CN111445951B - Optimization method for realizing low-cost high-throughput aptamer optimal sequence based on label-free hybridization probe competition method - Google Patents
Optimization method for realizing low-cost high-throughput aptamer optimal sequence based on label-free hybridization probe competition method Download PDFInfo
- Publication number
- CN111445951B CN111445951B CN202010185599.6A CN202010185599A CN111445951B CN 111445951 B CN111445951 B CN 111445951B CN 202010185599 A CN202010185599 A CN 202010185599A CN 111445951 B CN111445951 B CN 111445951B
- Authority
- CN
- China
- Prior art keywords
- aptamer
- sequence
- label
- optimal
- concentration
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Classifications
-
- G—PHYSICS
- G16—INFORMATION AND COMMUNICATION TECHNOLOGY [ICT] SPECIALLY ADAPTED FOR SPECIFIC APPLICATION FIELDS
- G16B—BIOINFORMATICS, i.e. INFORMATION AND COMMUNICATION TECHNOLOGY [ICT] SPECIALLY ADAPTED FOR GENETIC OR PROTEIN-RELATED DATA PROCESSING IN COMPUTATIONAL MOLECULAR BIOLOGY
- G16B30/00—ICT specially adapted for sequence analysis involving nucleotides or amino acids
-
- G—PHYSICS
- G16—INFORMATION AND COMMUNICATION TECHNOLOGY [ICT] SPECIALLY ADAPTED FOR SPECIFIC APPLICATION FIELDS
- G16B—BIOINFORMATICS, i.e. INFORMATION AND COMMUNICATION TECHNOLOGY [ICT] SPECIALLY ADAPTED FOR GENETIC OR PROTEIN-RELATED DATA PROCESSING IN COMPUTATIONAL MOLECULAR BIOLOGY
- G16B25/00—ICT specially adapted for hybridisation; ICT specially adapted for gene or protein expression
- G16B25/20—Polymerase chain reaction [PCR]; Primer or probe design; Probe optimisation
Abstract
The invention belongs to the field of molecular biology, and relates to an optimization method for realizing a low-cost high-throughput optimal sequence of a nucleic acid aptamer based on a label-free hybridization probe competition method. The optimization method for realizing the optimal sequence of the low-cost high-throughput aptamer based on the label-free hybridization probe competition method can be used for optimizing the aptamer of any type of target. The invention aims at different targets or different aptamers, and has simple characterization method, low cost and high flux.
Description
Technical Field
The invention belongs to the field of molecular biology, and relates to an optimization method for realizing an optimal sequence of a low-cost high-throughput aptamer based on a label-free hybridization probe competition method.
Background
Aptamer (Aptamer, also known as nucleic acid recognition entity, Aptamer) refers to a single-stranded oligonucleotide that can bind to a target with high affinity and recognize with high specificity, which is selected from artificially synthesized DNA or RNA libraries by the exponential enrichment of ligands by systematic evolution (SELEX). The basic sequence structure of the random library includes: the length of the middle random sequence is 35-60 bases, and the length of the primers used for amplification at two ends is about 20 bases respectively. The total length of the aptamer finally screened is about 60 to 100 bases.
Aptamers can form unique three-dimensional structures that allow aptamers to bind better to targets, ranging from small to ionic, single molecule, to large to whole cells. Aptamers have good selectivity and strong affinity for targets, which makes them advantageous over traditional recognition elements, to some extent comparable to antibodies. Therefore, the aptamer has wide application prospect in basic research, drug screening, clinical diagnosis and disease treatment of various diseases by replacing the traditional antibody.
In reported researches, the fact that the length of the aptamer is too long is not beneficial to forming a stable structure and easily causes unnecessary base mismatching, thereby influencing the recognition process. By removing unnecessary sequences of unrelated pairs to the recognition region, only the recognized core region is retained, and the aptamer length can be greatly shortened; and then, by analyzing possible spatial structures, a structural domain for improving the structural stability is increased, so that the binding affinity and specificity of the aptamer and the target are improved. The high-affinity aptamer obtained through optimization can fully utilize bases and reduce the synthesis cost. Currently, aptamers such as thrombin aptamers, ATP aptamers, IgE aptamers, and the like, which have been widely used, have a core sequence length of 15 to 30 bases. The sequence optimization of the selected aptamer becomes a necessary way for further application and is a difficult problem to be solved urgently because the sequence of a great amount of the selected aptamer is too long to be fully utilized.
