CN111440876A

CN111440876A - Kit and method for quantitatively detecting methylation degree of human MGMT gene

Info

Publication number: CN111440876A
Application number: CN202010486776.4A
Authority: CN
Inventors: 许明炎; 张晓妮; 屈宏越
Original assignee: Haplox Biotechnology Shenzhen Co ltd
Current assignee: Haplox Biotechnology Shenzhen Co ltd
Priority date: 2020-06-01
Filing date: 2020-06-01
Publication date: 2020-07-24

Abstract

The application discloses a kit and a method for quantitatively detecting human MGMT gene methylation degree, wherein the kit comprises an MGMT gene detection reagent, an internal control β -Actin gene detection reagent and a standard substance, the MGMT gene detection reagent comprises an MGMT primer pair and an MGMT probe which are respectively sequences shown in SEQ ID NO. 1-3, the internal control β -Actin gene detection reagent comprises a β -Actin primer pair and a β -Actin probe which are respectively sequences shown in SEQ ID NO. 4-6, the two probes are modified by different fluorescent groups, and the standard substance is formed by mixing 100% of methylated MGMT gene and 0% of methylated MGMT gene according to different proportions.

Description

Kit and method for quantitatively detecting methylation degree of human MGMT gene

Technical Field

The application relates to the field of MGMT gene methylation detection, in particular to a kit and a method for quantitatively detecting the methylation degree of human MGMT genes.

Background

The MGMT gene encodes an O6-methylguanine DNA methyltransferase. In normal cells, MGMT removes the methyl group at the position O6 of guanine which is abnormally methylated, allowing DNA damage due to guanine methylation to be repaired. The MGMT expression deletion and DNA repair obstacle caused by the methylation of the CpG island of the MGMT gene promoter are closely related to the occurrence and development of various tumors. Research shows that over 50% of glioma can generate MGMT gene promoter CpG island methylation, and the glioma patients of the type are sensitive to temozolomide chemotherapy, and the life cycle of the patients can be obviously prolonged by combining temozolomide chemotherapy with radiotherapy. Therefore, the methylation of the CpG island of the MGMT gene promoter can be used as a molecular marker for glioma molecular typing and prediction of the sensitivity of glioma molecular typing to an alkylating agent.

NCCN guidelines recommend MGMT promoter methylation to be an important molecular diagnostic tool for all high grade gliomas (grade III or IV), especially for elderly patients with increased diagnostic value. Patients with unmethylated MGMT promoter benefit less from temozolomide chemotherapy than patients with methylated MGMT promoter.

Therefore, detection of MGMT gene methylation is an important reference for molecular typing, prediction and medication guidance of glioma. The existing MGMT gene methylation detection method mainly comprises a fluorescence PCR method and a pyrosequencing method. Under the chemical action of genome DNA, the unmethylated cytosine undergoes a series of chemical modifications and is converted into uracil, and the methylated cytosine does not change due to the protection of the methyl. The fluorescence PCR method is to utilize the difference, take the common methylation region of the MGMT gene promoter as a target, design ARMS primers, adopt a fluorescence labeling probe, and utilize a real-time fluorescence PCR detection technology to qualitatively analyze the methylation state of the MGMT gene promoter. However, this detection method can only qualitatively determine the MGMT gene promoter, and cannot quantitatively determine the methylation degree. Pyrosequencing also utilizes the difference caused by the methyl protection of methylated cytosine to determine the methylation degree of MGMT gene by detecting the proportion of C/T introgression at CpG corresponding sites on a DNA template by a pyrosequencer. Although pyrosequencing can accurately detect the degree of methylation, this method requires a special instrument and equipment, and is expensive.

Therefore, how to simply and effectively quantitatively detect the methylation degree of the MGMT gene is a research focus and difficulty in the field.

Disclosure of Invention

The purpose of this application is to provide a new kit and method for quantitative determination of the methylation degree of human MGMT gene.

