimidine-3-carboxamide] and PB1 _{- 5}- Tat (SEQ ID NO:1 ) in comparison with ribavirin (RBV) on plaque formation by A/PR/8/34 virus were determined in MDCK cells. (S) Effects of compound 1 [methyl 2-amino-4-(1 ,3-benzodioxol-5-yl)-1 -(3-chloro-2-methylphenyl)-5-oxo- 1 ,4,5,6,7,8-hexahydroquinoline-3-carboxylate], compound 3 [4-{1 1 -(4- methoxyphenyl)-1 -oxo-3-[4-(trifluoromethyl)phenyl]-1 ,2,3,4,5,1 1 -hexahydro-1 OH- dibenzo[b,e][1 ,4]diazepin-10-yl}-4-oxobutanoic acid], compound 5 [N-(3- carbamoyl-5,6-dihydro-4H-cyclopenta[b]thiophen-2-yl)-7-(difluoromethyl)-5- phenylpyrazolo[1 ,5-a]pyrimidine-3-carboxamide], and ribavirin (RBV) on the yield of A/PR/8/34 virus following low MOI infections of MDCK cells at 12 and 48 hr p.i. (C) Effects of compound 1 [methyl 2-amino-4-(1 ,3-benzodioxol-5-yl)-1 -(3-chloro-2- methylphenyl)-5-oxo-1 ,4,5,6,7,8-hexahydroquinoline-3-carboxylate], compound 3

[4-{l 1 -(4-methoxyphenyl)-1 -oxo-3-[4-(trifluoromethyl)phenyl]-1 ,2,3,4,5,1 1 - hexahydro-10H-dibenzo[b,e][1 ,4]diazepin-10-yl}-4-oxobutanoic acid], and compound 5 [N-(3-carbamoyl-5,6-dihydro-4H-cyclopenta[b]thiophen-2-yl)-7- (difluoromethyl)-5-phenylpyrazolo[1 ,5-a]pyrimidine-3-carboxamide] on viral protein synthesis. MDCK cells were infected with A/PR/8/34 virus and treated with test compounds. At 12 hr p.i., [³⁵S]-Methionine was added to the cell medium and labeled proteins were analyzed by SDS-PAGE and autoradiography.

Figure 3 shows the activities of the compounds in FluB virus minireplicon assays. HEK 293T cells were transfected with plasmids encoding PB1 (GenBank Accession No: AAB72043), PB2 (GenBank Accession No: AAB72044), PA (GenBank Accession No: AAB72045), and Nucleoprotein (NP) (GenBank Accession No: AAB72046) proteins of B/Panama/45/90 virus, and with a plasmid containing a GFP reporter gene (GenBank Accession No: ADN93293) flanked by noncoding sequences of the Hemagglutinin (HA) gene of B/Lee/40 virus (SEQ ID NO:4 and SEQ ID NO:5) and treated with test compounds. GFP expression was examined at 24 hr post-transfection by confocal laser microscopy. The green (GFP) and blue (TOTO-3 iodide) channels are shown; merged images of the green and blue channels are shown on the right.

Detailed description of the invention

Definition

The anti-viral compound methyl 2-amino-4-(1 ,3-benzodioxol-5-yl)-1 -(3-chloro-2- methylphenyl)-5-oxo-1 ,4,5,6,7,8-hexahydroquinoline-3-carboxylate is herein identified also as compound 1 and the anti-viral compound N-(3-carbamoyl-5,6- dihydro-4H-cyclopenta[b]thiophen-2-yl)-7-(difluoromethyl)-5-phenylpyrazolo[1 ,5- a]pyrimidine-3-carboxamide is herein identified also as compound 5. The compound 4-{1 1 -(4-methoxyphenyl)-1 -oxo-3-[4-(trifluoromethyl)phenyl]- 1 ,2,3,4,5,1 1 -hexahydro-10H-dibenzo[b,e][1 ,4]diazepin-10-yl}-4-oxobutanoic acid, identified also only as compound 3, found inactive compound in the screening performed, is herein used as a negative control in the assessment of activity of compound 1 and compound 5.

The peptide PB1 _{- 5}-Tat is a synthetic peptide having sequence MDVNPTLLFLKVPAQYGRKKRRQRRR (SEQ ID NO:1 ) obtained from the sequence 1 -15 of PB1 subunit of A/PR/8/34 virus (NCBI RefSeq. NP_040985) and the sequence 47-57 of Tat protein of human immunodeficiency virus 1 (GenBank Accession No: AAA45081 ).

Description

For the achievement of the purposes of the present invention, the inventors have identified in the compound 1 [methyl 2-amino-4-(1 ,3-benzodioxol-5-yl)-1 -(3-chloro- 2-methylphenyl)-5-oxo-1 ,4,5,6,7,8-hexahydroquinoline-3-carboxylate] and in the compound 5 [N-(3-carbamoyl-5,6-dihydro-4H-cyclopenta[b]thiophen-2-yl)-7- (difluoromethyl)-5-phenylpyrazolo[1 ,5-a]pyrimidine-3-carboxamide] having the structural formula herein below reported,

Compound 1

Compound 5

the small molecules capable to inhibit the PA and PB1 subunit interactions of the heterotrimeric viral RNA polymerase of both the influenza viruses type A and B. Advantageously, said compounds 1 and 5 are capable to inhibit specifically the replication of influenza by A and B viruses and, hence, said compounds are suitable to be used as antiviral agents for treating influenza, in particular influenza by A and B viruses, in humans and animals (mammals and birds).

In addition said compounds 1 and 5 have shown no cytotoxicity and high specificity, being inactive against non-influenza RNA viruses, namely vesicular stomatitis virus, respiratory syncytial virus, measles virus and coxsackie virus B1 , and DNA viruses, namely herpes simplex virus type 1 (HSV-1 ), human cytomegalovirus (HCMV), and human adenovirus (AdV).

Both the compounds were identified after an extensive study herein below briefly reported.

A preliminary in silico assay based on the FLAP (Fingerprints for Ligands And Proteins) software (Baroni M et al., 2007,) and the crystal structure of a C-terminal fragment of PA subunit of the virus A/goose/Guandong/1/96 (NCBI Ref.Seq. NC_007359 - aa 257-716) bound to a PB1 -derived peptide (Protein Data Bank code 3CM8) (He X et al., ref. cit.) among three million compounds from the ZINC database and Enzyme-Linked Immunosorbent Assay (ELISA) were used to perform structure-based virtual and in vitro screenings for the selection of small molecules potentially acting as candidate inhibitors of the protein-protein interactions of the PA and PB1 subunits of the heterotrimeric viral RNA polymerase. From these screenings only two compounds, the compound 1 [methyl 2-amino-4- (1 ,3-benzodioxol-5-yl)-1 -(3-chloro-2-methylphenyl)-5-oxo-1 ,4,5,6,7,8- hexahydroquinoline-3-carboxylate] and the compound 5 [N-(3-carbamoyl-5,6- dihydro-4H-cyclopenta[b]thiophen-2-yl)-7-(difluoromethyl)-5-phenylpyrazolo[1 ,5- a]pyrimidine-3-carboxamide] objects of the present invention, have shown to exhibit a high capacity to inhibit the PA-PB1 interaction in cells and the viral replication.

In addition, said compounds have no cytotoxicity and no activity on viral replication of non-influenza viruses.