The method for optimizing the sequence of the aptamer comprises a bioinformatics prediction method, an enzyme digestion protection experiment, a chip analysis method and the like. The bioinformatics prediction method is used for predicting the secondary structure of the aptamer based on algorithms such as thermodynamic minimum free energy and the like, but the reliability of the prediction method is difficult to ensure because the predictable secondary structure of the nucleic acid by each algorithm is very limited; the enzyme digestion protection experiment is to hydrolyze a compound combined by the aptamer and the target by utilizing ribozyme, so that a partial sequence combined by the aptamer and the target can be obtained, but a non-combined sequence playing a key role in stability in the aptamer cannot be obtained by the method; the chip technology is that the truncated segment of the aptamer is made into a chip, the binding signal of the target and the chip is modified by fluorescence, and the optimized sequence with better affinity is preferred. Because the current sequence optimization method for the aptamer lacks a quick, accurate and satisfactory method, especially the two difficulties of flux and cost.
Patent CN108387561A discloses an optimization method for realizing low-cost high-throughput aptamer optimal sequence based on the base quenching fluorescence principle, which utilizes the characteristic that G base has quenching fluorescein, and uses short-chain nucleic acid marked by fluorescein to screen and optimize unmodified aptamer in high throughput. The synthesis cost of the fluorescein-labeled short-chain nucleic acid used in patent CN108387561A is high, and although the optimization cost is reduced by half compared with the double-fluorescence labeling method, the cost is still high, for example, the design difficulty and synthesis cost of the complementary short-chain probe are relatively high, and are not suitable for high-throughput optimization.
Disclosure of Invention
The invention aims to solve the technical problems of complex operation, low flux, high cost and the like in the prior art and provides an optimization method for realizing the optimal sequence of a low-cost high-flux nucleic acid aptamer based on a label-free hybridization probe competition method.
In order to achieve the purpose, the invention provides the technical scheme that:
an optimization method for realizing the optimal sequence of a low-cost high-throughput aptamer based on a label-free hybridization probe competition method comprises the following steps:
step 1, selecting an optimal complementary region and an optimal complementary short-chain probe:
planning n regions by using the obtained long-chain aptamer as a candidate aptamer according to the base number of a full-length sequence, wherein each region comprises 20 bases, and a complementary short-chain probe with 7-20 bases is designed in each region; reacting a long-chain aptamer to be characterized with a target molecule with the concentration of 0-1000nM in a binding solution for 5-30 minutes at room temperature, adding each complementary short-chain probe containing SYBR Green I for reaction, and fitting an experimental result through a four-parameter equation, wherein the four-parameter equation is as follows:
wherein, I F Is a fluorescence response value; c OTA Is the target molecule concentration; a. the max Expressing the maximum value obtained after fitting the four-parameter equation; a. the min After fitting equation expressing four parametersThe minimum value obtained; IC (integrated circuit) 50 Expressing a semi-inhibition value obtained after fitting of a four-parameter equation; in which p is C OTA Is an IC 50 The slope of the time-fitted curve;
each complementary short-chain probe (A) was obtained by analysis of the working curve max -A min )/IC 50 Value, select (A) max -A min )/IC 50 The complementary short-chain probe with the maximum value is the optimal complementary short-chain probe;
step 2, obtaining a better aptamer preliminarily:
the region corresponding to the optimal complementary short-chain probe determined in the step 1) is a core recognition region of the aptamer, 3 bases are reduced from two ends of the original aptamer to the core region each time, a series of new aptamers are designed, and the IC of the new aptamers is obtained by the method of the step 1) 50 Value, select IC 50 The smallest value is the preferred aptamer;
step 3, obtaining the shortest aptamer sequence:
reducing the optimal nucleic acid aptamer obtained in the step 2) from two ends of nucleic acid aptamer to a core region by one base each time, designing a series of base truncated nucleic acid aptamers, adopting the method of the step 1), reacting the optimal complementary short-chain probe determined in the step 1), the target molecule and each base truncated nucleic acid aptamer to obtain IC corresponding to each base truncated nucleic acid aptamer 50 Value, select IC 50 Minimum value OR IC 50 The nucleic acid aptamer core sequence with smaller value but the structure of the nucleic acid aptamer core sequence is complementary to the tail end, namely the shortest nucleic acid aptamer sequence;
step 4, constructing the aptamer with higher affinity:
and 3) obtaining the aptamer with higher affinity, namely an analytic sequence, by a method of structure analysis and structural stability increase of the shortest aptamer sequence obtained in the step 3).