In order to achieve the purpose, the following technical scheme is adopted in the application:

the first aspect of the application discloses a kit for quantitatively detecting human MGMT gene methylation degree, which comprises an MGMT gene detection reagent, an internal control β -Actin gene detection reagent and a standard substance, wherein the MGMT gene detection reagent comprises an MGMT primer pair and an MGMT probe, the upstream primer and the downstream primer of the MGMT primer pair are respectively a sequence shown in SEQ ID NO.1 and a sequence shown in SEQ ID NO.2, the MGMT probe is a sequence shown in SEQ ID NO.3, the internal control β -Actin gene detection reagent comprises a β -Actin primer pair and a β -Actin probe, the upstream primer and the downstream primer of the β -Actin primer pair are respectively a sequence shown in SEQ ID NO.4 and SEQ ID NO.5, and the β -Actin probe is a sequence shown in SEQ ID NO. 6;

SEQ ID NO.1：5’-CGCGTTTCGGATATGTTGGG-3’

SEQ ID NO.2：5’-ATCAAAACGACCCCACACCC-3’

SEQ ID NO.3：5’-CGCGGTGCGTATCGTTTGCG-3’

SEQ ID NO.4：5’-AGTGAGTGGTGTGGGGTTAA-3’

SEQ ID NO.5：5’-CCAACCTTACACATACCAAAACCA-3’

SEQ ID NO.6：5’-TGGTTTGAGTGGTTGTGGTGGTGT-3’

wherein, the 5' ends of the MGMT probe and the β -Actin probe are respectively modified by different fluorescent groups, and the standard sample is a series of mixed nucleic acid samples with known methylated MGMT gene content, which are formed by 100 percent of methylated MGMT gene and 0 percent of methylated MGMT gene according to different proportions.

The kit can be used for carrying out double real-time fluorescent quantitative detection on a nucleic acid sample to be detected by adopting an MGMT gene detection reagent and an internal control β -Actin gene detection reagent, can be used for realizing relative quantitative detection on the methylation degree of the MGMT gene by combining a quality control product specially developed by the application, solves the problem that the conventional fluorescent PCR method cannot be used for quantitatively detecting the methylation degree of the MGMT gene, only needs a fluorescent quantitative PCR detector conventionally used in a laboratory for carrying out the relative quantitative detection on the methylation degree of the MGMT gene by adopting the kit, does not need special equipment compared with a pyrosequencing method, and is relatively low in cost.

It should be noted that, in the kit of the present application, on one hand, each of the MGMT primer pair, MGMT probe, β -Actin primer pair and β -Actin probe should ensure the specificity of its detection target, on the other hand, two sets of primer probes should be capable of cooperating with each other to achieve dual real-time quantitative fluorescence detection, and in addition, the use of a standard product and a standard curve should be considered.

Preferably, the kit of the present application further comprises at least one of a DNA extraction reagent, a methylation conversion reagent and a real-time fluorescent quantitative PCR detection reagent.

It should be noted that the kit of the present application is developed for dual real-time fluorescence quantitative detection of MGMT gene methylation, and therefore, the use of the MGMT gene detection reagent and the internal control β -Actin gene detection reagent in the kit of the present application needs to involve a real-time fluorescence quantitative PCR detection reagent, and in addition, the nucleic acid methylation detection may involve a DNA extraction reagent and a methylation conversion reagent.

Preferably, in the kit, the 5 'end of the MGMT probe is modified by FAM fluorescent group, the 3' end of the MGMT probe is modified by NFQ-MGB fluorescent quenching group, the 5 'end of the β -Actin probe is modified by Hex fluorescent group, and the 3' end of the MGMT probe is modified by NFQ-MGB fluorescent quenching group.

It should be noted that, in the kit of the present application, the detection reagent is detected by using dual real-time fluorescence quantitative PCR, and therefore, in principle, only the MGMT probe and the β -Actin probe are modified by using different fluorescent groups, and the two can be effectively distinguished in one reaction, FAM and Hex fluorescent groups are only modified by a specifically used fluorescent group in an implementation manner of the present application, and other fluorescent groups are not excluded.

Preferably, in the kit of the application, the standard includes mixed nucleic acid samples with the contents of methylated MGMT gene being 0%, 5%, 10%, 30%, 60% and 100% in sequence.

