CN111440847B - A high-throughput and low-cost molecular identification technology for trace biological samples - Google Patents

Abstract

The invention relates to the field of molecular biology, in particular to a high-throughput and low-cost molecular identification technology for trace biological samples, including high-quality genome extraction and sequence detection and analysis. The invention aims to reduce the cost of high-throughput sequencing for molecular identification of trace biological samples. The above-mentioned high-throughput and low-cost molecular identification technology for trace biological samples has the following steps: 1) sample collection; 2) sample lysis; 3) nucleic acid collection; 4) PCR amplification with labeled primers; 5) PCR product mixing Sequencing and position restoration. The invention does not need to prepare complex protoplasts, has simple sources of receptors, and is suitable for transforming fungi without spores. In addition, the present invention simplifies and improves the existing DNA extraction technology, enabling researchers to use some simple and small equipment in the laboratory to conveniently carry out large-scale high-quality genome extraction; at the same time integrating common PCR and high-throughput sequencing technologies, Combined with computer analysis, low-cost PCR sequence amplification and sequencing analysis can be realized for the above-mentioned extracted DNA.

Description

A high-throughput and low-cost molecular identification technology for trace biological samples

technical field

The invention belongs to the technical field of molecular biology, and relates to a high-throughput and low-cost molecular identification technology of trace biological samples, including high-quality genome extraction and sequence detection and analysis of trace biological samples.

Background technique

Modern molecular biotechnology has gradually entered the era of high-throughput processing in DNA sample extraction, PCR amplification and sequencing, which is very necessary in many research fields, such as studying the diversity of certain biological loci by molecular means When processing a large number of samples (including animal and plant cells and microorganisms), such high-throughput processing usually relies on expensive automated processing machines and kits. For laboratory research with ordinary conditions, if the genome extraction, PCR amplification and sequencing are performed manually one by one with kits according to conventional methods, it is not only time-consuming and laborious, but also often unaffordable in terms of cost. In terms of DNA extraction, it is not difficult to extract high-quality DNA from a single sample using kits, but rapid and low-cost extraction of samples in batches requires method improvement and optimization. In recent years, many researchers have proposed many improvements in DNA extraction methods, but they are often only for one kind of microbial samples, such as only for Gram-negative bacteria, which makes it difficult to extract various samples at the same time. For example, intestinal bacteria include Gram-negative bacteria, which are relatively easy to extract DNA, and Gram-positive bacteria, such as Bifidobacteria, which are difficult to extract DNA; moreover, in order to meet the needs of large-scale extraction, the previous large-scale Most improvements tend to oversimplify the extraction process, seriously reducing the quality of extracted DNA. In terms of sequence detection and analysis, although PCR and classical sequencing methods are very mature and reliable, it is still time-consuming and labor-intensive to sequence thousands of samples, making high-throughput sequencing an astonishing amount of sequencing, but the cost of sequencing each sample It's not cheap either, and it costs a lot to use.

Contents of the invention

In order to solve the above-mentioned technical problems, in order to economically and quickly carry out molecular identification based on high-throughput trace biological samples, the present invention proposes two innovations: the first is to simplify and improve the existing DNA extraction technology, so that research The first is to use some simple and small equipment in the laboratory to conveniently, economically and quickly extract high-quality genomes on a large scale; the second is to integrate ordinary PCR and high-throughput sequencing technologies, combined with computer analysis, to realize low-cost PCR on the above-mentioned extracted DNA. Sequence amplification and sequencing analysis;

The present invention adopts the following technical solutions to realize the above-mentioned first innovation content:

As preferably, the technical solution comprises the following steps:

(1) Treat the samples separately according to their dry and wet states: For relatively dry samples such as microbial colonies, directly pick the samples into a centrifuge tube to proceed to the next step; For the supernatant, wash once with sterile water, then centrifuge at 10000g at 4°C for 1 min, and remove the supernatant; the tube can be a row tube or a 96-well plate;

(2) According to the volume of the tube, add glass beads with a diameter of 0.1mm-0.5mm to 1/8 of the total volume of the tube, then add proteinase K suspension with a concentration of 1mg/ml to 1/8 of the total volume of the tube, 40-70°C After keeping warm for 5-30 minutes, shake horizontally or vertically for 5 minutes at a speed above 1000rpm;

(3) Add 1/4 of the total volume of the chelex solution with a concentration of 10%, break it up, 95°C for 10-20min, and then ice bath;

(4) Centrifuge at 10,000 g at 4°C for 1 min, take the supernatant as a template, and store in a freezer;

The present invention adopts the following technical solutions to realize the above-mentioned second innovation content:

As preferably, the technical solution comprises the following steps:

(1) Design the primer marking sites corresponding to different PCR tubes;

(2) PCR amplification and sample mixing sequencing;

(3) Restore the position of the PCR tube where different primers are located according to the detected primer sequence;

Preferably, the above step (1) includes the following three steps:

根据待扩增基因序列的保守区设计通用的上下游引物，长度20-25个碱基，Tm值在55-60℃，扩增产物长度300-500bp；

Design universal upstream and downstream primers according to the conserved region of the gene sequence to be amplified, with a length of 20-25 bases, a Tm value of 55-60°C, and amplified product length of 300-500bp;

② Introduce 1-2 mismatched bases between the 5' end of the upstream and downstream primers and the middle region of the primers as specific markers, design 24 mismatched combinations for the upstream primers, and design 16 mismatched combinations for the downstream primers, thus forming a 384 different primer combinations can correspond to 384 different PCR tube positions;

③ A 30-35 base adapter is added to the 5' end of the primer to connect to the PCR amplification during the subsequent high-throughput sequencing, so that the length of the primer is increased to about 45 bases, which can further enhance the stability of the amplification;

Preferably, the above step (2) includes the following three steps:

设定PCR反应体系为15μl，分别按比例混合每列和每行所需的PCR反应试剂，包括引物；

Set the PCR reaction system to 15 μl, and mix the PCR reaction reagents required for each column and each row in proportion, including primers;

进行行列的组合，配制每孔的反应体系，包含各不相同引物组合，最后各孔分别加入模板；

Combining rows and columns, preparing a reaction system for each well, including different primer combinations, and finally adding templates to each well;

③ After the PCR reaction, take 1-5 μl of the product from each well and mix it, record it as a sample, and perform Illumina Miseq deep sequencing;

Preferably, the above step (3) includes the following two steps:

① The sequence measured by a sample is identified and classified by the computer software related to the position of the tube hole. When identifying, it is required that 1-2 adjusted bases at the upstream and downstream positions can be selected, so as to eliminate errors to the greatest extent;

② Sorting the sequences measured in each well, the reliability of the sequence with more reads is higher, and the number of sequences with fewer reads can be further verified by classical sequencing methods. The number of sequences is less than the set prediction, such as less than 10 will be regarded as errors and excluded . In this way, the sequence of each well can be restored to the greatest extent;

The invention is divided into a microbe genome extraction part and a PCR sequence amplification and sequence analysis part. The feature of the microbial genome extraction part is: use glass beads to shake, enzymatic hydrolysis of proteinase K, chelating resin and high temperature and other methods suitable for high-throughput operations to play a synergistic role, and achieve a large number of microbial samples in a short period of time. Release high-quality DNA; part of the PCR sequence amplification and sequence analysis technology is characterized by using primer combinations to mark different PCR samples, then using deep sequencing technology to realize one-time sequencing of different samples mixed, and finally using computer technology to sort out the primer marks ; The two parts of the technology described in the present invention can be closely connected to realize the high-throughput and low-cost operation of the whole process, and each part can also be used as a part of other molecular biology identification technologies;

Compared with existing genome extraction technology and PCR sequence analysis technology, the present invention has the following beneficial effects:

(1) Only a small amount of sample can be used for micro-DNA extraction, such as picking colonies from a plate, to avoid the trouble of preparing a large number of strains;

(2) The entire operation can be performed in multiple single tubes, and is more suitable for the operation of high-throughput equipment such as microplates;

(3) It is especially suitable for large-scale strain identification and research on the diversity of specific gene loci in the flora;

(4) The extracted genome is of high quality, ensuring the stability of PCR sequence amplification;

Whether it is genome extraction technology, or PCR sequence amplification and sequence analysis, they all reflect the characteristics of high throughput and low cost.

Description of drawings

Fig. 1 Extraction effect of Gram-positive bacteria Bifidobacterium longum (Bifidobacterium.longum ) in 8 PCR tubes;

Figure 2 PCR amplification effect of intestinal bacteria.

Detailed ways

Example 1 DNA Extraction of Gram-positive Bacteria Bifidobacterium longum

In bacteria, usually, the DNA of Gram-negative bacteria is easier to extract; Gram-positive bacteria have relatively thick peptidoglycan cell walls, so usually a single heating, freezing and thawing and mechanical disruption are not effective; and using Method of the present invention obtains better effect;

1. Cultivate the target strain to an OD value above 1.0;

2. Pipette the bacterial solution into a 200μl 8-tube tube, centrifuge at 10,000g at 4°C for 1min, and remove the supernatant. If the bacterial solution is relatively dilute, it can be repeated 2-3 times; then, add sterile water to wash, and centrifuge to remove the supernatant;

3. Add 25 μl glass beads (diameter 0.3 mm), 25 μl 1 mg/ml proteinase K, mix well, and incubate at 60°C for 10 minutes;

4. Shake at 1200 rpm for 6 minutes in a microplate mixer;

5. Add 50 μl of 10% chelex solution, break it up, heat the lid of the PCR instrument, 95°C, 20min, and cool to 4°C;

6. Centrifuge at 10,000 g for 1 min at 4°C, take the supernatant as a template, and store in a freezer;

7. Take the product and run electrophoresis, and you can see clear bands (see Figure 1);

Example 2 Using commonly used 16s rRNA primers and PCR amplification to identify intestinal flora

The standard 16s rRNA universal primer is 515F in the forward direction: 5'-GTGCCAGCMGCCGCGG-3', and 907R in the reverse direction: 5'-CCGTCAATTCMTTTRAGTTT-3'; now a point mutation crossover combination is used to form a 24×16 primer square array (Table 1), corresponding to 384 sample combinations, carry out specific amplification; the amplification results show that for the primers with different site mutations, the PCR effect is obvious, and the size is near the target band, and the experimental results are reliable (see Figure 2) ;

Table 1. The sequences and numbers of each primer

Primer name adapter (underline) + universal primer (5'-3', mutations are marked in lowercase) number