Further, the candidate aptamer in step 1) is one or more sequences comprising 60 to 100 bases.
Further, the length of the complementary short-chain probe in the step 1) is 7-20 bases.
Further, the length of the sequence analyzed in step 4) is 14 to 45 nucleotides.
Further, the concentration of NaCl in the binding solution in the step 1) is 80-200 nM; the concentration of calcium ion or magnesium ion is 1-30 mM; the concentration of the Tris-HCl buffer solution is 10-30mM, and the pH value is 5-10; the surfactant is Tween20 with a mass fraction of 0.01-0.2%.
Further, the target molecules in the step 1) are small molecules, large molecules, cells and pathogens.
Compared with the prior art, the invention has the beneficial effects that: the invention utilizes the characteristic that Sybr Green I has fluorescent response when only being embedded into double-stranded nucleic acid, and uses a label-free complementary short-chain probe to optimize the unmodified nucleic acid aptamer in high throughput. The method is based on the secondary sequence of the aptamer, so that the uncertainty of bioinformatics analysis is avoided, and the accuracy of sequence optimization is obviously improved; compared with the chip method and the fluorescence labeling method, the method provided by the invention has the advantage that the synthesis cost is obviously reduced. The method can be used for aptamer optimization of any type of target. The invention aims at different targets or different aptamers, and has simple characterization method, low cost and high flux. In conclusion, compared with the prior art, the optimization cost is further greatly reduced, signals are obtained through the label-free fluorescent dye SGI, the design difficulty and the synthesis cost of the complementary short-chain probe are greatly reduced, and the method is more suitable for high-throughput optimization.
Drawings
FIG. 1 is a schematic diagram of the method for optimizing the sequence of aptamer according to the present invention.
FIGS. 2A and 2B show that different short-chain probes (A) are added to OTA Ap42 max -A min )/IC 50 A map of values.
Detailed Description
In order to make the objects, technical solutions and advantages of the present invention more clear, the above solutions are further described with reference to the accompanying drawings and specific embodiments. It should be understood that the specific examples are intended to illustrate the invention and are not intended to limit the scope of the invention. The conditions employed in the examples may be further adjusted depending on the candidate aptamer and target, and the conditions used in the routine experiments are not generally indicated.
An optimization method for realizing the optimal sequence of a low-cost high-throughput aptamer based on a label-free hybridization probe competition method comprises the steps of providing an affinity evaluation standard, selecting the position of a complementary short-chain probe, optimizing the base number of the complementary short-chain probe and optimizing the optimal sequence of the aptamer, and specifically comprises the following steps:
(1) an affinity evaluation criterion was proposed. In the recognition system of the aptamer, ochratoxin A (OTA) and the complementary short-chain probe are in a competitive relationship, so that the affinity of the complementary short-chain probe and the aptamer influences the interaction of the aptamer and the OTA. In order to obtain a complementary short-chain probe with similar competitive capacity to OTA, the invention provides the following evaluation criteria:
A. when complementary short-chain probes are evaluated, they are obtained by analyzing the working curve (A) max -A min )/IC 50 The value of the one or more of the one,
(A max -A min )/IC 50 the larger the size, the more preferable the complementary short-chain probe.
B. After immobilization of the complementary short-chain probe, IC was obtained by analysis of the working curve when evaluating the novel aptamer 50 Value, IC 50 Smaller aptamers are preferred.
The target is micromolecule, macromolecule, cell, pathogen and the like. Reacting an aptamer to be characterized with a target molecule with the concentration of 0-1000nM in a binding solution for 5-30 minutes at room temperature, and adding a complementary short-chain probe containing SYBR Green I (SGI), wherein the binding solution comprises a solvent and a solute, and the solvent is water; the solute comprises 80-200nM NaCl, 1-30mM calcium ion or 1-30mM magnesium ion, 10-30mM Tris-HCl buffer solution, pH 5-10, and 0.01-0.2 wt% of surfactant Tween 20.