In the kit of the present application, the standard substance is used for preparing a standard curve; therefore, in principle, as long as the methylated MGMT gene content in each standard can be uniformly covered from 0% to 100%; the six standards of 0%, 5%, 10%, 30%, 60%, and 100% are only specific standard formulations in one implementation of the present application. It can be understood that the more the number of the standard substance is, the more uniform the distribution is from 0% to 100%, the more accurate the drawn standard curve is; however, considering that the greater the number of standards, the higher the corresponding test cost; therefore, the standard curve meeting the use requirement can be accurately drawn by adopting six standard products.

The second aspect of the application discloses application of the kit in preparing a glioma molecular typing detection reagent.

In a third aspect, the application discloses the application of the kit in the preparation of a reagent for screening or researching glioma treatment drugs.

The kit can simply, effectively and accurately quantitatively detect the methylation degree of the human MGMT gene, and the methylation of the MGMT gene can be used as a molecular marker for typing glioma molecules and predicting the sensitivity of the glioma molecules to an alkylating agent; therefore, the kit can be used for preparing a glioma molecular typing detection reagent or screening or researching glioma treatment drugs.

The fourth aspect of the application discloses a method for quantitatively detecting human MGMT gene methylation degree, which comprises the steps of converting an extracted DNA sample to be detected by using a methylation conversion reagent, then performing double real-time fluorescence quantitative PCR detection on the converted DNA sample to be detected by using the MGMT gene detection reagent and the internal control β -Actin gene detection reagent in the kit of the application, and judging the MGMT gene methylation degree according to the Ct value of the DNA sample to be detected.

It should be noted that the detection method of the present application is only used for quantitatively detecting the methylation degree of the human MGMT gene, and the detection result directly obtained by the detection method is only the methylation degree of the MGMT gene; according to the prior art, MGMT gene methylation can be used as a molecular marker for glioma molecular typing and prediction of glioma sensitivity to an alkylating agent; however, the degree of methylation of the MGMT gene is not directly used as a basis for judging glioma diagnosis. In addition, for patients with established glioma, the drug may be selected according to the degree of methylation of the MGMT gene; however, the specific drug effect or therapeutic effect cannot be judged from the quantitative detection result of the methylation degree of the MGMT gene.

Preferably, the detection method further comprises the steps of carrying out double real-time fluorescent quantitative PCR detection on the standard substance in the kit by using the MGMT gene detection reagent and the internal control β -Actin gene detection reagent, drawing a standard curve representing the methylation degree of the MGMT gene according to the detection result of the standard substance, and substituting the Ct value of the DNA sample to be detected into the standard curve to obtain the quantitative result of the methylation degree of the MGMT gene of the DNA sample to be detected.

It should be noted that the relative quantification by using the standard curve is an important technical means of the kit and the detection method; for the detection of the same batch or the same laboratory, the same standard curve can be used for MGMT gene methylation degree quantification, so that the standard substance is not required to be detected in each MGMT gene methylation degree quantification detection test, and the standard curve is drawn again. Generally, it is recommended to redraw the standard curve for different operators, different laboratories, or with different batches or sources of detection reagents.

In a fifth aspect, the application discloses the use of the method for quantitatively detecting the methylation degree of the human MGMT gene in molecular typing detection of glioma.

The sixth aspect of the application discloses the application of the method for quantitatively detecting the methylation degree of the human MGMT gene in glioma treatment drug screening or research.

The detection method can simply, effectively and accurately quantitatively detect the methylation degree of the human MGMT gene, and the methylation of the MGMT gene can be used as a molecular marker for typing glioma molecules and predicting the sensitivity of glioma molecules to an alkylating agent; therefore, the detection method can be used for molecular typing detection of glioma, or screening or research of glioma treatment drugs. It is understood that the detection method of the present application is used for glioma molecular typing detection, and the purpose is to detect glioma molecular typing only, and the detection result is only used as intermediate reference data to guide clinical medication or guide the establishment of personalized treatment schemes; it is not intended directly for diagnosis or treatment, nor does it directly reflect the therapeutic effect.