The results obtained with the compound 1 [methyl 2-amino-4-(1 ,3-benzodioxol-5- yl)-1 -(3-chloro-2-methylphenyl)-5-oxo-1 ,4,5,6,7,8-hexahydroquinoline-3- carboxylate] and compound 5 [N-(3-carbamoyl-5,6-dihydro-4H- cyclopenta[b]thiophen-2-yl)-7-(difluoromethyl)-5-phenylpyrazolo[1 ,5-a]pyrimidine- 3-carboxamide] together with a negative control represented by the compound 3 selected in the silico screen but found inactive in the screening performed by using in vitro ELISA test for assessment of the inhibition of the PA-PB1 interaction, are herein after reported.

Functional inhibition of PA-PB1 interactions in cells.

The compound 1 [methyl 2-amino-4-(1 ,3-benzodioxol-5-yl)-1 -(3-chloro-2- methylphenyl)-5-oxo-1 ,4,5,6,7,8-hexahydroquinoline-3-carboxylate] and compound 5 [N-(3-carbamoyl-5,6-dihydro-4H-cyclopenta[b]thiophen-2-yl)-7- (difluoromethyl)-5-phenylpyrazolo[1 ,5-a]pyrimidine-3-carboxamide] were tested for the ability to interfere with functional interactions between PA and PB1 subunits in a cellular context. First, it was investigated whether the compounds could inhibit PA-PB1 binding in the cell cytosol and consequently block the intranuclear translocation of PA subunit, which requires formation of a PA-PB1 complex (Fodor E, Smith M, 2004). Thus, the cell line HEK 293T were transfected with plasmids expressing PB1 of FluA virus (PB1 NCBI RefSeq: NP_040985) and a PA-GFP (green fluorescent protein) fusion protein (PA subunit of influenza A virus GenBank Accession No: ABO21708; GFP GenBank Accession No: ADN93293) and analyzed the intracellular localization of PA-GFP fusion protein in the presence or absence of test compounds. As previously shown (Fodor E, Smith M, ref. cit), individually expressed PA-GFP fusion protein was largely cytoplasmic, while coexpression of PA-GFP fusion protein with PB1 subunit resulted in marked nuclear accumulation of PA subunit (GenBank Accession No: ABO21708) (Fig. λ Α). Treatment of PA-PB1 -coexpressing cells with compound 1 [methyl 2-amino-4- (1 ,3-benzodioxol-5-yl)-1 -(3-chloro-2-methylphenyl)-5-oxo-1 ,4,5,6,7,8- hexahydroquinoline-3-carboxylate] and compound 5 [N-(3-carbamoyl-5,6-dihydro- 4H-cyclopenta[b]thiophen-2-yl)-7-(difluoromethyl)-5-phenylpyrazolo[1 ,5- a]pyrimidine-3-carboxamide] reduced PA subunit nuclear localization, while DMSO vehicle or compound 3 had no effect (Fig. λ Α).

The inventors have next analyzed the ability of the compounds to inhibit the activity of FluA virus RNA polymerase by a minireplicon assay (Mullin AE et al., 2004). Cells were cotransfected with plasmids encoding the three polymerase subunits of fluA virus PB1 , PB2, PA [pcDNA-PB1 : pcDNA3 (Invitrogen V79020) modified in Hindi 11 restriction site by inserting the PB1 sequence (NCBI RefSeq: NP_040985); pcDNA-PB2: pcDNA3 (Invitrogen V79020) modified in BamHI restriction site by inserting PB2 sequence (GenBank Accession No: ABO21 705); pcDNA-PA: pcDNA3 (Invitrogen V79020) modified in EcoRI restriction site by inserting PA sequence (GenBank Accession No: ABO21708)], and the viral and nucleocapsid protein (NP) [(pcDNA-NP: pcDNA3 (Invitrogen V79020) modified in EcoRV/Xbal restriction site by inserting NP sequence (GenBank Accession No: ADY00024)], along with a plasmid containing the firefly luciferase reporter gene (GenBank Accession No: M26194) flanked by the noncoding regions of A/WSN/33 virus segment 8 (SEQ ID NO:2 and 3), and treated with test or control compounds. In the absence of drug, the polymerase and NP proteins transcribed the viral-like RNA expressed by the reporter plasmid into imRNA, resulting in luciferase expression. A strong decrease in reporter gene activity was observed in the presence of the PB1 i-i₅-Tat peptide (SEQ ID NO:1 ). Treatment of transfected cells with compound 1 [methyl 2-amino-4-(1 ,3-benzodioxol-5-yl)-1 -(3-chloro-2- methylphenyl)-5-oxo-1 ,4,5,6,7,8-hexahydroquinoline-3-carboxylate] and compound 5 [N-(3-carbamoyl-5,6-dihydro-4H-cyclopenta[b]thiophen-2-yl)-7- (difluoromethyl)-5-phenylpyrazolo[1 ,5-a]pyrimidine-3-carboxamide] resulted in dose-dependent inhibition of luciferase activity with IC₅₀s of 18.5 ± 3.8 μΜ and 31 .4 ± 4.2 μΜ, respectively (Fig. 1 B), while compound 3 had no effect.

Thus, two out of the compounds that inhibited PA-PB1 binding in vitro also interfered effectively in cells with PA intranuclear translocation and with the catalytic activity of the viral polymerase.

Activity of the Compounds Against FluA Virus Replication.

The inventors then investigated the antiviral effects of the compounds in FluA virus-infected MDCK cells. First, the compounds were tested in plaque reduction assays with various virus subtypes and strains. RBV, a known inhibitor of RNA viruses, exhibited a 50% effective dose (ED₅₀) of 8.4 ± 2.3 μΜ. Compound 1

[methyl 2-amino-4-(1 ,3-benzodioxol-5-yl)-1 -(3-chloro-2-methylphenyl)-5-oxo- 1 ,4,5,6,7,8-hexahydroquinoline-3-carboxylate] inhibited plaque formation with an ED₅₀ of 18.6 ± 4.1 μΜ (Table 1 ). Compound 5 [N-(3-carbamoyl-5,6-dihydro-4H- cyclopenta[b]thiophen-2-yl)-7-(difluoromethyl)-5-phenylpyrazolo[1 ,5-a]pyrimidine- 3-carboxamide] weakly inhibited virus growth, having an ED₅₀ >100 μΜ. The compound 3 showed no activity, while the PB1 _{- 5}-Tat peptide (SEQ ID NO:1 ) exhibited inhibitory activity, as expected (Fig. 2A and Table 1 ).

Table 1 . Effects of selected compounds on the replication of FluA viruses

Compound Activity

Virus Subtype and

. Εϋ₅₀ (μΜ)

Strain

RBV Oseltamivir

A (H1 N1 )

A/PR/8/34 18.6±4.1 >100 >100 8.4±2.3 0.01 ±0.004

A/Solomon 12.2±2.6 >100 >100 15.2±4.1 ND Island/3/06

A/Roma-ISS/2/08 17.3±3.7 >100 >100 15.3±3.7 ND

A/California/7/09 19.1 ±4.3 >100 75.5±8.8 16.4±2.8 ND

A/Padova/30/201 1 15.5±3.6 >100 >100 13.3±3.5 ND

A/Padova/72/201 1 20.0±2.9 >100 >100 15.7±4.4 ND A/Padova/253/201 1 18.2±5.2 >100 >100 17.2±4.7 ND

A/Parma/24/09 22.5±3.7 >100 82.2±10.3 18.6±2.9 >100

( Oseltamivir-resistant)

A (H3N2)

A/Wisconsin/67/05 22.5±3.2 >100 >100 17.5±3.5 ND

^'Expressed as the ED₅₀, defined as the concentration of the compound that inhibits 50% of plaque formation; ND, not determined.