And (3) fitting an experimental result through a four-parameter equation, wherein the four-parameter equation is as follows:
wherein, I F Is a fluorescence response value; c OTA Target molecule concentration, here concentration of OTA; a. the max Expressing the maximum value obtained after fitting the four-parameter equation; a. the min Expressing the minimum value obtained after fitting the four-parameter equation; IC (integrated circuit) 50 Expressing a semi-inhibition value obtained after fitting of a four-parameter equation; in which p is C OTA Is an IC 50 The slope of the fitted curve.
(2) And selecting an optimal complementary region and an optimal complementary short-chain probe. Planning n regions by using the obtained long-chain aptamer as a candidate aptamer according to the base number of the full-length sequence, wherein each region comprises 20 bases, and a complementary short-chain probe with 7-20 bases is designed in each region, and the position of a complementary region can be adjusted if necessary. Obtaining (A) different complementary short-chain probes by the method of step (1) max -A min )/IC 50 The value is obtained. By comparison (A) max -A min )/IC 50 The value is selected to be the maximum value, thereby selecting the optimal complementary region, and the optimal complementary short-chain probe.
(3) Obtaining better aptamer preliminarily. The region corresponding to the optimal complementary short-chain probe is the core recognition region of the aptamer, 3 bases are reduced from two ends of the original aptamer to the core region each time, a series of new aptamers are designed, and the IC of the new aptamers is obtained by the method of the step (1) 50 Value, select IC 50 The smallest value is the preferred aptamer.
(4) Obtaining the shortest nucleic acid aptamer sequence. Reducing the preferred nucleic acid aptamers obtained in the step (3) from two ends of nucleic acid aptamers to the core region by one base at a time, designing a series of new nucleic acid aptamers, and obtaining the IC corresponding to the newly designed nucleic acid aptamers by the method in the step (1) 50 Value, select IC 50 Minimum value OR IC 50 Smaller but tailed in structure are aptamer core sequences.
(5) Nucleic acid aptamers with higher affinity are constructed. And (4) carrying out structural analysis on the shortest nucleic acid aptamer core sequence obtained in the step (4) to increase the structural stability, so as to obtain the nucleic acid aptamer with higher affinity. The length range of the analysis sequence is adjusted according to different candidate aptamers, and is specifically 14-45 bases.
Examples
Example of a method for performing sequence optimization of ochratoxin a aptamers: FIG. 1 is a schematic flow chart of an optimization method for realizing low-cost high-throughput aptamer optimal sequence based on the label-free hybridization probe competition method according to the present invention. The method mainly comprises the following steps:
firstly, selecting an optimal complementary region and an optimal complementary short-chain probe
The aptamer sequence of OTA obtained was TGGTGGCTGTAGGTCAGCATCTGAT CGGGTGTGGGTGGCGTAAAGGGAGCATCGGACAACG (SEQ ID NO.1) with 61 bases, which was divided into 3 regions each comprising 20 bases.
In practical experiments, it is found that the first 20 bases of the sequence are primers, and the complementary sequence thereof is not responsive to OTA with different concentrations, so that the complementary region is arranged in the last 42 base regions (1T base is reserved at the 5' end to satisfy 3 bases per cut), and because the number of bases is small and the core region is in the middle, 10 probe sequences located in the middle are designed in the embodiment.
From the experimental results of FIGS. 2A and 2B, of B13 (A) max -A min )/IC 50 The value varied the most, and the dissociation constant of the aptamer from OTA in this line was 200nM, so that the dissociation constant of its competitor (i.e., the complementary short-chain probe) was also of this order. Because the complementary short-chain probes will inhibit the interaction of OTA with the aptamer, the complementary short-chain probes will interact with small molecules with weak binding capacityThe length of the complementary strand is 7-20 bases.
And secondly, obtaining a better aptamer preliminarily.
Designing a series of new aptamers by reducing the number of bases from the 5' end of the original aptamer to the core region three at a time, and obtaining the IC of the new aptamers by the method of step (1) 50 Value, select IC 50 The smallest value is the preferred aptamer. Through analysis of experimental data, OTA Ap39L is a preferred aptamer truncated from 5'.