Due to the adoption of the technical scheme, the beneficial effects of the application are as follows:

the kit provided by the application carries out double real-time fluorescence quantitative PCR detection on a sample to be detected by utilizing the MGMT gene detection reagent and the internal control β -Actin gene detection reagent, and realizes the relative quantification of the methylation degree of the MGMT gene through a standard curve by utilizing a standard curve drawn by a standard product.

Drawings

FIG. 1 is a graph showing the results of real-time fluorescent quantitative PCR amplification of six standards in the examples of the present application;

FIG. 2 is a graph showing the results of real-time fluorescent quantitative PCR amplification of sample DNA in the examples of the present application.

Detailed Description

In the two existing MGMT gene methylation detection methods, a pyrosequencing method is complex to operate, special instruments and equipment are needed, and the cost is high; the fluorescence PCR method can only qualitatively analyze the methylation of the MGMT gene and cannot quantitatively detect the methylation degree of the MGMT gene.

The method creatively designs double real-time fluorescent PCR detection primers and probes of the MGMT gene and the internal control β -Actin gene on the basis of real-time fluorescent PCR, and utilizes standard substances mixed by 100% of methylated MGMT gene and 0% of methylated MGMT gene according to different proportions to draw a standard curve, thereby realizing the relative quantification of the methylation degree of the MGMT gene according to the standard curve.

Unlike existing concentration gradient standards, which are generally defined by concentration, the present application inventively defines standards by the degree of methylation of the MGMT gene; therefore, the result of relative quantification is not the concentration, but the degree of methylation of the MGMT gene of the sample to be tested.

Moreover, the general standard curve is real-time fluorescence PCR matched with a dye method, such as SYBR Green real-time fluorescence PCR; the standard curve is creatively combined with the real-time fluorescence PCR by the probe method, and the relative quantification is carried out through the Ct value. Compared with dye-based real-time fluorescent PCR, the probe-based real-time fluorescent PCR has higher accuracy and specificity. In addition, the MGMT gene specific primer pair and the site of the probe are screened, so that the MGMT gene specific primer pair and the site of the probe can be better matched with a standard curve for use.

On the basis of the kit, the reaction system and the reaction conditions of the dual real-time fluorescence quantitative PCR are further researched.

The optimized PCR reaction system of the application is as follows:

the optimized PCR reaction conditions of the application are as follows:

the first stage is as follows: denaturation at 90-96 ℃ for 2-5 min, and 1 cycle;

and a second stage: denaturation at 90-96 ℃ for 10-30 s, annealing at 55-60 ℃ for 30-60 s, and 50 cycles;

the fluorescence signal is collected during the second stage annealing.

The kit and the detection method solve the problem that the existing fluorescence PCR method cannot quantitatively detect the methylation degree of the MGMT gene; moreover, the kit and the detection method can simply and effectively realize quantitative detection only by adopting the existing real-time fluorescence quantitative PCR instrument, and have lower cost compared with a pyrophosphoric acid sequencing method which only can adopt special equipment.

The present application is described in further detail below with reference to specific embodiments and the attached drawings. The following examples are intended to be illustrative of the present application only and should not be construed as limiting the present application.

Examples

First, primer and Probe design

The present example selects the position containing more methylation sites for designing MGMT gene, and the present example designs MGMT primer pair and MGMT probe specific to MGMT gene at the position containing 5 CpG sites, meanwhile, designs β -Actin gene specific primer and probe, namely β -Actin primer pair and β -Actin probe, for internal control β -Actin gene, which can cooperate with MGMT primer pair and MGMT probe to perform double real-time fluorescence quantitative PCR, the MGMT primer pair, MGMT probe, β -Actin primer pair and β -Actin probe designed in the present example are shown in Table 1, and all the primer pairs and probes are synthesized by Biotechnology (Shanghai) GmbH.

TABLE 1 specific primer pairs and probes

Primer or Probe name	Sequence (5 '→ 3')	SEQ ID NO.
			Upstream primer of MGMT primer pair	CGCGTTTCGGATATGTTGGG		1
MGMT primer pair downstream primer	ATCAAAACGACCCCACACCC	2
			MGMT probe	CGCGGTGCGTATCGTTTGCG	3
β -Actin primer pair upstream primer	AGTGAGTGGTGTGGGGTTAA					4
			β -Actin primer pair downstream primer	CCAACCTTACACATACCAAAACCA	5
β -Actin probe	TGGTTTGAGTGGTTGTGGTGGTGT	6

The 5 'end of the MGMT probe is modified by FAM fluorescent group, the 3' end of the MGMT probe is modified by NFQ-MGB fluorescent quenching group, the 5 'end of the β -Actin probe is modified by Hex fluorescent group, and the 3' end of the MGMT probe is modified by NFQ-MGB fluorescent quenching group.

Secondly, preparation and detection of standard substance

1. Preparation of standards

In this example, 5. mu.g/20. mu. L of MGMT gene 100% methylated reference prepared from human HCT116 DKO cell line by M.Sssl methyltransferase treatment and 5. mu.g/20. mu. L of MGMT gene 0% methylated reference prepared from human HCT116 DKO cell line by knock-out methyltransferases DNMT1 and DNMT3b by genetic engineering (ZMYO Research, Humanmethylated & Non-methylated DNA Set) were selected.

The 100% methylated standard and the 0% methylated standard were diluted according to the gradient shown in table 2 to prepare the remaining 6 gradients of methylated standards.

TABLE 2 proportions of the ingredients in the standard

In Table 2, "standard number" and "0%" are referred to as MGMT gene 0% methylation reference, and "standard number" and "100%" are referred to as MGMT gene 100% methylation reference.

The prepared standards are uniformly diluted to 10 ng/mu L for standby.

2. Standard test

The primer pairs and probes in Table 1 were used to perform dual real-time fluorescent quantitative PCR detection on the standard, and the PCR reaction system is shown in Table 3.

TABLE 3 Dual real-time fluorescent quantitative PCR reaction System

After the PCR reaction system is prepared, an ABI QuantStudio 5 fluorescence detection PCR instrument is used for detection.

The dual real-time fluorescent quantitative PCR reaction conditions are shown in table 4.

TABLE 4 Dual real-time fluorescent quantitative PCR reaction conditions

Step (ii) of	Condition	Number of cycles
			First stage	Denaturation at 95 ℃ for 3min	1
Second stage	Denaturation at 95 ℃ for 20s and annealing at 58 ℃ for 60s	50

The fluorescent signal was collected during the second stage of annealing at 58 ℃.

The detection results of six standard products with the methylated MGMT gene content of 0%, 5%, 10%, 30%, 60% and 100% show that the six standard products have detection signals of the MGMT gene, the fluorescence signals are enhanced along with the increase of the methylated MGMT gene content, and the Ct value of the standard product and the methylated MGMT gene content are in a linear relation, which shows that a standard curve can be drawn through the standard products of the embodiment, and the relative quantification of the MGMT gene methylation degree can be carried out through the Ct value.

Third, clinical sample detection

In this example, the methylation status of MGMT gene was quantitatively determined using the primers and probes shown in Table 1, using paraffin-embedded tumor tissues of 1 patient with brain glioma, as follows:

1. sample DNA extraction

In this example, QIAamp DNA FFPE Tissue Kit was used to extract DNA from paraffin-embedded tumor Tissue samples of patients, and the detailed procedures were described in reference to the Kit instructions.

The concentration of the extracted sample DNA is detected by using the Qubit 2.0, and the result shows that the concentration of the tissue sample DNA extracted in the embodiment is 24.5 ng/. mu. L, which can meet the use requirement of subsequent detection.

2. Methylation conversion

In this example, 50ng of the extracted tissue sample DNA was sampled and 50ng of each of the six standards was sampled and then subjected to Methylation conversion using a Methylation conversion reagent. Systems and conditions for methylation conversion reference kit instructions.

3. Dual real-time fluorescent quantitative PCR detection

The primer pairs and probes in table 1 were used to perform duplex real-time fluorescent quantitative PCR detection on the sample DNA of "2. methylation conversion" and six standards according to the duplex real-time fluorescent quantitative PCR reaction system shown in table 3, and the duplex real-time fluorescent quantitative PCR reaction conditions are shown in table 4.

4. Results and analysis

(1) Drawing of standard curve

The results of the dual real-time fluorescent quantitative PCR detection of the six standards are shown in table 5 and fig. 1.

TABLE 5 Dual real-time fluorescent quantitative PCR detection Ct values for standards

Standard article number	Ct value
		0％	47.2
5％	43.5
		10％	41.3
30％	33.8
		60％	25.1
100％	19.7

In fig. 1, the curves from left to right are standards of the methylated MGMT gene content 100%, 60%, 30%, 10%, 5%, and 0% in order. From the results of table 5 and fig. 1, a standard curve was calculated, resulting in the following formula for the standard curve of this example:

y＝-0.0344x+1.5544。

wherein y is the methylation degree of MGMT gene, and x is the detected Ct value.

(2) Clinical sample detection result and judgment method

According to the detection results of the MGMT gene and the internal control β -Actin gene of the clinical sample DNA and the detection results of the standard substance with the methylated MGMT gene content of 0%, the Ct value effectiveness of the clinical sample is judged, and the details are as follows:

A. the Ct value of the internal control β -Actin gene detection of the sample DNA is more than or equal to 35, which means that the sample input amount is too low and the detection needs to be carried out again;

B. the detection Ct value of MGMT gene of the sample DNA is more than or equal to 45, which represents that the sample is a negative sample, and the methylation degree does not need to be calculated;

C. the detection Ct value of the MGMT gene of the standard substance with the methylated MGMT gene content of 0% is less than 45, which represents that the sample methylation conversion process is abnormal, and the methylation conversion process needs to be carried out again.

D. If the Ct value of the internal control β -Actin gene detection of the sample DNA is less than 30, the Ct value of the MGMT gene detection of the sample DNA is less than 45, and the Ct value of the MGMT gene detection of the standard product with the methylated MGMT gene content of 0% is greater than 45, the detection result is effective.

Specifically, in the present example, the detection results all meet the above indexes, the detection Ct value of the MGMT gene of the clinical sample DNA is 26.6, the detection Ct value of the internal control β -Actin gene of the sample DNA is 28.7, and the detection Ct value of the MGMT gene of the standard product with 0% methylated MGMT gene content is 47.2, where the detection result of the MGMT gene of the clinical sample DNA is shown in fig. 2.

Therefore, the MGMT gene methylation degree of the sample DNA of this example was calculated by substituting the MGMT gene detection Ct value of 26.6 of the clinical sample DNA into the formula of the standard curve.

The degree of methylation of MGMT gene in sample DNA was-0.0344 × 26.6+1.5544 — 63.9%.

The detection result is consistent with the actual situation of a patient with brain glioma, which shows that the primer probe and the detection method of the embodiment can effectively and quantitatively detect the methylation degree of the MGMT gene.

The foregoing is a more detailed description of the present application in connection with specific embodiments thereof, and it is not intended that the present application be limited to the specific embodiments thereof. It will be apparent to those skilled in the art from this disclosure that many more simple derivations or substitutions can be made without departing from the spirit of the disclosure.

SEQUENCE LISTING

<110> Shenzhen Shanpulos Biotech Co., Ltd

<120> kit and method for quantitatively detecting methylation degree of human MGMT gene

<130>19I29483

<160>6

<170>PatentIn version 3.3

<210>1

<211>20

<212>DNA

<213> Artificial sequence

<400>1

cgcgtttcgg atatgttggg 20

<210>2

<211>20

<212>DNA

<213> Artificial sequence

<400>2

atcaaaacga ccccacaccc 20

<210>3

<211>20

<212>DNA

<213> Artificial sequence

<400>3

cgcggtgcgt atcgtttgcg 20

<210>4

<211>20

<212>DNA

<213> Artificial sequence

<400>4

agtgagtggt gtggggttaa 20

<210>5

<211>24

<212>DNA

<213> Artificial sequence

<400>5

ccaaccttac acataccaaa acca 24

<210>6

<211>24

<212>DNA

<213> Artificial sequence

<400>6

tggtttgagt ggttgtggtg gtgt 24

Claims

1. A kit for quantitatively detecting the methylation degree of human MGMT genes is characterized by comprising an MGMT gene detection reagent, an internal control β -Actin gene detection reagent and a standard substance;

the MGMT gene detection reagent comprises an MGMT primer pair and an MGMT probe, wherein the upstream primer and the downstream primer of the MGMT primer pair are respectively a sequence shown by SEQ ID NO.1 and a sequence shown by SEQ ID NO.2, and the MGMT probe is a sequence shown by SEQ ID NO. 3;

the internal control β -Actin gene detection reagent comprises a β -Actin primer pair and a β -Actin probe, wherein the upstream primer and the downstream primer of the β -Actin primer pair are respectively sequences shown as SEQ ID NO.4 and SEQ ID NO.5, and the β -Actin probe is a sequence shown as SEQ ID NO. 6;

SEQ ID NO.1：5’-CGCGTTTCGGATATGTTGGG-3’

SEQ ID NO.2：5’-ATCAAAACGACCCCACACCC-3’

SEQ ID NO.3：5’-CGCGGTGCGTATCGTTTGCG-3’

SEQ ID NO.4：5’-AGTGAGTGGTGTGGGGTTAA-3’

SEQ ID NO.5：5’-CCAACCTTACACATACCAAAACCA-3’

SEQ ID NO.6：5’-TGGTTTGAGTGGTTGTGGTGGTGT-3’

the 5' ends of the MGMT probe and the β -Actin probe are respectively modified by different fluorescent groups;

the standard substance is a series of mixed nucleic acid samples with known methylated MGMT gene content, which are formed by 100 percent of methylated MGMT gene and 0 percent of methylated MGMT gene according to different proportions.

2. The kit of claim 1, wherein: also comprises at least one of a DNA extraction reagent, a methylation conversion reagent and a real-time fluorescence quantitative PCR detection reagent.

3. The kit according to claim 1 or 2, wherein the MGMT probe is modified at the 5 'end by FAM fluorescent group and at the 3' end by NFQ-MGB fluorescent quenching group, and the β -Actin probe is modified at the 5 'end by Hex fluorescent group and at the 3' end by NFQ-MGB fluorescent quenching group.

4. The kit according to claim 1 or 2, characterized in that: the standard includes mixed nucleic acid samples with methylated MGMT gene content of 0%, 5%, 10%, 30%, 60% and 100% in sequence.

5. Use of the kit according to any one of claims 1 to 4 for the preparation of a reagent for the molecular typing detection of glioma.

6. Use of a kit according to any one of claims 1 to 4 in the manufacture of a reagent for screening or research of glioma treating drugs.

7. A method for quantitatively detecting the methylation degree of human MGMT gene is characterized by comprising the steps of converting an extracted DNA sample to be detected by using a methylation conversion reagent, then carrying out double real-time fluorescence quantitative PCR detection on the converted DNA sample to be detected by using the MGMT gene detection reagent in the kit of any one of claims 1 to 4 and the internal control β -Actin gene detection reagent, and judging the methylation degree of the MGMT gene according to the Ct value of the DNA sample to be detected.

8. The method as claimed in claim 7, further comprising performing double real-time fluorescence quantitative PCR detection on the standard substance in the kit of any one of claims 1 to 4 by using the MGMT gene detection reagent and the internal control β -Actin gene detection reagent, drawing a standard curve representing the methylation degree of the MGMT gene according to the detection result of the standard substance, and substituting the Ct value of the DNA sample to be detected into the standard curve to obtain the quantitative result of the methylation degree of the MGMT gene of the DNA sample to be detected.

9. Use of the method according to claim 7 or 8 for molecular typing detection of glioma.

10. Use of the method according to claim 7 or 8 in glioma therapeutic drug screening or research.