1B515F1-A CACTCCATACAGCACGCTCTTCCGATCTTCCCGA aTGCCAGCMGCCGCGG D1

1B515F1-B CACTCCATACAGCACGCTCTTCCGATCTTCCCGA tTGCCAGCMGCCGCGG D2

1B515F1-C CACTCCATACAGCACGCTCTTCCGATCTTCCCGA cTGCCAGCMGCCGCGG D3

1B515F1-D CACTCCATACAGCACGCTCTTCCGATCTTCCCGA GaGCCAGCMGCCGCGG D4

1B515F1-E CACTCCATACAGCACGCTCTTCCGATCTTCCCGA GTaCCAGCMGCCGCGG D5

1B515F1-F CACTCCATACAGCACGCTCTTCCGATCTTCCCGA GTtCCAGCMGCCGCGG D6

1B515F1-G CACTCCATACAGCACGCTCTTCCGATCTTCCCGA GTcCCAGCMGCCGCGG D7

1B515F1-H CACTCCATACAGCACGCTCTTCCGATCTTCCCGA GTGaCAGCMGCCGCGG D8

1B515F1-I CACTCCATACAGCACGCTCTTCCGATCTTCCCGA GTGtCAGCMGCCGCGG E1

1B515F1-J CACTCCATACAGCACGCTCTTCCGATCTTCCCGA GTGgCAGCMGCCGCGG E2

1B515F1-K CACTCCATACAGCACGCTCTTCCGATCTTCCCGA GTGCaAGCMGCCGCGG E3

1B515F1-L CACTCCATACAGCACGCTCTTCCGATCTTCCCGA GTGCtAGCMGCCGCGG E4

1B515F1-M CACTCCATACAGCACGCTCTTCCGATCTTCCCGA GTGCgAGCMGCCGCGG E5

1B515F1-N CACTCCATACAGCACGCTCTTCCGATCTTCCCGA GTGCCtGCMGCCGCGG E6

1B515F1-O CACTCCATACAGCACGCTCTTCCGATCTTCCCGA GTGCCAaCMGCCGCGG E7

1B515F1-P CACTCCATACAGCACGCTCTTCCGATCTTCCCGA GTGCCAtCMGCCGCGG E8

1B907R1-1 CATCATATACAGCACGCTACCTTGATCTTCCCGA aCGTCAATTCMTTTRAGTT A1

1B907R1-2 CATCATATACAGCACGCTACCTTGATCTTCCCGA tCGTCAATTCMTTRAGTT A2

1B907R1-3 CATCATATACAGCACGCTACCTTGATCTTCCCGA gCGTCAATTCMTTTRAGTT A3

1B907R1-4 CATCATATACAGCACGCTACCTTGATCTTCCCGA CaGTCAATTCMTTRAGTT A4

1B907R1-5 CATCATATACAGCACGCTACCTTGATCTTCCCGA CtGTCAATTCMTTRAGTT A5

1B907R1-6 CATCATATACAGCACGCTACCTTGATCTTCCCGA CgGTCAATTCMTTRAGTT A6

1B907R1-7 CATCATATACAGCACGCTACCTTGATCTTCCCGA CCaTCAATTCMTTTRAGTT A7

1B907R1-8 CATCATATACAGCACGCTACCTTGATCTTCCCGA CCtTCAATTCMTTTRAGTT A8

1B907R1-9 CATCATATACAGCACGCTACCTTGATCTTCCCGA CCGaCAATTCMTTTRAGTT A9

1B907R1-10 CATCATATACAGCACGCTACCTTGATCTTCCCGA CCGcCAATTCMTTTRAGTT A10

1B907R1-11 CATCATATACAGCACGCTACCTTGATCTTCCCGA CCGgCAATTCMTTTRAGTT A11

1B907R1-12 CATCATATACAGCACGCTACCTTGATCTTCCCGA CCGTaAATTCMTTTRAGTT A12

1B907R1-13 CATCATATACAGCACGCTACCTTGATCTTCCCGA CCGTtAATTCMTTTRAGTTT B1

1B907R1-14 CATCATATACAGCACGCTACCTTGATCTTCCCGA CCGTgAATTCMTTTRAGTTT B2

1B907R1-15 CATCATATACAGCACGCTACCTTGATCTTCCCGA CCGTCtATTCMTTTRAGTT B3

1B907R1-16 CATCATATACAGCACGCTACCTTGATCTTCCCGA CCGTCcATTCMTTTRAGTT B4

1B907R1-17 CATCATATACAGCACGCTACCTTGATCTTCCCGA CCGTCgATTCMTTTRAGTT B5

1B907R1-18 CATCATATACAGCACGCTACCTTGATCTTCCCGA CCGTCAtTTCMTTTRAGTTT B6

1B907R1-19 CATCATATACAGCACGCTACCTTGATCTTCCCGA CCGTCAcTTCMTTTRAGTT B7

1B907R1-20 CATCATATACAGCACGCTACCTTGATCTTCCCGA CCGTCAgTTCMTTTRAGTTT B8

1B907R1-21 CATCATATACAGCACGCTACCTTGATCTTCCCGA CCGTCAAcTCMTTTRAGTT B9

1B907R1-22 CATCATATACAGCACGCTACCTTGATCTTCCCGA CCGTCAAgTCMTTTRAGTTT B10

1B907R1-23 CATCATATACAGCACGCTACCTTGATCTTCCCGA CCGTCAATaCMTTTRAGTTT B11

1B907R1-24 CATCATATACAGCACGCTACCTTGATCTTCCCGA CCGTCAATcCMTTTRAGTTT B12

Note: The underlined linker sequence depends on the primers used for high-throughput sequencing, here is just an example;

Preparation of PCR reaction solution:

The mix uses Qingke 2×TSINGKE Master Mix, the primers are biosynthesized, the page is purified, and the water is self-provided sterile water; the reaction solution is mixed in a 96 deep-well plate;

Forward primers (24): water 0.6×24×3.3=48, mix 3.8×24×3.3=301, each primer 0.6×24×3.3=48

Reverse primers (16): water 0.6×16×3.3=32, mix 3.8×16×3.2=201, each primer 0.6×16×3.2=32

Note: This amount has been increased by 10%, which is enough for 3×4×96 holes

Primers correspond to templates:

Add samples with a thermo12-channel (5-50 μl) pipette, and use four 96-well plates to form a 384-well sample, corresponding to 24×16 primer combinations. Add 5 μl of template;

PCR program: 94°C for 5 min; 95°C for 10s, 56°C for 50s, 72°C for 100s, a total of 35 rounds; 72°C for 5min; 4°C for 30min;

Electrophoresis detection conditions

name description

gel TAE 90ml, 25comb

Agarose (1%) Biowest 0.3g

dye EB (10mg/ml) 2μl

buffer TAE, 45ML

device DYY-8c

Voltage(V) 120

Current(mA) 150

Time(min) 25

Loading Product 5μl

marker DL 2000 marker

Example 3 Sequence tag recognition and reduction to each tube

Use python software to design the sorting program:

Program flow: assign all sequenced sequence marker sites to corresponding PCR reaction wells >> select 20-30 sequences from each well and integrate them into a single fasta file >> perform stand-alone BLAST sequence comparison >> perform results in excel Classification and Sorting >> Output homologous comparison results to excel; the execution effect is shown in the following table:

The first column in the table is the hole position, the second column is the maximum 20 sequences randomly taken out, the third column is the largest possible strain, and the fourth column is the sequence of the strain;

Cell_position Total_count 1Species 1Hit

515F1-D-907R1-9 20 Veillonella dispar 8

515F1-E-907R1-9 20 Veillonella dispar 7

515F1-H-907R1-11 20 Veillonella dispar 4

515F1-I-907R1-6 20 Veillonella dispar 5

515F1-I-907R1-7 20 Veillonella dispar 7

515F1-J-907R1-8 20 Veillonella dispar 7

515F1-K-907R1-10 20 Veillonella dispar 11

515F1-K-907R1-11 20 Veillonella dispar 8

515F1-K-907R1-12 20 Veillonella dispar 9

515F1-K-907R1-7 20 Veillonella dispar 7

515F1-L-907R1-12 20 Veillonella dispar 8

515F1-L-907R1-9 20 Veillonella dispar 13

515F1-N-907R1-13 5 Veillonella dispar 1

515F1-P-907R1-18 5 Veillonella dispar 1

515F1-O-907R1-11 20 Sphingomonas koreansis 2

515F1-E-907R1-2 20 Microbacterium maritypicum 6

515F1-G-907R1-24 13 Microbacterium maritypicum 4

515F1-A-907R1-1 20 Escherichia fergusonii 16

515F1-A-907R1-10 20 Escherichia fergusonii 17

515F1-A-907R1-11 20 Escherichia fergusonii 15

515F1-A-907R1-12 20 Escherichia fergusonii 15

515F1-A-907R1-13 20 Escherichia fergusonii 19

515F1-A-907R1-14 20 Escherichia fergusonii 14

515F1-A-907R1-15 20 Escherichia fergusonii 13

515F1-A-907R1-16 20 Escherichia fergusonii 10

515F1-A-907R1-17 20 Escherichia fergusonii 10

515F1-A-907R1-18 20 Escherichia fergusonii 15

515F1-A-907R1-19 20 Escherichia fergusonii 13

515F1-A-907R1-20 20 Escherichia fergusonii 14

515F1-A-907R1-22 20 Escherichia fergusonii 13

515F1-A-907R1-23 20 Escherichia fergusonii 12

515F1-A-907R1-3 20 Escherichia fergusonii 17

515F1-A-907R1-4 8 Escherichia fergusonii 6

515F1-A-907R1-5 20 Escherichia fergusonii 14

515F1-A-907R1-6 20 Escherichia fergusonii 12

515F1-A-907R1-7 16 Escherichia fergusonii 7

515F1-A-907R1-8 20 Escherichia fergusonii 12

515F1-A-907R1-9 20 Escherichia fergusonii 13

515F1-B-907R1-1 20 Escherichia fergusonii 12

515F1-B-907R1-10 20 Escherichia fergusonii 11

515F1-B-907R1-11 20 Escherichia fergusonii 14

515F1-B-907R1-12 20 Escherichia fergusonii 13

515F1-B-907R1-13 20 Escherichia fergusonii 14

515F1-B-907R1-14 20 Escherichia fergusonii 14

515F1-B-907R1-18 20 Escherichia fergusonii 9

515F1-B-907R1-19 20 Escherichia fergusonii 10

515F1-B-907R1-2 20 Escherichia fergusonii 6

515F1-B-907R1-20 20 Escherichia fergusonii 14

515F1-B-907R1-22 20 Escherichia fergusonii 12

515F1-B-907R1-23 20 Escherichia fergusonii 10

515F1-B-907R1-24 20 Escherichia fergusonii 16

515F1-B-907R1-3 20 Escherichia fergusonii 10

515F1-B-907R1-4 20 Escherichia fergusonii 14

515F1-B-907R1-5 20 Escherichia fergusonii 9

515F1-B-907R1-6 20 Escherichia fergusonii 12

515F1-B-907R1-7 20 Escherichia fergusonii 10

515F1-B-907R1-8 20 Escherichia fergusonii 8

515F1-B-907R1-9 20 Escherichia fergusonii 9

515F1-C-907R1-1 20 Escherichia fergusonii 15

515F1-C-907R1-10 20 Escherichia fergusonii 13

515F1-C-907R1-11 20 Escherichia fergusonii 15

515F1-C-907R1-13 20 Escherichia fergusonii 8

515F1-C-907R1-15 20 Escherichia fergusonii 12

515F1-C-907R1-16 20 Escherichia fergusonii 9

515F1-C-907R1-17 20 Escherichia fergusonii 10

515F1-C-907R1-18 20 Escherichia fergusonii 11

515F1-C-907R1-2 20 Escherichia fergusonii 15

515F1-C-907R1-22 20 Escherichia fergusonii 10

515F1-C-907R1-24 20 Escherichia fergusonii 10

515F1-C-907R1-3 20 Escherichia fergusonii 15

515F1-C-907R1-4 10 Escherichia fergusonii 6

515F1-C-907R1-5 15 Escherichia fergusonii 7