Thirdly, reducing the 3' end of the OTA Ap39L to the core region by three bases at a time, designing a series of new aptamers, and obtaining the IC of the new aptamers by the method of the step (1) 50 Value, select IC 50 The smallest value is the preferred aptamer. Through analysis of experimental data, the OTA Ap39L-6 is a preferred aptamer truncated from 3'.
And fourthly, obtaining the shortest nucleic acid aptamer sequence.
Through analysis of experimental data, the aptamer of ochratoxin A has good recognition capability compared with the aptamers OTA Ap39L-6, OTA Ap39L-7 and OTA Ap39L-8, and the binding capability of the aptamers of OTA Ap38L, OTA Ap39L-9, OTA Ap39L-10 and the like is obviously weakened. The OTA Ap39L-8 is the shortest sequence available.
Fifthly, constructing the aptamer with higher affinity.
The shortest aptamer core sequence obtained in step (IV) is considered to be aptamer recognition here based on experimental results and preliminary workThe ochratoxin A forms an antiparallel G quadruplex later, and the 31-base analysis structure forms three pairs of complementary sequences on the tail strands after the G quadruplex is formed, and the complementary tail strand structure is favorable for the stability of the whole system. Therefore, several pairs of complementary bases, IC, are added to the tail strand 50 The values are further reduced, which further demonstrates that the tail-strand formation after recognition of OTA by the formed aptamer is complementary and that extension of the complementary tail-strand contributes to stabilization of the structure. Finally, novel aptamers GG29CC, TATG29CATA and TATGG29CCATA with better affinity are obtained.
Sequence listing
<110> university of Large Community
<120> a method for realizing the optimum sequence of the low-cost high-throughput aptamer based on the label-free hybridization probe competition method
Chemical conversion method
<130> 2020
<160> 25
<170> PatentIn version 3.5
<210> 1
<211> 61
<212> DNA
<213> Artificial sequence
<220>
<223> aptamer sequences of OTA
<400> 1
tggtggctgt aggtcagcat ctgatcgggt gtgggtggcg taaagggagc atcggacaac 60
g 61
<210> 2
<211> 42
<212> DNA
<213> Artificial sequence
<220>
<223> OTA Ap42
<400> 2
tctgatcggg tgtgggtggc gtaaagggag catcggacaa cg 42
<210> 3
<211> 17
<212> DNA
<213> Artificial sequence
<220>
<223> B17
<400> 3
accgcatttc cctcgta 17
<210> 4
<211> 16
<212> DNA
<213> Artificial sequence
<220>
<223> B16
<400> 4
ccgcatttcc ctcgta 16
<210> 5
<211> 15
<212> DNA
<213> Artificial sequence
<220>
<223> B15
<400> 5
cgcatttccc tcgta 15
<210> 6
<211> 14
<212> DNA
<213> Artificial sequence
<220>
<223> B14
<400> 6
gcatttccct cgta 14
<210> 7
<211> 13
<212> DNA
<213> Artificial sequence
<220>
<223> B13
<400> 7
catttccctc gta 13
<210> 8
<211> 12
<212> DNA
<213> Artificial sequence
<220>
<223> B12
<400> 8
atttccctcg ta 12
<210> 9
<211> 11
<212> DNA
<213> Artificial sequence
<220>
<223> B11
<400> 9
tttccctcgt a 11
<210> 10
<211> 10
<212> DNA
<213> Artificial sequence
<220>
<223> B10
<400> 10
<210> 11
<211> 9
<212> DNA
<213> Artificial sequence
<220>
<223> B09
<400> 11
tccctcgta 9
<210> 12
<211> 8
<212> DNA
<213> Artificial sequence
<220>
<223> B08
<400> 12
ccctcgta 8
<210> 13
<211> 39
<212> DNA
<213> Artificial sequence
<220>
<223> OTA Ap39L
<400> 13
gatcgggtgt gggtggcgta aagggagcat cggacaacg 39
<210> 14
<211> 36
<212> DNA
<213> Artificial sequence
<220>
<223> OTA Ap36L
<400> 14
cgggtgtggg tggcgtaaag ggagcatcgg acaacg 36
<210> 15
<211> 36
<212> DNA
<213> Artificial sequence
<220>
<223> OTA Ap39L-3
<400> 15
gatcgggtgt gggtggcgta aagggagcat cggaca 36
<210> 16
<211> 33
<212> DNA
<213> Artificial sequence
<220>
<223> OTA Ap39L-6
<400> 16
gatcgggtgt gggtggcgta aagggagcat cgg 33
<210> 17
<211> 30
<212> DNA
<213> Artificial sequence
<220>
<223> OTA Ap39L-9
<400> 17