Then, the effects of selected compounds in viral yield assays at 12 and 48 hr post- infection (p.i.) were tested. Compound 1 [methyl 2-amino-4-(1 ,3-benzodioxol-5-yl)- 1 -(3-chloro-2-methylphenyl)-5-oxo-1 ,4,5,6,7,8-hexahydroquinoline-3-carboxylate] inhibited virus yield with an ED₅₀ of 1 .5 ± 0.9 μΜ at 12 hr p.i. and of 19.4 ± 3.6 μΜ at 48 hr (Fig. 2B). Similarly, compound 5 [N-(3-carbamoyl-5,6-dihydro-4H- cyclopenta[b]thiophen-2-yl)-7-(difluoromethyl)-5-phenylpyrazolo[1 ,5-a]pyrimidine- 3-carboxamide] showed higher activity at 12 hr p.i. (ED₅₀ of 30.7 ± 4.1 μΜ) than at 48 hr p.i. (ED₅₀ >100 μΜ). As expected, compound 3 showed no significant antiviral activity at 12 or 48 hr p.i., while RBV exhibited ED₅₀s of ~9 μΜ at both times p.i.

Then, the inhibition of viral protein synthesis was analyzed. MDCK cells were infected with influenza A/PR/8/34 virus at an MOI of 5 and treated with compound 1 [methyl 2-amino-4-(1 ,3-benzodioxol-5-yl)-1 -(3-chloro-2-methylphenyl)-5-oxo- 1 ,4,5,6,7,8-hexahydroquinoline-3-carboxylate], compound 3, and compound 5 [N- (3-carbamoyl-5,6-dihydro-4H-cyclopenta[b]thiophen-2-yl)-7-(difluoromethyl)-5- phenylpyrazolo[1 ,5-a]pyrimidine-3-carboxamide]. At 12 hr p.i., [³⁵S]-Met was added for 1 hr in the cell medium to label de novo viral protein synthesis, which was then analyzed by SDS-PAGE and autoradiography. Cells treated with compound 1 [methyl 2-amino-4-(1 ,3-benzodioxol-5-yl)-1 -(3-chloro-2- methylphenyl)-5-oxo-1 ,4,5,6,7,8-hexahydroquinoline-3-carboxylate] showed reduced expression of viral proteins (Fig. 2C), but as expected, compound 3 had no effect. No significant activity of compound 5 [N-(3-carbamoyl-5,6-dihydro-4H- cyclopenta[b]thiophen-2-yl)-7-(difluoromethyl)-5-phenylpyrazolo[1 ,5-a]pyrimidine- 3-carboxamide] was observed, perhaps due to the high MOI used in these experiments.

The activity of compound 1 [methyl-2-amino-4-(1 ,3-benzodioxol-5-yl)-1 -(3-chloro- 2-methylphenyl)-5-oxo-1 ,4,5,6,7,8-hexahydroquinoline-3-carboxylate] and compound 5 [N-(3-carbamoyl-5,6-dihydro-4H-cyclopenta[b]thiophen-2-yl)-7- (difluoromethyl)-5-phenylpyrazolo[1 ,5-a]pyrimidine-3-carboxamide] against a number of clinical isolates of FluA virus was further tested. As with A/PR/8/34 virus, compound 5 [N-(3-carbamoyl-5,6-dihydro-4H-cyclopenta[b]thiophen-2-yl)-7- (difluoromethyl)-5-phenylpyrazolo[1 ,5-a]pyrimidine-3-carboxamide] showed weak antiviral activity against several strains in plaque reduction assays (Table 1 ). However, compound 1 [methyl 2-amino-4-(1 ,3-benzodioxol-5-yl)-1 -(3-chloro-2- methylphenyl)-5-oxo-1 ,4,5,6,7,8-hexahydroquinoline-3-carboxylate] effectively inhibited all FluA viruses tested, including pandemic swine-originated influenza virus (S-OIV) strains, with ED₅₀s ranging from 12.2 to 22.5 μΜ. Importantly, this included potent activity against an Oseltamivir-resistant clinical isolate (A/Parma/24/09) (ED₅₀ of 22.5 ± 3.7 μΜ; Table 1 ). Thus, compound 1 [methyl 2- amino-4-(1 ,3-benzodioxol-5-yl)-1 -(3-chloro-2-methylphenyl)-5-oxo-1 ,4,5,6,7,8- hexahydroquinoline-3-carboxylate] displays broad-spectrum antiviral activity against FluA virus.

Activity of compounds on FluB Virus Replication

It was then investigated whether compounds active against FluA virus polymerase could also inhibit FluB viruses. Thus, compound 1 [methyl 2-amino-4-(1 ,3- benzodioxol-5-yl)-1 -(3-chloro-2-methylphenyl)-5-oxo-1 ,4,5,6,7,8- hexahydroquinoline-3-carboxylate] and compound 5 [N-(3-carbamoyl-5,6-dihydro- 4H-cyclopenta[b]thiophen-2-yl)-7-(difluoromethyl)-5-phenylpyrazolo[1 ,5- a]pyrimidine-3-carboxamide] were tested against several FluB virus strains by plaque reduction assays. In these experiments, ribavirin (RBV) blocked FluB virus replication with an ED₅₀ of 12.4 ± 3.4 μΜ, while compound 3 had no effect. Compound 1 [methyl 2-amino-4-(1 ,3-benzodioxol-5-yl)-1 -(3-chloro-2- methylphenyl)-5-oxo-1 ,4,5,6,7,8-hexahydroquinoline-3-carboxylate] inhibited the replication of FluB viruses with ED₅₀ values ranging from 12.5 to 21 .0 μΜ, while compound 5 [N-(3-carbamoyl-5,6-dihydro-4H-cyclopenta[b]thiophen-2-yl)-7- (difluoromethyl)-5-phenylpyrazolo[1 ,5-a]pyrimidine-3-carboxamide] exhibited ED values >100 μΜ against all virus tested (Table 2).

Table 2. Effects of selected compounds on the replication of FluB viruses

Compound Activity

Virus Strain ED (μΜ)^*

1 3 5 RBV

B/Lee/40 14.5±3.5 >100 >100 20.2±3.4

B/Malaysia/2506/04 12.5±2.2 >100 >100 17.5±3.4

B/Bangladesh/333/07 14.3±4.3 >100 >100 14.3±5.1

B/Brisbane/60/08 19.6±3.1 >100 >100 16.6±5.6

B/Padova/2/201 1 16.5±5.6 >100 >100 19.1 ±6.4

B/Padova/3/201 1 19.2±3.2 >100 >100 17.7±3.8

B/Padova/42/201 1 21 .0±2.8 >100 >100 20.0±4.7 ^* Expressed as the ED₅₀, defined as the concentration of the compound that inhibits 50% of plaque formation.

To confirm that the antiviral activity of compound 1 [methyl 2-amino-4-(1 ,3- benzodioxol-5-yl)-1 -(3-chloro-2-methylphenyl)-5-oxo-1 ,4,5,6,7,8- hexahydroquinoline-3-carboxylate] against FluB virus was due to inhibition of the viral RNA polymerase, the inventor investigated whether the compound could inhibit a FluB virus minireplicon system. Compound 1 [methyl 2-amino-4-(1 ,3- benzodioxol-5-yl)-1 -(3-chloro-2-methylphenyl)-5-oxo-1 ,4,5,6,7,8- hexahydroquinoline-3-carboxylate] efficiently reduced expression of the GFP reporter gene (GenBank Accession No: ADN93293), while compound 3 showed no effect (Fig. 3). Thus, compound 1 [methyl 2-amino-4-(1 ,3-benzodioxol-5-yl)-1 - (3-chloro-2-methylphenyl)-5-oxo-1 ,4,5,6,7,8-hexahydroquinoline-3-carboxylate] also inhibits the FluB virus RNA polymerase.

Activity of Compounds Against Non-Influenza Viruses

Finally, to further evaluate the therapeutic potential and selectivity of compound 1 [methyl 2-amino-4-(1 ,3-benzodioxol-5-yl)-1 -(3-chloro-2-methylphenyl)-5-oxo- 1 ,4,5,6,7,8-hexahydroquinoline-3-carboxylate] and compound 5 [N-(3-carbamoyl- 5,6-dihydro-4H-cyclopenta[b]thiophen-2-yl)-7-(difluoromethyl)-5- phenylpyrazolo[1 ,5-a]pyrimidine-3-carboxamide], their effects on the replication of RNA viruses other than influenza virus: vesicular stomatitis virus, respiratory syncytial virus, measles virus, and coxsackie virus B1 and DNA viruses: herpes simplex virus type 1 , human cytomegalovirus, and human adenovirus were assayed in comparison with ribavirin (RBV) and ganciclovir (GCV). Compound 1 [methyl 2-amino-4-(1 ,3-benzodioxol-5-yl)-1 -(3-chloro-2-methylphenyl)-5-oxo- 1 ,4,5,6,7,8-hexahydroquinoline-3-carboxylate] and compound 5 [N-(3-carbamoyl- 5,6-dihydro-4H-cyclopenta[b]thiophen-2-yl)-7-(difluoromethyl)-5- phenylpyrazolo[1 ,5-a]pyrimidine-3-carboxamide] did not inhibit the replication of any of the tested viruses (Table 3). Thus, the compounds possess specific antiviral activity against FluA and FluB viruses.

Table 3. Activities of test compounds against other RNA and DNA viruses

Compound Activity

Virus Family Genome

ED₅₀ (μΜ)^*

1 3 5 RBV GCV

HSV-1 Herpesviridae dsDNA >100 >100 >100 0.1 ±0.04

HCMV Herpesviridae dsDNA >100 >100 >100 1 .211 .3

AdV Adenoviridae dsDNA >100 >100 >100

COX B1 Picornaviridae (+) ssRNA >100 >100 >100

VSV Rhabdoviridae (-) ssRNA >100 >100 >100 10.3±2.9

MV Paramyxo viridae (-) ssRNA >100 >100 >100

RSV Paramyxo viridae (-) ssRNA >100 >100 >100 21 .6±3.6

"Expressed as the ED₅₀, defined as the concentration of the compound that inhibits 50% of plaque formation or cytopathic effect; ds, double-stranded; ss, single- stranded; RBV, ribavirin; GCV, ganciclovir; HSV- 1, herpes simplex virus type 1; HCMV, human cytomegalovirus; AdV, adenovirus; COX B1, coxsackie virus B1; VSV, vesicular stomatitis virus; MV, measles virus; RSV, respiratory syncytial virus.

Cytotoxicity of the Compounds.

The compounds were further assayed to verify the cytotoxicity in a panel of cell lines: Human Embryonic Kidney (HEK) 293T, Madin-Darby Canine Kidney (MDCK), human lung carcinoma (A549), African Green Monkey kidney (Vero), mouse fibroblast (L929), human laryngeal carcinoma (HEp-2), and human foreskin fibroblast (HFF) cells.

The cytotoxicity test has been performed in comparison with known anti-viral agents as reference: ribavirin (RBV) and oseltamivir.

The compound 1 [methyl 2-amino-4-(1 ,3-benzodioxol-5-yl)-1 -(3-chloro-2- methylphenyl)-5-oxo-1 ,4,5,6,7,8-hexahydroquinoline-3-carboxylate], compound 3, and compound 5 [N-(3-carbamoyl-5,6-dihydro-4H-cyclopenta[b]thiophen-2-yl)-7- (difluoromethyl)-5-phenylpyrazolo[1 ,5-a]pyrimidine-3-carboxamide] showed no significant cytotoxicity up to concentrations of 250-1000 μΜ (Table 4), whereas ribavirin (RBV) and oseltamivir showed CC₅₀ (concentration that causes a decrease of cell viability of 50%) values >250 μΜ in all tested cell lines (Table 4).

Table 4. Cytotoxicity of compounds 1 and 5 in comparison with compound 3,

PB1 Ms-Tat peptide, ribavirin and oseltamivir

Expressed as the CC50, defined as the concentration of the compound that produces 50% cytotoxicity as determined by MTT assays. Reported values represent the means ± SD of data derived from at least three independent experiments; ND, not determined.

In summary, the compound 1 [methyl 2-amino-4-(1 ,3-benzodioxol-5-yl)-1 -(3- chloro-2-methylphenyl)-5-oxo-1 ,4,5,6,7,8-hexahydroquinoline-3-carboxylate] and the compound 5 [N-(3-carbamoyl-5,6-dihydro-4H-cyclopenta[b]thiophen-2-yl)-7- (difluoromethyl)-5-phenylpyrazolo[1 ,5-a]pyrimidine-3-carboxamide] have been demonstrated to be real effective agents against the influenza A and B viruses acting by disrupting the interactions of the subunits PA and PB1 of the heterotrimeric viral RNA polymerase fulfilling in this way the purposes of the present invention.

Therefore, these compounds can be an effective therapeutic tool for treating the influenza in humans and animals and represent an improved alternative to the anti-influenza therapeutic agents of the state-of-the-art.

In fact, both compound 1 [methyl 2-amino-4-(1 ,3-benzodioxol-5-yl)-1 -(3-chloro-2- methylphenyl)-5-oxo-1 ,4,5,6,7,8-hexahydroquinoline-3-carboxylate] and compound 5 [N-(3-carbamoyl-5,6-dihydro-4H-cyclopenta[b]thiophen-2-yl)-7- (difluoromethyl)-5-phenylpyrazolo[1 ,5-a]pyrimidine-3-carboxamide] showed no cytotoxicity at concentrations up to 1 imM and one molecule - compound 1 [methyl 2-amino-4-(1 ,3-benzodioxol-5-yl)-1 -(3-chloro-2-methylphenyl)-5-oxo-1 ,4,5,6,7,8- hexahydroquinoline-3-carboxylate] - blocked the formation of virus progeny with low micromolar potency, thus having a selectivity index >500. Additionally, the most active compound was effective not only against FluA but also against FluB viruses. Conversely, in contrast to other antiviral agents that act on viral RNA polymerases, these compounds do not possess broad-spectrum antiviral activity against RNA and DNA viruses of other families.

The inhibitors identified have a number of advantages compared to other classes of anti-influenza compounds. First, since protein-protein interactions are highly specific, their inhibitors are likely to be highly specific. In line with this, the compounds of the invention did not inhibit the replication of DNA viruses or of RNA viruses other than influenza virus. Further supporting their specificity, the active drug candidates did not exhibit significant cytotoxicity in cell culture.

A major concern in the use of anti-influenza drugs is the development of resistance (Hayden FG, de Jong MD, 201 1 ). The antiviral agents identified have a different mode of action to the current anti-influenza drugs, and thus are unlikely to suffer from cross-resistance. In fact, the most active of the compounds object of the invention - compound 1 [methyl 2-amino-4-(1 ,3-benzodioxol-5-yl)-1 -(3-chloro- 2-methylphenyl)-5-oxo-1 ,4,5,6,7,8-hexahydroquinoline-3-carboxylate] - inhibited the replication of an Oseltamivir-resistant virus strain. Another advantage of targeting viral protein-protein interactions is that dissociative inhibitors may be less prone to drug resistance than the current anti-influenza drugs. Since active site- directed inhibitors usually establish a few high-affinity interactions with the target protein, a single residue change often leads to resistance, as seen for instance with amantadine (De Clercq E, ref. cit). In contrast, a single mutation in one subunit of a protein-protein interface is likely to require a complementary mutation in the other subunit to maintain intact the complex. As simultaneous coupled mutations in different subunits are unlikely, the probability that the target protein complex can acquire resistance is reduced.

Finally, since the amino acids of both PB1 and PA that are essential for polymerase subunit interaction are highly conserved among all known FluA virus strains (Ghanem A et al., ref. cit.), inhibitory molecules will likely have broad efficacy against FluA viruses of both human and animal origin. Consistent with this, herein it is shown that compound 1 [methyl 2-amino-4-(1 ,3-benzodioxol-5-yl)- 1 -(3-chloro-2-methylphenyl)-5-oxo-1 ,4,5,6,7,8-hexahydroquinoline-3-carboxylate] inhibited the replication of a number of FluA virus strains, including the novel pandemic S-OIV. It is also noteworthy that compound 1 [methyl 2-amino-4-(1 ,3- benzodioxol-5-yl)-1 -(3-chloro-2-methylphenyl)-5-oxo-1 ,4,5,6,7,8- hexahydroquinoline-3-carboxylate] exhibited similar potencies against FluA and FluB viruses, while Oseltamivir is less active against FluB than FluA virus (Hatakeyama S et al., 2007). This compares favorably also with adamantanes, which are only effective against FluA virus (De Clercq E, ref. cit).

Therefore, the compounds methyl 2-amino-4-(1 ,3-benzodioxol-5-yl)-1 -(3-chloro-2- methylphenyl)-5-oxo-1 ,4,5,6,7,8-hexahydroquinoline-3-carboxylate and N-(3- carbamoyl-5,6-dihydro-4H-cyclopenta[b]thiophen-2-yl)-7-(difluoromethyl)-5- phenylpyrazolo[1 ,5-a]pyrimidine-3-carboxamide of the invention can be usefully employed as antiviral agents for use for the treatment of influenza by A and B viruses. In particular, methyl 2-amino-4-(1 ,3-benzodioxol-5-yl)-1 -(3-chloro-2- methylphenyl)-5-oxo-1 ,4,5,6,7,8-hexahydroquinoline-3-carboxylate is the preferred one for this use.

For this purpose the compounds methyl 2-amino-4-(1 ,3-benzodioxol-5-yl)-1 -(3- chloro-2-methylphenyl)-5-oxo-1 ,4,5,6,7,8-hexahydroquinoline-3-carboxylate and N-(3-carbamoyl-5,6-dihydro-4H-cyclopenta[b]thioph

phenylpyrazolo[1 ,5-a]pyrimidine-3-carboxamide can be used as a such or salified with pharmaceutically acceptable salts or pharmaceutically acceptable derivatives for the preparation of compositions in combination with pharmaceutically acceptable excipients and/or diluents suitable for parenteral and oral administration.

Hereinafter it is reported in detail the study performed in order to assess the ability of these small molecules to disrupt PA-PB1 interactions in the cell and to inhibit viral replication. Assays for anti-viral specificity and cytotoxicity are also reported in detail.

Experimental Part

Materials

Compounds. Ribavirin (RBV; 1 -D-ribofuranosyl-1 ,2,4-triazole-3-carboxamide) and oseltamivir carboxylic acid, the active form of oseltamivir [(3R,4R,5S)-4- acetamido-5-amino-3-(1 -ethylpropoxy)-1 -cyclohexene-1 - carboxylic acid] were obtained from Roche. Ganciclovir (GCV) was purchased from Sigma.

Compound 1 [methyl 2-amino-4-(1 ,3-benzodioxol-5-yl)-1 -(3-chloro-2- methylphenyl)-5-oxo-1 ,4,5,6,7,8-hexahydroquinoline-3-carboxylate] and compound 3 [4-{1 1 -(4-methoxyphenyl)-1 -oxo-3-[4-(trifluoromethyl)phenyl]- 1 ,2,3,4,5,1 1 -hexahydro-10H-dibenzo[b,e][1 ,4]diazepin-10-yl}-4-oxobutanoic acid] were purchased from SPECS (Delft, The Netherlands). Compound 5 [N-(3- carbamoyl-5,6-dihydro-4H-cyclopenta[b]thiophen-2-yl)-7-(difluoromethyl)-5- phenylpyrazolo[1 ,5-a]pyrimidine-3-carboxamide] was purchased from Chembridge Corporation (San Diego, CA, USA).

All compounds were dissolved in dimethyl sulfoxide (DMSO).

Peptide. The PB1 _{1 -15}-Tat peptide (MDVNPTLLFLKVPAQYGRKKRRQRRR, SEQ ID NO:1 ) was synthesized and purified by the Peptide Facility of CRIBI Biotechnology Centre (University of Padua, Italy). The PB1 _{- 5}-Tat peptide possesses a C-terminal sequence from the human immunodeficiency virus Tat protein (aa 47 to 57) that has been shown to mediate cell entry. The peptide was dissolved in water. Proteins. The PA, PB1 and PB2 subunits of fluA virus used are those of influenza A virus (A/Puerto Rico/8/1934(1-11 N1 )) having sequences with the following data bank accession numbers: PA GenBank Accession No: ABO21708.1 ; PB1 NCBI RefSeq: NP_040985.1 ; PB2 GenBank Accession No: ABO21705.1 . The nucleocapsid protein (NP) is the protein of influenza A virus (A/Puerto Rico/8/1934(1-11 N1 )) having data bank accession number GenBank Accession No: ADY00024.1 .

The PA, PB1 and PB2 subunits of fluB virus B/Panama/45/90 used have the following data bank accession numbers: PA GenBank Accession No: AAB72045; PB1 GenBank Accession No:72043; PB2 GenBank Accession No: AAB72044. The nucleoprotein (NP) of influenza B virus has data bank accession number GenBank Accession No: AAB72046.

The green fluorescent protein (GFP) used is the synthetic construct having data bank accession number GenBank Accession No: ADN93293.1 .

Plasmids. Plasmids pcDNA-PB1 [pcDNA-PB1 : pcDNA3 (Invitrogen V79020) modified in Hind 111 restriction site by inserting the PB1 sequence (NCBI RefSeq.: NP_040985)], pcDNA-PB2 [pcDNA-PB2: pcDNA3 (Invitrogen V79020) modified in BamHI restriction site by inserting PB2 sequence (GenBank Accession No: ABO21705)], pcDNA-PA [pcDNA-PA: pcDNA3 (Invitrogen V79020) modified in EcoRI restriction site by inserting PA sequence (GenBank Accession No: ABO21708)], and pcDNA-NP [(pcDNA-NP: pcDNA3 (Invitrogen V79020) modified in EcoRV/Xbal restriction site by inserting NP sequence (GenBank Accession No: ADY00024)], containing cDNA copies of the influenza A/PR/8/34 PB1 , PB2, PA, and NP genes, respectively, were created as described elsewhere (Mullin AE et al., ref. cit). Plasmid pPoll-Flu-ffLuc [pUC19 (GenBank Accession No: L09137) modified in Hindi 11 restriction site by inserting human RNA polymerase (pPoll) promoter (GenBank Accession No: NR_045058) sequence, hepatitis d ribozyme sequence (GenBank Accession No: 1 CX0_B), and the firefly luciferase gene (GenBank Accession No: M26194) sequence flanked by the 5' and 3' non- translated sequence of the segment 8 of A/WSN/33 virus genome (3'- UCGUUUUCGUCCCACUGUUUCUGUAUUAC-5' (SEQ ID NO:2) and 3'- AUUATCTTAGACUUUUUUGUGGGAACAAAGAUGA-5' SEQ ID NO:3)], which contains an influenza virus-based luciferase minireplicon vRNA under the control of the human RNA polymerase I promoter, was provided by L. Tiley (University of Cambridge, United Kingdom). Plasmid pRL-SV40 expressing the Renilla luciferase was purchased from Promega (Promega E2231 ). Plasmids pCI-PB1 [pCI-PB1 : pCI (Promega E1731 ) modified in Xhol restriction site by inserting PB1 sequence (GenBank Accession No: AAB72043)], pCI-PB2 [pCI-PB2: pCI (Promega E1731 ) modified in Notl restriction site by inserting PB2 sequence (GenBank Accession No: AAB72044)], pCI-PA [pCI-PA: pCI (Promega E1731 ) modified in Xbal restriction site by inserting PA sequence (GenBank Accession No: AAB72045)], and pCI-NP [pCI-NP: pCI (Promega E1731 ) modified in Xhol restriction site by inserting NP sequence (GenBank Accession No: AAB72046)], expressing B/Panama/45/90 polymerase and NP proteins (PA B/Panama/45/90: GenBank Accession No: AAB72045; PB1 B/Panama/45/90: GenBank Accession No: AAB72043; PB2 B/Panama/45/90: GenBank Accession No: AAB72044; NP B/Panama/45/90: GenBank Accession No: AAB72046 ), and plasmid pPoll-HA- GFP [pUC19 (GenBank L09137) modified in Hindlll restriction site by inserting human RNA polymerase (pPoll) promoter (GenBank Accession No: NR_045058) sequence, hepatitis d ribozyme sequence (GenBank Accession No: 1 CX0_B), and the GFP gene (GenBank Accession No: ADN93293) sequence flanked by the 5' and 3' non-translated sequence of the HA gene of B/Lee/40 virus (3'- UCGUCUUCGUCUCGUAAAAGAUUAUAGGUGUUU-5' (SEQ ID NO:4) and 3'- AUUAUCUAGACCCUCUAAUUCGGGACACAAAAGGAAAUAACAUCACGAGCA AACGAACAGUGGUAAUGUUUCUUUGCAAUAACUUUUUACGAGAACAAUGAU CA-5' (SEQ ID NO:5)], which contains an influenza virus-based green fluorescent protein (GFP) minireplicon vRNA under the control of the human RNA polymerase I promoter, were a gift of W. S. Barclay (Imperial College, London, United Kingdom). The pcDNA-PA-GFP plasmid, which encodes a PA-GFP fusion protein (fusion protein sequence: PA = GenBank Accession No: ABO21708; GFP = GenBank Accession No: ADN93293), was kindly provided by E. Fodor (University of Oxford, United Kingdom).

Cells and viruses. Human Embryonic Kidney (HEK) 293T, Madin-Darby Canine Kidney (MDCK), human lung carcinoma (A549), African Green Monkey kidney (Vero), mouse fibroblast (L929), human laryngeal carcinoma (HEp-2), and human foreskin fibroblast (HFF) cells were maintained in Dulbecco's modified Eagle's medium (DMEM, Life Biotechnologies) supplemented with 10% fetal bovine serum (FBS, Life Biotechnologies). All cells were grown in the presence of 100 U/ml penicillin and 100 μg/ml streptomycin (Life Biotechnologies) and were maintained at 37 °C in humidified atmosphere supplemented with 5% CO₂.

Influenza A/PR/8/34 virus (H1 N1 , Cambridge lineage) was obtained from the Division of Virology's (Department of Pathology, University of Cambridge, United Kingdom) collection of influenza viruses. The FluA viruses A/Wisconsin/67/05 and A/Solomon Island/3/06, and influenza B/Malaysia/2506/4 virus were provided by R. Cusinato (Clinical Microbiology and Virology Unit, Padua University Hospital, Padua, Italy); influenza B/Lee/40 virus was obtained from W. S. Barclay (Imperial College, London, United Kingdom). The clinical isolates A/Roma- ISS/2/08 and A/Parma/24/09 were kindly provided by I. Donatelli (Istituto Superiore di Sanita, Rome, Italy); local strains of the new pandemic variant H1 N1 FluA virus (A/Padova/30/201 1 , A/Padova/72/201 1 , and A/Padova/253/201 1 ) and of FluB virus (B/Padova/2/201 1 , B/Padova/3/201 1 , and B/Padova/42/201 1 ) were provided by C. Salata and A. Calistri (University of Padua, Italy). All influenza viruses were propagated in MDCK cells. Herpes simplex virus type 1 (HSV-1 , strain F) and human cytomegalovirus (HCMV, strain AD169) were purchased from the American Type Culture Collection (Manassas, VA). Vesicular stomatitis virus (VSV) was provided by G. Gribaudo (University of Turin, Italy). Clinical isolates of human measles virus (MV), coxsackie virus B1 (COX B1 ), respiratory syncytial virus (RSV), and adenovirus (AdV) were collected at the Microbiology and Virology Unity of Padua University Hospital (Italy).

Example 1 . Functional inhibition of PA-PB1 interactions in cells

For analysis of PA nuclear translocation, HEK 293T cells were transiently transfected using the Arrest-IN™ (Biosystems) with pcDNA-PA-GFP [pcDNA3 (Invitrogen V79020) modified in EcoRI restriction site by inserting PA sequence (GenBank Accession No: ABO21708) and GFP sequence (GenBank Accession No. ADN93293)] and pcDNA-PB1 [pcDNA3 (Invitrogen V79020) modified in Hindlll restriction site by inserting the PB1 sequence (NCBI RefSeq.: NP_040985)], in the absence or the presence of test compounds. At 24 hr post-transfection, cells were fixed for 20 min with 4% formaldehyde in PBS. After permeabilization with 0.2 % Triton X-100 in PBS for 5 min at room temperature, cells were incubated for 20 min with TOTO-3 iodide (Molecular Probes) in PBS and 4% FBS, mounted using mounting fluid (70% glycerol in PBS), and imaged using a Leica TCS-NT/SP2 confocal microscope equipped with a 63X oil immersion objective. Images were digitally analyzed with Leica software.

The results obtained have been previously discussed and are reported in Fig.1 A For analysis of the effect of the compounds on FluA RNA polymerase activity, HEK 293T cells were seeded into 24-well plates at a density of 2 x 10⁵ cells per well and incubated O/N at 37°C. Cells were then cotransfected with pcDNA-PB1 [pcDNA-PB1 : pcDNA3 (Invitrogen V79020) modified in Hindi 11 restriction site by inserting the PB1 sequence (NCBI RefSeq.: NP_040985)], pcDNA-PB2 [pcDNA- PB2: pcDNA3 (Invitrogen V79020) modified in BamHI restriction site by inserting PB2 sequence (GenBank Accession No: ABO21705)], pcDNA-PA [pcDNA-PA: pcDNA3 (Invitrogen V79020) modified in EcoRI restriction site by inserting PA sequence (GenBank Accession No: ABO21708)], and pcDNA-NP [(pcDNA-NP: pcDNA3 (Invitrogen V79020) modified in EcoRV/Xbal restriction site by inserting NP sequence (GenBank Accession No: ADY00024)], with the influenza virus- specific RNA polymerase l-driven firefly luciferase reporter plasmid (pPoll-Flu- ffLuc), and with pRL-SV40 plasmid (coding for Renilla luciferase; Promega E2231 ) which served to normalize variations in transfection efficiency. Transfections were performed with Arrest-IN™ (Biosystems) according to the manufacturer's recommendations in the presence of the test compounds 1 , 3 and 5, PB1 _{- 5}-Tat peptide (SEQ ID NO:1 ), or DMSO. Cell medium was replaced 5 hr post- transfection with DMEM containing compounds 1 , 3 and 5, PB1 1-15-Tat peptide (SEQ ID NO:1 ), or DMSO. At 24 hr post-transfection, cells were harvested and both firefly luciferase and Renilla luciferase expression were determined using the Dual Luciferase Assay Kit from Promega. The activity measured in control transfection reactions containing DMSO was set at 1 00%.

The results obtained are previously reported and shown in Fig.1 B. Example 2. Activity assay of the compounds against FluA and FluB viruses replication: plaque reduction assays (PRA) and virus yield reduction assays.

For plaque reduction assays (PRA) with FluA and FluB viruses, MDCK cells were seeded at a density of 5 x 10⁵ cells per well in 12-well plates. The next day, cells were infected with the FluA or FluB virus at 40 PFU/well in DMEM plus 0.14% BSA and 1 μg/ml TPCK-treated trypsin (Worthington Biochemical Corporation) for 1 hr at 37°C. Cells were then incubated with medium containing 1 .2% Avicel cellulose, 0.14% BSA, 1 μg/ml TPCK-treated trypsin, and various concentrations of each test compound. After 2 days, cell monolayers were fixed with 4% formaldehyde and stained with 0.1 % toluidine blue, and plaques were counted.

For virus yield reduction assays, MDCK cells were seeded at a density of 2 x 10⁵ cells per well in 24-well plates and incubated O/N. The next day, cells were infected with influenza A/PR/8/34 virus at a multiplicity of infection (MOI) of 0.01 in DMEM plus 0.14% BSA, and 1 μς/ιηΙ TPCK-treated trypsin for 1 hr at 37°C. Cells were then incubated with medium containing 0.14% BSA, 1 μg /ml TPCK-treated trypsin, and various concentrations of each compound. At 12 and 48 hr postinfection (p.i.), cell culture supernatants were collected and viral progeny was titrated by plaque assays on fresh MDCK monolayers.

The results obtained are previously reported and shown in Table 1 and Fig. 2A and B for FluA viruses and in Table 2 for FluB viruses.

Example 3. Activity assay of the compounds against FluA viruses replication: analysis of viral protein synthesis

MDCK cells were seeded at 2 x 10⁵ cells per well in 24-well plates. The next day, cells were infected with influenza A/PR/8/34 virus at an MOI of 5 in DMEM plus 0.14% BSA and 1 μς/ιηΙ TPCK-treated trypsin for 1 hr at 37 °C. Cells were then incubated with medium containing 0.14% BSA, 1 μg/ml TPCK-treated trypsin, and various concentrations of each test compound. After 12 hr, cells were incubated with medium containing [³⁵S]-Methionine (10 μθϊ/μΐ; Perkin Elmer) for 1 hr at 37°C. After labeling, cells were harvested, lysed by two freeze/thaw cycles, and analyzed by SDS-PAGE and autoradiography.

The results obtained are previously reported and shown in Fig. 2C. Example 4. Activity assay of the compounds against FluB viruses replication: minireplicon assay

For FluB virus minireplicon assays, HEK 293T cells were cotransfected with pCI- PB1 [pCI-PB1 : pCI (Promega E1731 ) modified in Xhol restriction site by inserting PB1 sequence (GenBank Accession No: AAB72043) )], pCI-PB2 [pCI-PB2: pCI (Promega E1731 ) modified in Notl restriction site by inserting PB2 sequence (GenBank Accession Bank AAB72044)], pCI-PA [pCI-PA: pCI (Promega E1731 ) modified in Xbal restriction site by inserting PA sequence (GenBank Accession No: AAB72045)], and pCI-NP [pCI-NP: pCI (Promega E1731 ) modified in Xhol restriction site by inserting NP sequence (GenBank Accession No: AAB72046)], and with the pPoll-HA-GFP reporter plasmid expressing RNA polymerase l-driven GFP gene.

Transfections were performed in the presence of the test compounds 1 and 3 or DMSO as described above. Cell medium was replaced 5 hr post-transfection with DMEM containing compounds or DMSO. At 24 hr post-transfection, cells were fixed for 20 min with 4% formaldehyde in PBS and then permeabilized with 0.2 % Triton X-100 in PBS for 5 min at room temperature. Cells were then were incubated for 20 min with TOTO-3 iodide (Molecular Probes) in PBS and 4% FBS, and imaged using a Leica TCS-NT/SP2 confocal microscope equipped with a 63X oil immersion objective. Images were digitally analyzed with Leica software.

The data obtained are previously reported and shown in Fig. 3.

Example 5. Activity assay of the compounds against non-influenza viruses The activity of the compounds against non-influenza viruses was evaluated for RNA viruses: vesicular stomatitis virus (VSV), respiratory syncytial virus (RSV), measles virus (MV), and coxsackie virus B1 (Cox B1 ) and DNA viruses: herpes simplex virus type 1 , HCMV, and human adenovirus (AdV) by PRAs for all viruses except COX B1 . For PRAs with HSV-1 , Vero cells were seeded at 1 .5 x 10⁵ cells per well in 24-well plates. The next day, cells were infected with HSV-1 (strain F) at 80 PFU/well in DMEM for 1 hr at 37°C. For PRAs with AdV, A549 cells were seeded at 1 x 10⁵ cells per well in 24-well plates. The next day, cells were infected with AdV at 40 PFU/well in DMEM for 1 hr at 37°C. For PRAs with VSV, L929 cells were seeded at 3 x 10⁵ cells per well in 12-well plates, and the next day infected with VSV at 40 PFU/well in DMEM for 2 hr at 37°C. For PRAs with MV, Vero cells were seeded at 0.5 x 10⁵ cells per well in 24-well plates, and the next day infected with MV at 40 PFU/well in DMEM for 2 hr at 37°C. For PRAs with RSV, HEp-2 cells were seeded at 1 x 10⁵ cells per well in 24-well plates. The next day, cells were infected with RSV at 40 PFU/well in DMEM for 2 hr at 37°C. All infected cells were then incubated with medium containing 1 .2% Avicel cellulose, 2% FBS, and various concentrations of each test compound. After appropriate periods of incubation, cell monolayers were fixed with 4% formaldehyde and stained with 0.1 % toluidine blue, and plaques were counted. The antiviral activity of the compounds against COX B1 was determined in Vero cells seeded at a density of 1 x 10⁵ cells per well in 96-well plates by microscopic estimation of the cytopathic effect at 24 hr p.i.

The compound 1 [methyl 2-amino-4-(1 ,3-benzodioxol-5-yl)-1 -(3-chloro-2- methylphenyl)-5-oxo-1 ,4,5,6,7,8-hexahydroquinoline-3-carboxylate], compound 5 [N-(3-carbamoyl-5,6-dihydro-4H-cyclopenta[b]thiophen-2-yl)-7-(difluoromethyl)-5- phenylpyrazolo[1 ,5-a]pyrimidine-3-carboxamide] and compound 3 were assayed in comparison with ribavirin (RBV) and ganciclovir (GCV) as reference anti-viral agents. The results are previously reported and shown in Table 3.

Example 6. Cytotoxicity assay of the compounds in cell lines

The cytotoxicity of test compounds were assayed by the 3-(4,5-dimethylthiazol-2- yl)-2,5-diphenyl tetrazolium bromide (MTT) method as described (Loregian A, Coen DM, 2006). The cell lines used were: Human Embryonic Kidney (HEK) 293T, Madin-Darby Canine Kidney (MDCK), human lung carcinoma (A549), African Green Monkey kidney (Vero), mouse fibroblast (L929), human laryngeal carcinoma (HEp-2), and human foreskin fibroblast (HFF) cells.

The cytotoxicity test has been performed in comparison with known anti-viral agents ribavirin (RBV) and oseltamivir.

The results obtained are previously reported and shown in Table 4.

References

Salomon R & Webster RG (2009) The influenza virus enigma. Cell

136(3):402-410 De Clercq E (2006) Antiviral agents active against influenza A viruses. Nat Rev Drug Discov 5:1015-1025.

Hayden FG, Hay AJ (1992) Emergence and transmission of influenza A viruses resistant to amantadine and rimantadine. Curr Top Microbiol Immunol 176:1 19-130.

Colman PM, Varghese JN, Laver WG (1983) Structure of the catalytic and antigenic sites in influenza virus neuraminidase. Nature 303:41 -44.

de Jong MD, et al. (2005) Oseltamivir resistance during treatment of influenza A (H5N1 ) infection. N Engl J Med 353:2667-2672.

Sidwell RW, et al. (1972) Broad-spectrum antiviral activity of Virazole: 1 - beta-D-ribofuranosyl-1 ,2,4-triazole-3-carboxamide. Science 177:705-706.

Biswas SK, Nayak DP (1994) Mutational analysis of the conserved motifs of influenza A virus polymerase basic protein 1 . J Virol 68:1819-1826.

Digard P, Blok VC, Inglis SC (1989) Complex formation between influenza virus polymerase proteins expressed in Xenopus oocytes. Virology 171 :162-169.

Guilligay D, et al. (2008) The structural basis for cap binding by influenza virus polymerase subunit PB2. Nat Struct Mol Biol 15:500-506.

Yuan P, et al. (2009) Crystal structure of an avian influenza polymerase PA(N) reveals an endonuclease active site. Nature 458:909-913.

Dias A, et al. (2009) The cap-snatching endonuclease of influenza virus polymerase resides in the PA subunit. Nature 458:914-918.

Torreira E, et al. (2007) Three-dimensional model for the isolated recombinant influenza virus polymerase heterotrimer. Nucleic Acids Res 35:3774- 3783.

Perez DR, Donis RO (1995) A 48-amino-acid region of influenza A virus

PB1 protein is sufficient for complex formation with PA. J Virol 69:6932-6939.

Ohtsu Y, Honda Y, Sakata Y, Kato H, Toyoda T (2002) Fine mapping of the subunit binding sites of influenza virus RNA polymerase. Microbiol Immunol 46:167-175.

Gonzalez S, Zurcher T, Ortin J (1996) Identification of two separate domains in the influenza virus PB1 protein involved in the interaction with the PB2 and PA subunits: a model for the viral RNA polymerase structure. Nucleic Acids Res 24:4456-4463.

Poole EL, Medcalf L, Elton D, Digard P (2007) Evidence that the C-terminal PB2-binding region of the influenza A virus PB1 protein is a discrete alpha-helical domain. FEBS Lett 581 :5300-5306.

Ghanem A et al. (2007) Peptide-mediated interference with influenza A virus polymerase. J Virol 81 :7801 -7804.

Obayashi E, et al. (2008) The structural basis for an essential subunit interaction in influenza virus RNA polymerase. Nature 454:1 127-1 131 .

He X, et al. (2008) Crystal structure of the polymerase PA(C)-PB1 (N) complex from an avian influenza H5N1 virus. Nature 454:1 123-1 126.

Baroni M, Cruciani G, Sciabola S, Perruccio F, Mason JS (2007) A common reference framework for analyzing/comparing proteins and ligands. Fingerprints for Ligands and Proteins (FLAP): theory and application. J Chem Inf Model 47:279- 294.

Fodor E, Smith M (2004) The PA subunit is required for efficient nuclear accumulation of the PB1 subunit of the influenza A virus RNA polymerase complex. J Virol 78:9144-9153.

Mullin AE, Dalton RM, Amorim MJ, Elton D, Digard P (2004) Increased amounts of the influenza virus nucleoprotein do not promote higher levels of viral genome replication. J Gen Virol 85:3689-3698.

Hayden FG, de Jong MD (201 1 ) Emerging influenza antiviral resistance threats. J Infect Dis 203:6-10.

Hatakeyama S, et al. (2007) Emergence of influenza B viruses with reduced sensitivity to neuraminidase inhibitors. JAMA 297:1435-1442.

Loregian A, Coen DM (2006) Selective anti-cytomegalovirus compounds discovered by screening for inhibitors of subunit interactions of the viral polymerase. Chem β/Ό/ 13:191 -200.

Claims

1 . A compound selected from methyl 2-amino-4-(1 ,3-benzodioxol-5-yl)-1 -(3- chloro-2-methylphenyl)-5-oxo-1 ,4,5,6,7,8-hexahydroquinoline-3-carboxylate and N-(3-carbamoyl-5,6-dihydro-4H-cyclopenta[b]thiophen-2-yl)-7-(difluoromethyl)-5- phenylpyrazolo[1 ,5-a]pyrimidine-3-carboxamide and pharmaceutically acceptable salts and derivatives thereof acting by disrupting PA and PB1 subunit interactions of viral RNA polymerase for use as anti-viral agents for treating the influenza in humans and animals.

2. The compound according to claim 1 , wherein said compound is used for treating the influenza by A and B viruses in humans and animals.

3. A use of a compound selected from methyl 2-amino-4-(1 ,3-benzodioxol-5- yl)-1 -(3-chloro-2-methylphenyl)-5-oxo-1 ,4,5,6,7,8-hexahydroquinoline-3- carboxylate and N-(3-carbamoyl-5,6-dihydro-4H-cyclopenta[b]thiophen-2-yl)-7- (difluoromethyl)-5-phenylpyrazolo[1 ,5-a]pyrimidine-3-carboxamide and pharmaceutically acceptable salts and derivatives thereof acting by disrupting PA and PB1 subunit interactions of viral RNA polymerase for the preparation of a composition for the treatment of the influenza in humans and animals.

4. The use according to claim 3, wherein the composition is for the treatment of the influenza by A and B viruses in humans and animals.

5. A composition comprising a compound selected from methyl 2-amino-4- (1 ,3-benzodioxol-5-yl)-1 -(3-chloro-2-methylphenyl)-5-oxo-1 ,4,5,6,7,8- hexahydroquinoline-3-carboxylate and N-(3-carbamoyl-5,6-dihydro-4H- cyclopenta[b]thiophen-2-yl)-7-(difluoromethyl)-5-phenylpyrazolo[1 ,5-a]pyrimidine- 3-carboxamide and pharmaceutically acceptable salts and derivatives thereof acting by disrupting PA and PB1 subunit interactions of viral RNA polymerase in combination with at least one pharmaceutically acceptable vehicle and/or excipient for use of the treatment of the influenza in humans and animals.

6. The composition according to claim 5, wherein said composition is used for the treatment of the influenza by A and B viruses in humans and animals.