515F1-C-907R1-6 20 Escherichia fergusonii 9

515F1-C-907R1-7 20 Escherichia fergusonii 17

515F1-C-907R1-8 20 Escherichia fergusonii 15

515F1-C-907R1-9 20 Escherichia fergusonii 10

515F1-D-907R1-1 20 Escherichia fergusonii 13

515F1-D-907R1-10 20 Escherichia fergusonii 6

515F1-D-907R1-11 20 Escherichia fergusonii 13

515F1-D-907R1-12 20 Escherichia fergusonii 17

515F1-D-907R1-13 20 Escherichia fergusonii 12

515F1-D-907R1-14 20 Escherichia fergusonii 9

515F1-D-907R1-18 20 Escherichia fergusonii 11

515F1-D-907R1-2 20 Escherichia fergusonii 15

515F1-D-907R1-20 20 Escherichia fergusonii 16

515F1-D-907R1-22 20 Escherichia fergusonii 12

515F1-D-907R1-23 20 Escherichia fergusonii 12

515F1-D-907R1-24 20 Escherichia fergusonii 10

515F1-D-907R1-3 20 Escherichia fergusonii 12

515F1-D-907R1-4 16 Escherichia fergusonii 10

515F1-D-907R1-5 20 Escherichia fergusonii 7

515F1-D-907R1-6 20 Escherichia fergusonii 8

515F1-D-907R1-7 20 Escherichia fergusonii 9

515F1-D-907R1-8 20 Escherichia fergusonii 7

515F1-E-907R1-1 20 Escherichia fergusonii 12

515F1-E-907R1-10 20 Escherichia fergusonii 12

515F1-E-907R1-11 20 Escherichia fergusonii 11

515F1-E-907R1-12 20 Escherichia fergusonii 13

515F1-E-907R1-13 20 Escherichia fergusonii 9

515F1-E-907R1-14 20 Escherichia fergusonii 13

515F1-E-907R1-15 20 Escherichia fergusonii 10

515F1-E-907R1-16 20 Escherichia fergusonii 7

515F1-E-907R1-17 20 Escherichia fergusonii 10

515F1-E-907R1-23 20 Escherichia fergusonii 10

515F1-E-907R1-24 20 Escherichia fergusonii 10

515F1-E-907R1-3 20 Escherichia fergusonii 11

515F1-E-907R1-4 20 Escherichia fergusonii 14

515F1-E-907R1-5 20 Escherichia fergusonii 7

515F1-E-907R1-6 20 Escherichia fergusonii 10

515F1-E-907R1-7 20 Escherichia fergusonii 7

515F1-E-907R1-8 20 Escherichia fergusonii 10

515F1-F-907R1-1 20 Escherichia fergusonii 11

515F1-F-907R1-10 20 Escherichia fergusonii 12

515F1-F-907R1-11 20 Escherichia fergusonii 13

515F1-F-907R1-12 20 Escherichia fergusonii 13

515F1-F-907R1-13 20 Escherichia fergusonii 10

515F1-F-907R1-16 20 Escherichia fergusonii 8

515F1-F-907R1-17 20 Escherichia fergusonii 12

515F1-F-907R1-19 20 Escherichia fergusonii 6

515F1-F-907R1-2 20 Escherichia fergusonii 11

515F1-F-907R1-20 20 Escherichia fergusonii 12

515F1-F-907R1-23 20 Escherichia fergusonii 11

515F1-F-907R1-24 20 Escherichia fergusonii 12

515F1-F-907R1-3 20 Escherichia fergusonii 15

515F1-F-907R1-4 18 Escherichia fergusonii 8

515F1-F-907R1-5 20 Escherichia fergusonii 9

515F1-F-907R1-6 20 Escherichia fergusonii 10

515F1-F-907R1-7 20 Escherichia fergusonii 12

515F1-F-907R1-8 20 Escherichia fergusonii 10

515F1-F-907R1-9 20 Escherichia fergusonii 12

515F1-G-907R1-1 20 Escherichia fergusonii 14

515F1-G-907R1-10 20 Escherichia fergusonii 13

515F1-G-907R1-11 20 Escherichia fergusonii 12

515F1-G-907R1-12 20 Escherichia fergusonii 11

515F1-G-907R1-13 20 Escherichia fergusonii 14

515F1-G-907R1-14 20 Escherichia fergusonii 11

515F1-G-907R1-19 20 Escherichia fergusonii 5

515F1-G-907R1-2 20 Escherichia fergusonii 9

515F1-G-907R1-20 20 Escherichia fergusonii 11

515F1-G-907R1-3 20 Escherichia fergusonii 13

515F1-G-907R1-4 20 Escherichia fergusonii 13

515F1-G-907R1-5 20 Escherichia fergusonii 14

515F1-G-907R1-6 20 Escherichia fergusonii 12

515F1-G-907R1-7 20 Escherichia fergusonii 10

515F1-G-907R1-8 20 Escherichia fergusonii 13

515F1-G-907R1-9 20 Escherichia fergusonii 14

515F1-H-907R1-1 20 Escherichia fergusonii 13

515F1-H-907R1-10 10 Escherichia fergusonii 3

515F1-H-907R1-13 20 Escherichia fergusonii 13

515F1-H-907R1-16 20 Escherichia fergusonii 10

515F1-H-907R1-18 20 Escherichia fergusonii 12

515F1-H-907R1-19 20 Escherichia fergusonii 12

515F1-H-907R1-2 20 Escherichia fergusonii 13

515F1-H-907R1-20 20 Escherichia fergusonii 12

515F1-H-907R1-23 10 Escherichia fergusonii 6

515F1-H-907R1-24 15 Escherichia fergusonii 6

515F1-H-907R1-3 20 Escherichia fergusonii 10

515F1-H-907R1-4 20 Escherichia fergusonii 12

515F1-H-907R1-5 20 Escherichia fergusonii 12

515F1-H-907R1-6 20 Escherichia fergusonii 7

515F1-H-907R1-7 20 Escherichia fergusonii 8

515F1-H-907R1-8 20 Escherichia fergusonii 5

515F1-H-907R1-9 18 Escherichia fergusonii 8

515F1-I-907R1-1 20 Escherichia fergusonii 10

515F1-I-907R1-10 20 Escherichia fergusonii 13

515F1-I-907R1-11 20 Escherichia fergusonii 12

515F1-I-907R1-12 20 Escherichia fergusonii 8

515F1-I-907R1-13 6 Escherichia fergusonii 4

515F1-I-907R1-15 7 Escherichia fergusonii 3

515F1-I-907R1-19 9 Escherichia fergusonii 3

515F1-I-907R1-2 20 Escherichia fergusonii 14

515F1-I-907R1-21 4 Escherichia fergusonii 2

515F1-I-907R1-22 9 Escherichia fergusonii 3

515F1-I-907R1-23 6 Escherichia fergusonii 3

515F1-I-907R1-24 5 Escherichia fergusonii 2

515F1-I-907R1-3 20 Escherichia fergusonii 12

515F1-I-907R1-4 20 Escherichia fergusonii 11

515F1-I-907R1-5 20 Escherichia fergusonii 9

515F1-I-907R1-8 20 Escherichia fergusonii 9

515F1-I-907R1-9 20 Escherichia fergusonii 7

515F1-J-907R1-1 20 Escherichia fergusonii 13

515F1-J-907R1-10 3 Escherichia fergusonii 2

515F1-J-907R1-11 20 Escherichia fergusonii 13

515F1-J-907R1-12 20 Escherichia fergusonii 13

515F1-J-907R1-13 7 Escherichia fergusonii 5

515F1-J-907R1-14 5 Escherichia fergusonii 3

515F1-J-907R1-15 7 Escherichia fergusonii 4

515F1-J-907R1-16 8 Escherichia fergusonii 2

515F1-J-907R1-17 20 Escherichia fergusonii 15

515F1-J-907R1-18 6 Escherichia fergusonii 3

515F1-J-907R1-2 20 Escherichia fergusonii 14

515F1-J-907R1-20 20 Escherichia fergusonii 12

515F1-J-907R1-21 9 Escherichia fergusonii 5

515F1-J-907R1-22 9 Escherichia fergusonii 5

515F1-J-907R1-23 3 Escherichia fergusonii 2

515F1-J-907R1-24 6 Escherichia fergusonii 4

515F1-J-907R1-3 20 Escherichia fergusonii 6

515F1-J-907R1-4 20 Escherichia fergusonii 11

515F1-J-907R1-5 20 Escherichia fergusonii 12

515F1-J-907R1-6 20 Escherichia fergusonii 13

515F1-J-907R1-7 20 Escherichia fergusonii 12

515F1-J-907R1-9 13 Escherichia fergusonii 5

515F1-K-907R1-1 20 Escherichia fergusonii 15

515F1-K-907R1-13 12 Escherichia fergusonii 7

515F1-K-907R1-14 20 Escherichia fergusonii 13

515F1-K-907R1-17 20 Escherichia fergusonii 11

515F1-K-907R1-2 20 Escherichia fergusonii 11

515F1-K-907R1-21 20 Escherichia fergusonii 12

515F1-K-907R1-23 20 Escherichia fergusonii 14

515F1-K-907R1-3 20 Escherichia fergusonii 13

515F1-K-907R1-4 20 Escherichia fergusonii 12

515F1-K-907R1-5 20 Escherichia fergusonii 14

515F1-K-907R1-6 20 Escherichia fergusonii 13

515F1-K-907R1-8 20 Escherichia fergusonii 9

515F1-K-907R1-9 20 Escherichia fergusonii 7

515F1-L-907R1-1 20 Escherichia fergusonii 10

515F1-L-907R1-10 20 Escherichia fergusonii 13

515F1-L-907R1-11 20 Escherichia fergusonii 14

515F1-L-907R1-13 11 Escherichia fergusonii 5

515F1-L-907R1-14 20 Escherichia fergusonii 11

515F1-L-907R1-17 20 Escherichia fergusonii 8

515F1-L-907R1-18 20 Escherichia fergusonii 15

515F1-L-907R1-2 20 Escherichia fergusonii 17

515F1-L-907R1-20 20 Escherichia fergusonii 12

515F1-L-907R1-21 20 Escherichia fergusonii 10

515F1-L-907R1-22 20 Escherichia fergusonii 9

515F1-L-907R1-23 20 Escherichia fergusonii 15

515F1-L-907R1-24 9 Escherichia fergusonii 6

515F1-L-907R1-3 20 Escherichia fergusonii 15

515F1-L-907R1-4 20 Escherichia fergusonii 12

515F1-L-907R1-5 20 Escherichia fergusonii 7

515F1-L-907R1-6 20 Escherichia fergusonii 7

515F1-L-907R1-7 20 Escherichia fergusonii 13

515F1-L-907R1-8 20 Escherichia fergusonii 11

515F1-M-907R1-1 20 Escherichia fergusonii 8

515F1-M-907R1-10 20 Escherichia fergusonii 7

515F1-M-907R1-11 20 Escherichia fergusonii 13

515F1-M-907R1-12 20 Escherichia fergusonii 9

515F1-M-907R1-13 14 Escherichia fergusonii 7

515F1-M-907R1-15 20 Escherichia fergusonii 11

515F1-M-907R1-19 20 Escherichia fergusonii 10

515F1-M-907R1-2 20 Escherichia fergusonii 10

515F1-M-907R1-20 20 Escherichia fergusonii 6

515F1-M-907R1-22 20 Escherichia fergusonii 13

515F1-M-907R1-23 12 Escherichia fergusonii 7

515F1-M-907R1-24 10 Escherichia fergusonii 4

515F1-M-907R1-3 20 Escherichia fergusonii 13

515F1-M-907R1-4 20 Escherichia fergusonii 14

515F1-M-907R1-5 20 Escherichia fergusonii 6

515F1-M-907R1-6 20 Escherichia fergusonii 8

515F1-M-907R1-7 20 Escherichia fergusonii 13

515F1-M-907R1-8 20 Escherichia fergusonii 8

515F1-M-907R1-9 20 Escherichia fergusonii 9

515F1-N-907R1-1 13 Escherichia fergusonii 5

515F1-N-907R1-10 20 Escherichia fergusonii 10

515F1-N-907R1-11 20 Escherichia fergusonii 14

515F1-N-907R1-12 20 Escherichia fergusonii 10

515F1-N-907R1-15 11 Escherichia fergusonii 4

515F1-N-907R1-17 9 Escherichia fergusonii 4

515F1-N-907R1-18 9 Escherichia fergusonii 5

515F1-N-907R1-2 5 Escherichia fergusonii 2

515F1-N-907R1-20 9 Escherichia fergusonii 5

515F1-N-907R1-21 7 Escherichia fergusonii 4

515F1-N-907R1-22 10 Escherichia fergusonii 4

515F1-N-907R1-23 5 Escherichia fergusonii 3

515F1-N-907R1-24 5 Escherichia fergusonii 4

515F1-N-907R1-3 20 Escherichia fergusonii 13

515F1-N-907R1-4 20 Escherichia fergusonii 9

515F1-N-907R1-5 20 Escherichia fergusonii 16

515F1-N-907R1-6 20 Escherichia fergusonii 11

515F1-N-907R1-7 20 Escherichia fergusonii 8

515F1-N-907R1-8 20 Escherichia fergusonii 13

515F1-N-907R1-9 20 Escherichia fergusonii 7

515F1-O-907R1-1 18 Escherichia fergusonii 13

515F1-O-907R1-10 20 Escherichia fergusonii 5

515F1-O-907R1-2 20 Escherichia fergusonii 12

515F1-O-907R1-22 20 Escherichia fergusonii 10

515F1-O-907R1-3 20 Escherichia fergusonii 14

515F1-O-907R1-4 20 Escherichia fergusonii 12

515F1-O-907R1-5 20 Escherichia fergusonii 12

515F1-O-907R1-6 20 Escherichia fergusonii 11

515F1-O-907R1-7 20 Escherichia fergusonii 8

515F1-O-907R1-8 20 Escherichia fergusonii 10

515F1-O-907R1-9 20 Escherichia fergusonii 9

515F1-P-907R1-1 10 Escherichia fergusonii 4

515F1-P-907R1-10 20 Escherichia fergusonii 11

515F1-P-907R1-12 11 Escherichia fergusonii 2

515F1-P-907R1-13 6 Escherichia fergusonii 3

515F1-P-907R1-14 8 Escherichia fergusonii 3

515F1-P-907R1-17 20 Escherichia fergusonii 11

515F1-P-907R1-19 8 Escherichia fergusonii 3

515F1-P-907R1-20 8 Escherichia fergusonii 5

515F1-P-907R1-21 5 Escherichia fergusonii 4

515F1-P-907R1-22 5 Escherichia fergusonii 2

515F1-P-907R1-23 4 Escherichia fergusonii 3

515F1-P-907R1-24 3 Escherichia fergusonii 2

515F1-P-907R1-3 20 Escherichia fergusonii 13

515F1-P-907R1-4 20 Escherichia fergusonii 10

515F1-P-907R1-5 20 Escherichia fergusonii 10

515F1-P-907R1-6 20 Escherichia fergusonii 10

515F1-P-907R1-7 20 Escherichia fergusonii 7

515F1-P-907R1-8 20 Escherichia fergusonii 10

515F1-P-907R1-9 20 Escherichia fergusonii 8

515F1-A-907R1-21 20 Enterococcus hirae 11

515F1-B-907R1-15 20 Enterococcus hirae 10

515F1-B-907R1-16 20 Enterococcus hirae 9

515F1-B-907R1-17 20 Enterococcus hirae 7

515F1-B-907R1-21 20 Enterococcus hirae 10

515F1-C-907R1-12 20 Enterococcus hirae 5

515F1-C-907R1-14 20 Enterococcus hirae 9

515F1-C-907R1-19 20 Enterococcus hirae 10

515F1-C-907R1-20 20 Enterococcus hirae 11

515F1-C-907R1-21 20 Enterococcus hirae 10

515F1-C-907R1-23 20 Enterococcus hirae 11

515F1-D-907R1-16 20 Enterococcus hirae 14

515F1-D-907R1-17 20 Enterococcus hirae 11

515F1-D-907R1-19 20 Enterococcus hirae 10

515F1-D-907R1-21 20 Enterococcus hirae 9

515F1-E-907R1-18 20 Enterococcus hirae 8

515F1-E-907R1-19 20 Enterococcus hirae 9

515F1-E-907R1-20 20 Enterococcus hirae 12

515F1-E-907R1-21 20 Enterococcus hirae 13

515F1-E-907R1-22 20 Enterococcus hirae 10

515F1-F-907R1-14 20 Enterococcus hirae 10

515F1-F-907R1-15 20 Enterococcus hirae 9

515F1-F-907R1-18 20 Enterococcus hirae 10

515F1-F-907R1-21 20 Enterococcus hirae 13

515F1-F-907R1-22 20 Enterococcus hirae 9

515F1-G-907R1-15 20 Enterococcus hirae 12

515F1-G-907R1-16 20 Enterococcus hirae 9

515F1-G-907R1-17 20 Enterococcus hirae 8

515F1-G-907R1-18 20 Enterococcus hirae 9

515F1-G-907R1-21 20 Enterococcus hirae 11

515F1-G-907R1-22 20 Enterococcus hirae 11

515F1-G-907R1-23 5 Enterococcus hirae 2

515F1-H-907R1-12 17 Enterococcus hirae 5

515F1-H-907R1-14 20 Enterococcus hirae 14

515F1-H-907R1-15 20 Enterococcus hirae 12

515F1-H-907R1-17 20 Enterococcus hirae 10

515F1-H-907R1-21 20 Enterococcus hirae 11

515F1-H-907R1-22 20 Enterococcus hirae 9

515F1-I-907R1-14 2 Enterococcus hirae 1

515F1-I-907R1-17 10 Enterococcus hirae 5

515F1-I-907R1-18 3 Enterococcus hirae 1

515F1-I-907R1-20 6 Enterococcus hirae 2

515F1-J-907R1-19 5 Enterococcus hirae 2

515F1-K-907R1-15 20 Enterococcus hirae 14

515F1-K-907R1-22 20 Enterococcus hirae 10

515F1-K-907R1-24 5 Enterococcus hirae 2

515F1-L-907R1-15 20 Enterococcus hirae 20

515F1-L-907R1-16 20 Enterococcus hirae 17

515F1-L-907R1-19 20 Enterococcus hirae 13

515F1-M-907R1-14 17 Enterococcus hirae 6

515F1-M-907R1-16 20 Enterococcus hirae 12

515F1-M-907R1-17 20 Enterococcus hirae 16

515F1-M-907R1-18 20 Enterococcus hirae 18

515F1-M-907R1-21 20 Enterococcus hirae 13

515F1-N-907R1-14 3 Enterococcus hirae 1

515F1-N-907R1-16 10 Enterococcus hirae 2

515F1-N-907R1-19 5 Enterococcus hirae 2

515F1-O-907R1-13 5 Enterococcus hirae 2

515F1-O-907R1-14 5 Enterococcus hirae 3

515F1-O-907R1-15 20 Enterococcus hirae 8

515F1-O-907R1-19 20 Enterococcus hirae 12

515F1-O-907R1-20 20 Enterococcus hirae 14

515F1-O-907R1-23 6 Enterococcus hirae 3

515F1-O-907R1-24 4 Enterococcus hirae 1

515F1-P-907R1-16 20 Enterococcus hirae 16

515F1-A-907R1-24 20 Enterococcus gallinarum 13

515F1-D-907R1-15 20 Enterococcus gallinarum 11

515F1-K-907R1-18 20 Enterococcus gallinarum 10

515F1-K-907R1-19 20 Enterococcus gallinarum 14

515F1-K-907R1-20 20 Enterococcus gallinarum 12

515F1-O-907R1-17 20 Enterococcus gallinarum 9

515F1-O-907R1-18 20 Enterococcus gallinarum 10

515F1-O-907R1-21 20 Enterococcus gallinarum 14

515F1-P-907R1-15 20 Enterococcus gallinarum 11

515F1-O-907R1-16 20 Clostridium paraputrificum 4

515F1-A-907R1-2 20 Clostridium butyricum 14

515F1-O-907R1-12 9 Clostridium butyricum 3

515F1-P-907R1-2 20 Clostridium butyricum 14

515F1-P-907R1-11 20 Acinetobacter johnsonii 6

515F1-K-907R1-16 20 [Clostridium] innocuum 10

515F1-I-907R1-16 2 [Clostridium] boltae 1

Claims (4)

1. A high-throughput and low-cost trace biological sample molecular identification technology is characterized in that the technology comprises the following steps: (1) Sample collection: collect trace microbial samples in small centrifuge tubes, and remove the liquid part by short-time high-speed centrifugation for samples containing liquid; (2) Sample lysis: add glass beads with a diameter of 0.1mm-0.5mm to 1/8 of the total volume of the tube, add proteinase K suspension at a concentration of 1 mg/ml to 1/8 of the total volume of the tube, and incubate at 40-70°C for 5-30 Minutes later, immediately shake horizontally or vertically at a speed above 1000rpm; (3) Nucleic acid collection: add 5-10% concentration of 1/4 total tube volume of chelex solution, incubate at 80-95°C for 10-30 minutes, freeze and centrifuge at high speed for a short time, and take the supernatant and store it in a freezer; (4) PCR amplification with labeled primers: ① Design universal upstream and downstream primers according to the conserved region of the gene sequence to be amplified; ②Introduce 1-2 mismatched bases between the 5' end of the upstream and downstream primers and the middle region of the primers as specific markers, design 24 mismatched combinations for the upstream primers, and design 16 mismatched combinations for the downstream primers, thus forming a 384 different primer combinations can correspond to 384 different PCR tube positions; ③A 30-35 base linker is added to the 5' end of the primer to connect to the subsequent PCR amplification during high-throughput sequencing, and further enhance the stability of the amplification; ④ Amplify each sample using primers with different marker sites; (5) Mixed sequencing of PCR products and position restoration: After mixing the PCR products of each tube, high-throughput sequencing is performed, and each sequence is restored to each position of the sample tube according to the difference in the combination of primers and labels in each tube. 2. The high-throughput and low-cost molecular identification technology for trace biological samples according to claim 1, characterized in that: the trace biological samples here generally refer to various biological samples that are convenient for micropipette operation. 3. The high-throughput and low-cost molecular identification technology for trace biological samples according to claim 1, characterized in that: the extraction container can be in a plurality of single-tube operations, 12-tube strips, 96-well plates or 384-well plate devices Simultaneous operation to achieve high throughput and low cost. 4. The high-throughput and low-cost molecular identification technology for trace biological samples according to claim 1, characterized in that the specific content of step (5) includes: ① After amplification, take 1-5 μl of the product from each tube for mixing, and then use it as a sample for high-throughput sequencing; ② For the hundreds of thousands of sequences obtained by sequencing, use computer software to identify their marker sites, and redistribute the sequences to each sample tube.

Images