gatcgggtgt gggtggcgta aagggagcat 30
<210> 18
<211> 38
<212> DNA
<213> Artificial sequence
<220>
<223> OTA Ap38L
<400> 18
atcgggtgtg ggtggcgtaa agggagcatc ggacaacg 38
<210> 19
<211> 32
<212> DNA
<213> Artificial sequence
<220>
<223> OTA Ap39L-7
<400> 19
gatcgggtgt gggtggcgta aagggagcat cg 32
<210> 20
<211> 31
<212> DNA
<213> Artificial sequence
<220>
<223> OTA Ap39L-8
<400> 20
gatcgggtgt gggtggcgta aagggagcat c 31
<210> 21
<211> 29
<212> DNA
<213> Artificial sequence
<220>
<223> OTA Ap39L-10
<400> 21
gatcgggtgt gggtggcgta aagggagca 29
<210> 22
<211> 28
<212> DNA
<213> Artificial sequence
<220>
<223> OTA Ap39L-11
<400> 22
gatcgggtgt gggtggcgta aagggagc 28
<210> 23
<211> 33
<212> DNA
<213> Artificial sequence
<220>
<223> GG29CC
<400> 23
ggatcgggtg tgggtggcgt aaagggagca tcc 33
<210> 24
<211> 37
<212> DNA
<213> Artificial sequence
<220>
<223> TATG29CATA
<400> 24
tatgatcggg tgtgggtggc gtaaagggag catcata 37
<210> 25
<211> 39
<212> DNA
<213> Artificial sequence
<220>
<223> TATGG29CCATA
<400> 25
tatggatcgg gtgtgggtgg cgtaaaggga gcatccata 39
Claims (10)
1. An optimization method for realizing the optimal sequence of a low-cost high-throughput aptamer based on a label-free hybridization probe competition method is characterized by comprising the following steps:
step 1, selecting an optimal complementary region and an optimal complementary short-chain probe:
planning n regions by using the obtained long-chain aptamer as a candidate aptamer according to the base number of the full-length sequence, wherein each region comprises 20 bases, and a complementary short-chain probe with 7-20 bases is designed in each region; reacting a long-chain aptamer to be characterized with a target molecule with the concentration of 0-1000nM in a binding solution for 5-30 minutes at room temperature, adding each complementary short-chain probe containing SYBR Green I for reaction, and fitting an experimental result through a four-parameter equation, wherein the four-parameter equation is as follows:
wherein, I F Is a fluorescence response value; c OTA Is a targetThe concentration of the target molecule; a. the max Expressing the maximum value obtained after fitting the four-parameter equation; a. the min Expressing the minimum value obtained after fitting the four-parameter equation; IC (integrated circuit) 50 Expressing a semi-inhibition value obtained after fitting of a four-parameter equation; in which p is C OTA Is an IC 50 The slope of the time-fitted curve;
each complementary short-chain probe (A) was obtained by analysis of the working curve max -A min )/IC 50 Value, select (A) max -A min )/IC 50 The complementary short-chain probe with the maximum value is the optimal complementary short-chain probe;
step 2, obtaining a better aptamer preliminarily:
the region corresponding to the optimal complementary short-chain probe determined in the step 1) is a core recognition region of the aptamer, 3 bases are reduced from two ends of the original aptamer to the core region each time, a series of new aptamers are designed, and the IC of the new aptamers is obtained by the method of the step 1) 50 Value, select IC 50 The smallest value is the preferred aptamer.
Step 3, obtaining the shortest aptamer sequence:
reducing the optimal nucleic acid aptamer obtained in the step 2) from two ends of nucleic acid aptamer to a core region by one base each time, designing a series of base truncated nucleic acid aptamers, adopting the method of the step 1), reacting the optimal complementary short-chain probe determined in the step 1), the target molecule and each base truncated nucleic acid aptamer to obtain IC corresponding to each base truncated nucleic acid aptamer 50 Value, select IC 50 Minimum value OR IC 50 Smaller but tailend-complementary structures are aptamer core sequences, i.e., the shortest aptamer sequence.
Step 4, constructing the aptamer with higher affinity:
and 3) obtaining the aptamer with higher affinity, namely the resolved sequence, by a method of analyzing the structure and increasing the structural stability of the shortest aptamer sequence obtained in the step 3).
2. The method for optimizing the optimal sequence of the aptamer with low cost and high throughput based on the label-free hybridization probe competition method as claimed in claim 1, wherein the candidate aptamer in step 1) is one or more sequences comprising 60 to 100 bases.
3. The method for optimizing the optimal sequence of the aptamer with low cost and high throughput based on the label-free hybridization probe competition method according to claim 1 or 2, wherein the length of the complementary short-chain probe in the step 1) is 7-20 bases.
4. The method for optimizing the optimal sequence of the aptamer with low cost and high throughput based on the label-free hybridization probe competition method according to claim 1 or 2, wherein the length of the resolved sequence in the step 4) is 14-45 bases.
5. The method for optimizing the optimal sequence of the aptamer with low cost and high throughput based on the label-free hybridization probe competition method as claimed in claim 3, wherein the length of the sequence analyzed in step 4) is 14-45 bases.
6. The optimization method for realizing the optimal sequence of the aptamer with low cost and high throughput based on the label-free hybridization probe competition method according to claim 1, 2 or 5, wherein the concentration of NaCl in the binding solution in the step 1) is 80-200 nM; the concentration of calcium ion or magnesium ion is 1-30 mM; the concentration of the Tris-HCl buffer solution is 10-30mM, and the pH value is 5-10; the surfactant is Tween20 with a mass fraction of 0.01-0.2%.
7. The optimization method for realizing the optimal sequence of the low-cost high-throughput aptamer based on the label-free hybridization probe competition method according to claim 3, wherein the concentration of NaCl in the binding solution in the step 1) is 80-200 nM; the concentration of calcium ion or magnesium ion is 1-30 mM; the concentration of the Tris-HCl buffer solution is 10-30mM, and the pH value is 5-10; the surfactant is Tween20 with a mass fraction of 0.01-0.2%.
8. The optimization method for realizing the optimal sequence of the low-cost high-throughput aptamer based on the label-free hybridization probe competition method as claimed in claim 4, wherein the concentration of NaCl in the binding solution in the step 1) is 80-200 nM; the concentration of calcium ion or magnesium ion is 1-30 mM; the concentration of the Tris-HCl buffer solution is 10-30mM, and the pH value is 5-10; the surfactant is Tween20 with a mass fraction of 0.01-0.2%.
9. The optimization method for realizing the optimal sequence of the aptamer with low cost and high throughput based on the label-free hybridization probe competition method according to claim 1, 2, 5, 7 or 8, wherein the target molecules in the step 1) are small molecules, large molecules, cells and pathogens.
10. The method for optimizing the optimal sequence of the aptamer with low cost and high throughput based on the label-free hybridization probe competition method according to claim 6, wherein the target molecules in step 1) are small molecules, large molecules, cells and pathogens.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202010185599.6A CN111445951B (en) | 2020-03-17 | 2020-03-17 | Optimization method for realizing low-cost high-throughput aptamer optimal sequence based on label-free hybridization probe competition method |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202010185599.6A CN111445951B (en) | 2020-03-17 | 2020-03-17 | Optimization method for realizing low-cost high-throughput aptamer optimal sequence based on label-free hybridization probe competition method |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN111445951A CN111445951A (en) | 2020-07-24 |
| CN111445951B true CN111445951B (en) | 2022-09-20 |
Family
ID=71627563
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202010185599.6A Active CN111445951B (en) | 2020-03-17 | 2020-03-17 | Optimization method for realizing low-cost high-throughput aptamer optimal sequence based on label-free hybridization probe competition method |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN111445951B (en) |
Families Citing this family (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN116754762A (en) * | 2023-04-26 | 2023-09-15 | 国家粮食和物资储备局科学研究院 | Mycotoxin non-toxic quantitative analysis kit based on aptamer and application thereof |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2002029379A2 (en) * | 2000-10-04 | 2002-04-11 | Celadon Laboratories, Inc. | Computer system for designing oligonucleotides used in biochemical methods |
| CN104561013A (en) * | 2015-01-05 | 2015-04-29 | 中国人民解放军南京军区福州总医院 | Method for optimizing aptamer sequence based on high-throughput sequencing technology |
| CN108387561A (en) * | 2018-01-18 | 2018-08-10 | 大连理工大学 | A kind of optimization method for realizing inexpensive high-throughput nucleic acid aptamers optimal sequence based on base quenching fluorescence principle |
-
2020
- 2020-03-17 CN CN202010185599.6A patent/CN111445951B/en active Active
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2002029379A2 (en) * | 2000-10-04 | 2002-04-11 | Celadon Laboratories, Inc. | Computer system for designing oligonucleotides used in biochemical methods |
| CN104561013A (en) * | 2015-01-05 | 2015-04-29 | 中国人民解放军南京军区福州总医院 | Method for optimizing aptamer sequence based on high-throughput sequencing technology |
| CN108387561A (en) * | 2018-01-18 | 2018-08-10 | 大连理工大学 | A kind of optimization method for realizing inexpensive high-throughput nucleic acid aptamers optimal sequence based on base quenching fluorescence principle |
Non-Patent Citations (2)
| Title |
|---|
| 基于竞争触发滚环扩增的荧光适配体传感器高灵敏检测凝血酶;张松柏等;《分析化学》;20151115(第11期);全文 * |
| 核酸适配体荧光探针在生化分析和生物成像中的研究进展;黄子珂等;《应用化学》;20180110(第01期);全文 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN111445951A (en) | 2020-07-24 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Kohlberger et al. | SELEX: Critical factors and optimization strategies for successful aptamer selection | |
| Wilson | Preparation of single-stranded DNA from PCR products with streptavidin magnetic beads | |
| CN101809167B (en) | Method for generating aptamers with improved off-rates | |
| US20100120097A1 (en) | Methods and compositions for nucleic acid sequencing | |
| WO2012002541A1 (en) | Method for detection of target molecule | |
| CN113215167B (en) | Aptamer and application thereof in detecting cells infected by largemouth black bass iridovirus | |
| CN112779260B (en) | Aptamer of flavin mononucleotide, screening method and application thereof | |
| CN108387561B (en) | A kind of optimization method for realizing inexpensive high-throughput nucleic acid aptamers optimal sequence based on base quenching fluorescence principle | |
| KR20180041331A (en) | The method and kit of the selection of Molecule-Binding Nucleic Acids and the identification of the targets, and their use | |
| CN111445951B (en) | Optimization method for realizing low-cost high-throughput aptamer optimal sequence based on label-free hybridization probe competition method | |
| US20190106698A1 (en) | Method for aptamer pair selection | |
| CN112662771B (en) | Targeting capture probe of tumor fusion gene and application thereof | |
| US10590451B2 (en) | Methods of constructing a circular template and detecting DNA molecules | |
| CN104388426B (en) | A kind of Oligo dT primers and the method in construction cDNA library | |
| CN113462693B (en) | Application of ssDNA aptamer in identifying largemouth black bass iridovirus infected cells | |
| RU2652952C1 (en) | Method for creation and selection of the library of modified aptamers | |
| CN111363749B (en) | Nucleic acid aptamer for detecting Chinese softshell turtle iridovirus as well as construction method and application thereof | |
| Dausse et al. | In vitro selection procedures for identifying DNA and RNA aptamers targeted to nucleic acids and proteins | |
| CN106283198B (en) | Library construction method for single cell whole genome bisulfite sequencing | |
| CN111363748A (en) | Aptamer, construction method thereof and application thereof in detection of Chinese softshell turtle rainbow virus | |
| CN114621958B (en) | Single-stranded DNA aptamer sequence for specifically recognizing ATP and application thereof | |
| CN113462694B (en) | Nucleic acid aptamer for megaphone iridovirus infected cells and application thereof | |
| CN113897367B (en) | Nucleic acid aptamer for specifically recognizing p-hydroxybenzylsulfuronate and application thereof | |
| WO2024009960A1 (en) | Bio-fluid's ligand library enrichment technology and uses thereof | |
| CN110257385B (en) | Aptamer for resisting grass carp reovirus I, and construction method and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |