CN111440819B - Application of multiple gene knockout mutant in dry rice breeding - Google Patents

Abstract

The invention discloses an application of a multi-gene knockout mutant in early rice breeding, wherein the 4 th exon of a gene GW2 of the multi-gene knockout mutant is positioned in 2087 th base A deletion of a genome, and the base sequence is shown as SEQ ID NO.1; meanwhile, the 1 st exon of the gene SD1 of the multi-gene knockout mutant is inserted with a base A between 359 th and 360 th positions of a genome, 384bp between 377 th and 760 th positions of the genome is replaced by A, and the base sequence is shown as SEQ ID NO.2. The invention successfully obtains the polygene mutant by CRISPR/Cas9 polygene technology, and compared with wild early rice, the polygene mutant has the advantages of increased spike number and thousand grain weight, reduced plant height, obviously improved early rice yield, lodging resistance and great application value in early rice breeding.

Description

Application of multiple gene knockout mutant in dry rice breeding

Technical Field

The invention relates to the field of transgenic upland rice, in particular to application of a multigene knockout mutant in upland rice breeding.

Background

Rice is the first large grain crop in China and accounts for about 40% of the total yield of grains. However, the water demand of paddy rice is large, and the paddy rice accounts for about 70% of the agricultural water. The water resources are distributed unevenly in the regions of China, water shortage is frequent in the northwest regions for a long time, drought is frequent in the North China, the mountainous regions with high and low cold concentration in the southwest regions of Yunnan and the mountain regions with complex topography and topography are unbalanced in the season, the drought also frequently occurs in the Yangtze river basin and the south China rice region, and once drought occurs, the yield of rice is often greatly reduced. With the rapid growth of industrial and urban water and other agricultural water, the irrigation of paddy rice is more and more difficult to ensure, the contradiction between drought water shortage and paddy rice water supply and demand is more and more serious, and the development of water-saving agriculture is urgent.

The drought-resistant rice (land rice) has stronger water-saving and drought-resistant performances than rice varieties, and the planting management mode is similar to that of wheat, and the water consumption is only 1/5-1/3 of that of rice. In addition, the upland rice also has the characteristics of barren resistance, wide adaptability and the like. However, dry rice yields are generally lower and of poorer quality than rice. Therefore, the cultivation of new varieties of high-quality high-yield upland rice can change the cultivation and cultivation modes of traditional upland rice production and save fresh water resources by developing the upland rice upland production, and is a new revolution for realizing sustainable production of paddy rice.

The new variety of upland rice, 46, 8 months and 18 days in 2017, bred by the grain institute of agricultural science, yunnan province, is approved by the developing part of the rural area. The land-induced 46-line indica type upland rice is a main cultivated variety of the upland rice in Yunnan province. The variety is compact in plant type, strong in tillering power, strong in weed competitiveness, suitable for rice blast resistance, moderate in growth period and medium in rice quality, and has no obvious yield advantage, so that the invention aims to improve the yield of upland rice by means of gene editing.

Disclosure of Invention

The invention provides an application of a polygene knockout mutant in dry rice breeding, which utilizes a CRISPR/cas9 polygene knockout method to simultaneously perform gene knockout on a plurality of key genes with limited yield in the dry rice, thereby obtaining the polygene knockout mutant for improving the yield of the dry rice.

In order to solve the technical problems, the technical scheme of the invention is as follows: an application of a multi-gene knockout mutant in dry rice breeding, wherein the gene GW2 exon4 of the multi-gene knockout mutant is deleted in the 2087 th base A of the genome, and the base sequence is shown as SEQ ID NO.1; meanwhile, the 1 st exon of the gene SD1 of the multi-gene knockout mutant is inserted with a base A between 359 th and 360 th positions of a genome, 384bp between 377 th and 760 th positions of the genome is replaced by A, and the base sequence is shown as SEQ ID NO.2.

Preferably, the upland rice is indica-line upland rice, and is especially suitable for upland rice Liu Yin.

Further, primers used to detect the multiple gene knockout mutant were as follows:

GW2-F：AAAAGGGATATGCACCG；

GW2-R：CCAGGCTACAATGACACC；

SD1-F：TCTCATCTCCAATCTCATGGTGGCC；

SD1-R：CAGGTCGGTTTCTTCCCGCTTTC。

further, the multiple gene knockout mutant is obtained by the following method: constructing a multi-target expression vector by using a CRISPR/cas9 gene knockout system, transforming the multi-target expression vector into a dry rice callus by using an agrobacterium-mediated method, and performing fixed-point knockout on the following target gene combinations to obtain a multi-gene knockout mutant edited by genes GW2 and SD1 simultaneously;

the target gene combination is as follows: gene GW2 and gene SD1; or gene GW2, gene SD1 and gene DEP1; or gene GW2, gene SD1 and gene GS3; or gene GW2, gene SD1, gene DEP1 and gene GS3.

According to the invention, 2-4 genes in DEP1, GS3, GW2 and SD1 are knocked out simultaneously to obtain a plurality of gene knocked-out mutants, and the double-gene mutant provided by the invention can be cultivated to obviously improve the yield and resist lodging.

Compared with the prior art, the invention has the following beneficial effects: the invention overcomes the difficulty that the drought rice is difficult to carry out gene editing, and successfully obtains the polygene mutant through the CRISPR/Cas9 polygene technology, compared with the wild drought rice, the polygene mutant has the advantages of increased spike number and thousand seed weight, reduced plant height, obviously improved yield of the drought rice, lodging resistance and great application value in the breeding of the drought rice.

Drawings

FIG. 1 is a lacz-OSU6a-GW2-sgRNA expression cassette;

FIG. 2 is an OSU6b-SD1-sgRNA expression cassette;

FIG. 3 is an OSU6c-GS3-sgRNA expression cassette;

FIG. 4 is an OSU3-DEP1-sgRNA expression cassette;

FIG. 5 is a map of LY46-HY-1 vector;

FIG. 6 is a map of LY46-HY-3 vector;

FIG. 7 is a map of LY46-HY-4 vector;

FIG. 8 shows the copy result of the land-based 46 mutant.

Detailed Description

The following describes the technical scheme of the present invention in further detail with reference to the accompanying drawings and specific examples, but the present invention is not limited to the following technical scheme.

The following examples used pYLCRISPR/Cas9 strain (TOP 10F'), CRISPR/sgRNA vectors strain (DH 10B), promoter OsU a, osU6B, osU6c and OsU a all from the national institute of Electrical and electronics Endoconcha Liu Yaoguang subject group.

Example 1

1 vector construction

1.1 detection of target genes in the acceptor Material LY46

PCR and sequencing were performed in the transformation acceptor indica line upland primer 46 (LY 46) to detect mutations in the target genes DEP1, GS3, GW2, SD1, gn1 a. The experimental results show that in LY46, 4 genes DEP1, GS3, GW2 and SD1 are required to be knocked out (Gn 1a gene cannot be detected in the land 46, and the gene is considered to have large fragment deletion in the land 46), and the base sequences of the four genes can be found in a gene database.

1.2 target design

Based on the detection results of the target gene in LY46, the design and determination of the target design results are shown in Table 1:

gene DEP1 is designed as a target at exon5 and is located at the 3353-3372 bases of the genome.

Gene GS3 was targeted at exon1 at bases 117-136 of the genome.

Gene GW2 designs a target point at exon4, and is positioned at the 2071-2090 bases of the genome.

Gene SD1 was targeted at exon1 at bases 356-375 of the genome.

TABLE 1

1.3 vector construction

The expression level of the 4 small nuclear RNA promoters from rice sources used in this example was OsU a > OsU6b > OsU6c > OsU3a. When there are more than 4 ligation targets, the distance between the same promoters is made as close as possible in order to reduce the possibility of homologous recombination of the same promoter sequences in Agrobacterium. Therefore, the U3 and U6 a-c promoters are used and arranged in the following modes:

1 target point: lacZ-U6a

2 targets: lacZ-U6 a-U6 b

3 targets: lacZ-U6 a-U6 b-U6 c

4 targets: lacZ-U6 a-U6 b-U6 c-U3

For LY46, the U3, U6 a-c promoters and sgRNA expression cassettes were used and arranged in the manner of

The arrangement mode of the 4 gene targets is as follows:

LacZ-U6a—GW2---U6b—SD1---U6c—GS3---U3—DEP1

the 2 groups of 3 gene targets were arranged as follows:

LacZ-U6a—GW2---U6b—SD1-------------------U3—DEP1

LacZ-U6 a-GW 2-U6 b-SD 1-U6 c-GS 3-method for constructing and operating 1.3.1 vector

The embodiment constructs a polygene target point carrier, which is respectively as follows:

LY-HY-14 targets: u6a-GW 2-U6 b-SD 1-U6 c-GS 3-U3-DEP 1;

LY-HY-33 targets: u6a-GW 2-U6 b-SD 1-U3-DEP 1;

LY-HY-43 targets: u6a-GW 2-U6 b-SD 1-U6 c-GS 3;

because the construction process of the 3 polygenic target vectors is basically the same, LY-HY-1 is as follows: u6a-GW 2-U6 b-SD 1-U6 c-GS 3-U3-DEP 1, the specific construction process is described as an example.

1) Strain activation and plasmid extraction preparation: the pYLCRISPR/Cas9 strain (TOP 10F') and CRISPR/sgRNA vectors strain (DH 10B) were streaked overnight in plate medium containing kanamycin (25. Mu.g/ml) and ampicillin (50. Mu.g/ml), respectively, and 1ml seed solution was picked up for single colony culture and then grown for plasmid extraction.

2) Preparing a target joint: the adaptor primer TE was dissolved in 100. Mu.M mother liquor, and 1. Mu.l each was added to 98. Mu.l of 0.5 XTE and diluted to 1. Mu.M. And (3) transferring to room temperature for cooling at about 90 ℃ for 30s to finish annealing.

3) Enzymatic cleavage of sgRNA vector: pYLsgRNA-OsU6a-LacZ, pYLsgRNA-OsU6b, pYLsgRNA-OsU c and pYLsgRNA-OsU3 plasmid 1. Mu.g each were taken, and the reaction was digested with 10U Bsa I for 20min at 25. Mu.l, and stored frozen.

sgRNA expression cassette ligation reaction: the digested pYLsgRNA-U# plasmids (pYLsgRNA-OsU a-LacZ, pYLsgRNA-Os U6b, pYLsgRNA-OsU c, pYLsgRNA-OsU 3) were ligated with the corresponding linkers according to Table 2 for about 10-15min at room temperature (20-28 ℃) to obtain the respective ligation products. After each connection product is obtained, PCR amplification is carried out, and the specific reaction process is as follows:

TABLE 2

Table 3 target point joint (primer)

4) First round PCR amplification: each sgRNA expression cassette was divided into 2PCR reactions, 15. Mu.l each: mu.l of each ligation product was used as template, using U-F/adaptor reverse primer (reaction 1), and adaptor forward primer/gR-R (reaction 2), each 0.2. Mu.M, cycles 25-28: 94℃for 10s,60℃for 15s and 68℃for 20s. Mu.l of (optionally) the reaction 2 product was checked for electrophoresis (reaction 2 product length about 140bp, 2% agarose gel).

5) Second round PCR: the position specific primer pairs (Table 4) were previously mixed into 10 Xworking solutions, each 1.5. Mu. MsgRNA expression cassette specific position primer pair using method:

3cassettes:Pps-GGL/Pgs-GG2,Pps-GG2/Pgs-GG3,Pps-GG3/Pgs-GGR；

amplifying the corresponding gsRNA expression cassette:

lacz-OSU6a-GW2-sgRNA，OSU6c-GS3-sgRNA，OSU3-DEP1-sgRNA；

lacz-OSU6a-GW2-sgRNA，OSU6b-SD1-sgRNA，OSU3-DEP1-sgRNA；

lacz-OSU6a-GW2-sgRNA，OSU6b-SD1-sgRNA，OSU6c-GS3-sgRNA；

OSU6b-SD1-sgRNA，OSU6c-GS3-sgRNA，OSU3-DEP1-sgRNA。

4cassettes:Pps-GGL/Pgs-GG2,Pps-GG2/Pgs-GG3,Pps-GG3/Pgs-GG4,Pps-GG4/Pgs-GGR；

amplifying the corresponding gsRNA expression cassette: lacz-OSU6a-GW2-sgRNA, OSU6b-SD1-sgRNA, OSU6c-GS3-sgRNA and OSU3-DEP1-sgRNA. The lacz-OSU6a-GW2-sgRNA, OSU6b-SD1-sgRNA, OSU6c-GS3-sgRNA and OSU3-DEP1-sgRNA expression cassettes are respectively shown in figures 1-4, all the expression cassettes in figures 1-4 are expression cassettes without position specific primers, wherein lower case italics characters are sgRNA scanffold, lower case characters are corresponding promo, and bolded characters 19-20bp in the middle of the two are corresponding targets.

TABLE 4 second round pcr primer design (Golden gate cloning general site specific primer)

Note that: the bolded portion is Bsa I recognition site

1 μl of each of the two reaction products of the first round PCR of each sgRNA expression cassette was taken and used with H ₂ O was diluted 10-fold, and then 1. Mu.l of each diluted product was mixed as a template. 20-50. Mu.l of each expression cassette was PCR (50. Mu.l for 1 target, 30. Mu.l for 2-3 targets, 20. Mu.l for 4 or more targets). 1/10 amount of each primer combination working solution (final concentration 0.15. Mu.M) was added. Amplification 17-20 cycles (actual condition adjustment): 95℃10s,58℃15s,68℃20s.

6) Based on the estimated amount of each sample product, all PCR products were mixed in approximately equal amounts and purified using the PCR product purification kit.

7) The cleavage-ligation reaction of the binary vector with the sgRNA expression cassette, the reaction components are shown in table 5.

TABLE 5

Carrying out enzyme digestion connection by using a variable temperature circulation for about 10-15 cycles at 37 ℃ for 5min; 5min at 10 ℃ and 5min at 20 ℃; finally, the temperature is 37 ℃ for 5min.

8) Ligation product conversion: 10ul of the ligation product was used to transform 70ul E.coli DH5a competent cells by heat shock, and 350ul of SOC was added after transformation and incubated overnight at 37 ℃. The plating medium is LB+25 mug/ml Kan, 0.3-0.5 mM IPTG, and a proper amount of X-gal. IPTG induces ccdBs expression lethality in empty plasmid transformants that did not completely excise ccdBs. While positive clones containing the insert of interest (LacZ-gRNA expression cassette) produced blue plaques by LacZs expression

9) Blue plaque clone is selected, cultured, plasmid is extracted, and sequencing detection is carried out.

10 Agrobacterium is introduced. The obtained clone was transformed into Agrobacterium (EHA 105) by electric shock. The plasmid is extracted from the agrobacterium (the quality of the extracted plasmid of the agrobacterium is poor and the plasmid is only suitable for PCR), about 2-5ng of the plasmid is taken as a template, and the PCR is confirmed by pairing all target joint forward primers and reverse primers.

1.3.2 vector construction results

1. The vector map of the 4 target vectors LY-HY-1U 6a-GW 2-U6 b-SD 1-U6 c-GS 3-U3-DEP 1 is shown in FIG. 5, and is shown in FIG. 5: the connection of the sgRNA expression cassette at multiple sgRNA expression cassettes of IRAT-HY-1 is as follows: u6a-GW 2-U6 b-SD 1-U6 c-GS 3-U3-DEP 1;

the vector map of LY-HY-3U 6a-GW 2-U6 b-SD 1-U3-DEP 1 is shown in FIG. 6;

LY-HY-4: the vector map of U6a-GW 2-U6 b-SD 1-U6 c-GS3 is shown in FIG. 7.

1.3.3 transformation of the expression vector with Agrobacterium

The expression vector was transformed into Agrobacterium strain EHA105 by electric shock and stored at-70 ℃.

2 Agrobacterium-mediated genetic transformation of upland rice

Vectors LY-HY-1, LY-HY-3 and LY-HY-4 are transformed into upland primer 46 for upland rice variety by agrobacterium-mediated genetic transformation.

3 edit result detection

3.1DNA extraction

The genomic DNA of upland rice was extracted in small amounts by CTAB method.

(1) Taking rice leaves with the length of about 2cm, and placing the rice leaves into a 2ml centrifuge tube;

(2) Sampling by a sample grinder (rotation speed is 2000rpm,1 min), adding 800 mu L of 1.5 XCTAB into the sample after grinding, and mixing uniformly;

(3) Water bath of 65 ℃ water bath kettle for 20-30min, and reversing and mixing once every 5min;

(4) Adding 24:1 (chloroform: isoamyl alcohol) with equal volume, mixing upside down, and standing for 10min;

(5) Centrifuging at 10000rpm for 10min;

(6) Sucking 400 mu L of supernatant to a new centrifuge tube, adding 2 times of 95% ethanol subjected to freezing, and freezing at-20 ℃ for 20min;

(7) Centrifuging at 12000rpm for 15min;

(8) The supernatant was discarded, 500. Mu.L of 75% ethanol was added, and the mixture was centrifuged at 12000rpm for 5min;

(9) The supernatant was discarded, dried in an ultra clean bench, dissolved in 100. Mu.L ddH2O, and stored at-20℃until use.

3.2 design of PCR detection primer for target gene

TABLE 6

3.2PCR detection

The PCR reaction system is shown in Table 7.

TABLE 7

Note that: GW2, DEP1, gn1a have good amplification effect by Takara ExTaq enzyme, SD1 has good amplification effect by KOD enzyme, GS3 can only be amplified by KOD enzyme.

PCR amplification procedure

Sequencing of PCR products by sequencing company

3.3 genotyping results

The knockout rate of each target was found to be shown in table 8 through PCR and sequencing.

TABLE 8

And it was found that two target genes were edited in the same individual (Table 9): family 1, 2, 3, 5 had two genes edited at the same time. Wherein, family 1DEP1 and SD1 are edited simultaneously, the editing type of DEP1 is B10 (between 607-608, T insertion), and the editing type of SD1 is D25 (299, A-G); family 2 is also editing of DEP1 and SD1 simultaneously, the editing type of DEP1 is B15 (608-646, 39bp deletion), and the editing type of SD1 is D25 (299, A-G); family 3SD1 and GS3 were edited simultaneously, the editing type of SD1 was D13 (A insertion between 278 and 279 positions of exon1, 282bp between 296 and 577 was replaced by A), and the editing type of GS3 was E6 (A insertion between 101 and 102). Family 1, family 2 and family 3 can be obtained by site-directed knockout of multi-target vectors LY-HY-1, LY-HY-3 and LY-HY-4. The multi-target carrier adopted by the family 5 is LY-HY-1, the genes GW2 and SD1 are edited simultaneously, the editing type of GW2 is A13 (position 338 of 4 th exon, A delete), and the base sequence is shown as SEQ ID NO:1, a step of; the editing type of SD1 is D13 (A insertion between 278-279 positions of 1 exon is replaced by A at 282-577 positions of 296 bp), and the base sequence is shown as SEQ ID NO.2; as shown in table 9.

Note that: the mutation positions in each family were in the order of CDS, and the base number was 1 as A in the start code ATG. Wherein the CDS sequence mutation positions in family 5 correspond to positions in the genome as follows: bit A of 2087 in GW2 is missing. A insertion between position 359-360 in SD1, 384bp substitution at position 377-760 is A, where more is deleted than on CDS, because the deleted portion contains one intron.

TABLE 9 results of genotyping of the land-induced 46 mutants

4 field planting phenotype identification

4.1 field planting

Each family material was planted with 18 individual plants (6 plants per row, 3 rows) at a plant spacing of 15cm. Wild-type material was grown in the same manner.

4.2 phenotypic identification

TABLE 10 summary of copy results for the land-based 46 mutant

And (5) carrying out thousand seed weight, single plant yield, plant height, spike number and spike length identification on the field-planted mutant material. Analysis showed that the thousand kernel weights of 1, 2, 3, 5, 17 were significantly higher than WT, with 5 thousand kernel weights 34% higher than WT (fig. 8D, table 10). 1. The individual yields of 3, 5, 17 were significantly higher than WT (fig. 8E, table 10); the plant heights of 1, 3 and 17 are found to be obviously higher than the WT, and the plant height of 5 is obviously lower than the WT; the field observes that the lodging resistance of the mutant with the plant height higher than that of the WT is weakened, and the mutant is extremely easy to lodge in strong rainfall or windy weather, so that the family 5 with the lower plant height has higher advantage in breeding.

In addition, the inventor of the application also builds a double-gene target carrier of genes SD1 and GW2, the knockout rate of target targets and the editing effect on plants are not obtained yet, but high-yield mutants are more likely to be obtained.

Sequence listing

<110> Baoshanhua Dawisdom agricultural technologies and technologies Co., ltd

<120> application of multiple gene knockout mutant in dry rice breeding

<130> 20200311

<160> 2

<170> SIPOSequenceListing 1.0

<210> 1

<211> 6428

<212> DNA

<213> Artificial

<400> 1

gcagcagaga ggtctccact tccctttcct cccaccccga gaaagccaaa aaaagaaaaa 60

ttatttttca aaaaaaaagc tcgcctcgcc ctcgcgtcgt cgtccccatc accccccctc 120

ctccgctccg agtacgcgtg cgtataccac cacctccatc tccaccaccg tatgtatcta 180

cggtgaggcg gcggcggcgg aggaggagga ggagggggag tggtgagggt ttcatctgcg 240

gaggaggagg gaggaggagg gaggagggta gatctgggag ggggatgggg aacaggatag 300

gggggaggag gaaggcgggg gtggaggaga ggtacacgag gccgcagggg ctgtacgagc 360

acagggacat cgaccagaag aagctccgga agctgatcct cgaggccaag ctcgcgccgt 420

gctacatggg cgccgacgac gccgccgccg ccgccgacct cgaggagtgc cccatctgct 480

tcctggtata aaaccgcctc cggggagatg tggcgggtgg acgggaggaa gagatctctc 540

ccctcttcct cacttcctcc tcccgcttcc ttccacttca gctttttctc tctttttttt 600

tggtgggatt ttgtcgtaat gctactacta gtacttgttg ttgcgagagt agggcgtgga 660

ttgcgtgtgg ccgggtggtg gcgtggagcg tttcgattag ggggttgatt acttttgctc 720

ctgttcgatt gtggagagtg ccggtggtgt gtggccgtta tggagatgga tgaccacgcg 780

cagtgttttg gggcaagaat ttcagtcgac attggcacgg ttttggggtt gtttgtattg 840

ttcttggata attagtgcgg ttcgtggagc tgattttgcg aaatgtagta gtagtgtttg 900

aattatttct ggtagttagt agtggtatca tacttcgtat gtacattgtc cgcaatgttc 960

tcctaaattg ttttgttttc ttaatcatag tttacttact tttattatgt aattctgaga 1020

tacgtttttt tgggataatt atagtctagg aggttttggg tactcattta ttattgtcaa 1080

tattctatag gcctatctat tggctgcctg gctgtgatgc attgcatgaa atttaatgtt 1140

tactgccact cccggggttg ggacattaca gaccttatag gaaatttgac tagtttcata 1200

aatgaataat tggccaactg ttctgcaatg ttgggtgcct tcaatttcta atagtggatg 1260

ctctatagag tacggaggta ccatggtgat atttgtttgt tgtgtgtaat actttatttt 1320

tggtgtatta atgctcttgg gaaccgagat tgagaatcta ttgtagtgaa cttgattctg 1380

ttagctgtgc cagagtattt tcgatgtctc ttgtcaagcc tgcatttatt tggcacaaag 1440

tagatttttt aaaaaaaaat tctgcagctt taatgctact agcttactgc aattaatgtt 1500

attactatat aggaatttta atgcaattct atatggttgc aattttattg caattctgct 1560

tcattagatc tttagctcaa aatcactcaa taaatttggt tttagatgaa atcatgaaac 1620

ttgtattata ggagtatatt atatttggtg ttgaattata tgtttgcatt tgtgctaata 1680

gtggtattta acaattatca cttctggtat ttctgagttc aaactgtttg acaaccactc 1740

ctgtcctgaa atgcatgttt tctttctttg tagtactacc caagtcttaa ccgatcaaag 1800

tgttgctcaa aagggatatg caccggtaat acatctatcc tataactaac aattgtgttt 1860

tacttgttag gaccatatac ccttatattc aatggttggt ttttttgcag agtgctttct 1920

ccaaatgaaa ccaactcaca ctgctcagcc tacacagtat cctttgtgtc acccttgatt 1980

atattttgta accttggcag ttggcaatct atattccttt ttatgaaaaa aatacttaac 2040

caataaagat gtccattctg caaaactccc agttatgctg tggagttcgt ggtgtaaaga 2100

caaaggagga aaggagcata gaacaatttg taagtaattt atattctgat gttttttttt 2160

tgttttgcca aatgcatttc atttatctca cataatatgt gttacaggaa gagcagaaag 2220

tcatagaagc acaaatgagg atgcgccagc aagcacttca agatgaagaa gataagatga 2280

aaagaaaaca gaacaggtgc tcttctagca gaacaatcac accgaccaaa gaagtggagt 2340

atagagatat ttgcagcaca tccttttcag gtctgcacag gctgcaacta acatagaaat 2400

ttagtaatgt accatttctt ctgcttgatg tggtaattta ctatgtgtta tgtctgtttc 2460

agtgccgtca taccgatgtg ctgagcaaga aactgaatgc tgttcatcgg aaccttcatg 2520

ctctgcccag actagcatgc gccctttcca ttctaggcat aaccggtatg ttattatctt 2580

tttctctgag ttttagggtg tcattgtagc ctggttatgt tgaactgcaa accttactac 2640

acttctatgt taaataccct acctcaacca tgttgaaggg aagcaaatga gaagtattgt 2700

taaaatagga taaaggaaag taacagtatt atctatagaa tcaaatcgat aacaaagatc 2760

aaccgttgga ttaaattgga tagtggggac cagacaccat aaaacactgg catttcggac 2820

aagatcattt aattattcca ctttaagctt gtgcagtctg tcctgatcca ctgcactatt 2880

taagtggatg agaagctgtg attggagtta ctgttctagt gttaaggttg acttgtatca 2940

gatacaattg cctatccagt gacaaagttt gaatgtttaa tttgtgaaag tgtgaatgga 3000

gagaatttct gcccacatca ttgttgtacc atgatagtta cagtaatctt tagtttatct 3060

atactctaga gggataaaaa caccaaaaca gtttgatcaa aattgttcga ggtaaatcct 3120

aagtataaaa ttgagaatgg atttgttttt caatatggtt atttgttatc gacattcagt 3180

gtttttattt cacacaatgg ccaattccga aaaaacaatc tgggttcttt ttatcccact 3240

gtccatacca agttgatgta gcaagtaact actacacaaa atagtatatt gtagcccttt 3300

acatgcatcc aatagattaa gtggtcttca atccaaggat gaaataagca ataacgtagg 3360

ttccgatacc aaattagcac aaaacaatgc taaatgcttt tagaggaagt aaaccactca 3420

tttggttctt ttacctataa acttgtgttc gcttgatgtt ctcaatattg tcaggctatt 3480

ttatagactt gaggagtaaa catttcttga tgacgttatc ttctcctatt gtgctagaca 3540

taaaatacag tgtagcataa cttgtgtact gtgagttttt ttcaagtttt tcttgatgct 3600

gcacaatagt atacaacaat cgtctattca gtcacacatg gcacatcctc acatcaaaca 3660

gaagttactt tttatgatgt taatgtgtag tataacagca gaagctaaac ggtagaggga 3720

tacaggatac tcgagtcaat atgaagttgg ggttccatgg agtatttgaa tcgaataaaa 3780

catcttgatg atcaatattg gttttcatat tgtttctata agctagtttc atatttttct 3840

agagaaccta ttattatttt gcttcctgtc ctcctcagaa gattgacatt ctgtactggt 3900

agtgaatttg tgtttccctc ataccctgtt tgggagggtt tcaacgtcag cttagtgcag 3960

tgctgcaaag tttaaactct atgaccagag cataagtatg gcttaaggac ttctgatgac 4020

aaagccattt ttgaaacctg aagcctattt tgatcaactt atgaacttat atggaaaacc 4080

agtttctgaa agaggccaaa tatcaataaa tggtgcctta atctcccttc agttttatag 4140

tttaccatat ggatattttt cctgtactaa gtgtttcttg cttgctggtc atgataatcc 4200

tttatgctgt tgagatgaaa atggtttcta aaattatgaa actgtgtgtt tccccttaca 4260

gtgatgataa cattgacatg aatatagagg atatgatggt tatggaagcg atttggcgtt 4320

ccattcaggt tagtagtttt ctcactggtc cttacatgag attattgata atatgcatat 4380

ggcatactgt ggataatatt ataaaagctg atttgttggg tcaggtaatg gtttgtaaat 4440

gagctgcaca aaaatagatt gttatttgca ttgaacatga aagtttgcta atctcctggc 4500

atgcttgttg aattcagagc attttgcgag ttctgataaa tgcaagatct agtctgcaca 4560

agcagaacct gtattgttaa gtgttcaata ataaaaaaaa atgtcaatta aattgttgag 4620

aagtgtattg gcgatagtgg ataatgtagg atatgtttgg tttgagggac caacatcagt 4680

tagttcatca ttgcctcatt cctcaggcac atgctagtgg aaaaatgagt aatgcagtat 4740

tcatgccaaa atcatcctag atggtgtgat tcctcaaaca aaacaggcca gtagatgatg 4800

gggttggtaa gataagttat ctttttgtca ttttacttga gcagtactgc gcttggcaca 4860

aaaatatttc tggtcatttt gtgagaacaa gaggactttt cacattcctg cattcctgaa 4920

gggaacttat tatctaacag cattgctaaa ctcagctctt cccatgccct tagccatcaa 4980

attgatttgt tatgatggtt gcattgttag ttttgcggtc ccaattatta gccacttaac 5040

gttcaggtca ggaactaatg gtgttttttt tctccgtcct ttgtgttata ttacctccat 5100

cctaaaataa gtgcagccat gagtttccgc gcccaacttt gatcgtccgt tttatttgaa 5160

atttttttat aattagcatt tttgttgtta taagatgata aaacatgaat agtactttac 5220

tcgtgactta tgtttttgat tttttcaaaa aaatttcaaa taagacgaat ggtcaaagtt 5280

gggcgctgaa aaccatggct gcacttattt tgggacggag gtagtatcat ttattcattt 5340

gctgttcaag ctgtagctca tcgtgtactg ttccccaata agttgcttgc catttggtct 5400

atgtttccag cttctttctt ttgtgagcat ttttccttct gtatagcttg ttactagaaa 5460

gatgtaaact ttatgttaaa tgctgcttca tctttgaatt tagattcttg ggaataaaca 5520

ataagcaaag ttcatgtatt gcgtatagaa aagtctgcat atatttctat cctaatacgg 5580

tcaatctttt ctctgagcag gagcagggaa gtatagggaa tcctgtctgt ggcaacttta 5640

tgcctgtaac tgagccatct ccgcgtgaac gccagccatt cgttccagct gcttctctag 5700

aaatacctca tggtggtgga ttttcctgtg cggttgcggc aatggctgag caccagccac 5760

ccagtatgga cttctcttac atggctggca gcagcgcatt cccagttttc gacatgttcc 5820

ggcgaccatg caacattgct ggtggaagca tgtgtaatct ggagagctca ccggagagct 5880

ggagcgggat agcaccaagc tgcagcaggg aagtggtaag agaagaagga gagtgctcgg 5940

ctgaccactg gtcggagggt gcagaggccg gaacaagcta cgcgggctca gacatcgtgg 6000

cagatgccgg gaccatgccg cagctgcctt tcgccgagaa cttcgccatg gcgccaagcc 6060

acttccgccc ggagagcatc gaagaacaga tgatgttttc catggctctt tctttagcag 6120

atggtcatgg aagaacacac tcgcaagggt tggcatggtt gtaggtagag cactctaatt 6180

ttgacgcctt gctgccctct cccttgcgct gctgttgctg cccttctctc ccctgcctcc 6240

tgcttctgcc tcctttttgc caccagctct tggccttttt gttcacccct tttttgcatg 6300

tgttttgtcg tcatggtttg atatagatcc agctatagct ctccattgtt attgcttata 6360

tgtatgtaaa atggaatatg aggaaataga aaaaaggaaa atgggtcaac agttcttttg 6420

gcagtagg 6428

<210> 2

<211> 2704

<212> DNA

<213> Artificial

<400> 2

cacacacaca cacactcaca ctcacacacg ctctcaactc actcccgctc aacacagcgc 60

tcacttctca tctccaatct catggtggcc gagcacccca cgccaccaca gccgcaccaa 120

ccaccgccca tggactccac cgccggctct ggcattgccg ccccggcggc ggcggcggtg 180

tgcgacctga ggatggagcc caagatcccg gagccattcg tgtggccgaa cggcgacgcg 240

aggccggcgt cggcggcgga gctggacatg cccgtggtcg acgtgggcgt gctccgcgac 300

ggcgacgccg aggggctgcg ccgcgccgcg gcgcaggtgg ccgccgcgtg cgccacgcaa 360

cgggttcttc caggtgtcag cgaggagatg aaggagctgt cgctgacgat catggaactc 420

ctggagctga gcctgggcgt ggagcgaggc tactacaggg agttcttcgc ggacagcagc 480

tcaatcatgc ggtgcaacta ctacccgcca tgcccggagc cggagcggac gctcggcacg 540

ggcccgcact gcgaccccac cgccctcacc atcctcctcc aggacgacgt cggcggcctc 600

gaggtcctcg tcgacggcga atggcgcccc gtcagccccg tccccggcgc catggtcatc 660

aacatcggcg acaccttcat ggtaaaccat ctcctattct cctctcctct gttctcctct 720

gcttcgaagc aacagaacaa gtaattcaag cttttttttc tctctcgcgc gaaattgacg 780

agaaaaataa gatcgtggta ggggcggggc tttcagctga aagcgggaag aaaccgacct 840

gacgtgattt ctctgttcca atcacaaaca atggaatgcc ccactcctcc atgtgttatg 900

atttatctca catcttatag ttaataggag taagtaacaa gctacttttt tcatattata 960

gttcgtttga tttttttttt ttaaagtttt tttagtttta tccaaattta ttgaaaaact 1020

tagcaacgtt tataatacca aattagtctc atttagttta atattgtata tattttgata 1080

atatatttat gttatattaa aaatattact atatttttct ataaacatta ttaaaagcca 1140

tttataatat aaaatggaag gagtaattaa tatggatctc ccccgacatg agaatatttt 1200

ccgatggtgt gacgacgcca tgtaagcttc ggtgggcctg gacggccaga ggtgccaaca 1260

gccacgtcca acaacccctg ggtccccccc taacactcca aacagtagtg agtagtgtct 1320

cgtcgcgttt tagtatttga tgacaaacaa agtgtgagtt gagttagcca ccaccaactt 1380

gcacacgagc acatacattt gtgtccattc tcgccagtca cttccatctc tagtcctaac 1440

tcctatctag cgatgtaagc ggataatttc atcatccgta tataaacctg tttgttatag 1500

ttaatttcct atataatact ataacagtat acattttaaa agaaaacaaa attaggataa 1560

acaggccctg ctcctatcca tccatggcac ttggaaggac cagactcggt catgccatgc 1620

caagccaaga tatgggttat ggaagagtag agaagaggag agatgagaga taagcatgcg 1680

ttctcctcct cgttggatgt gtattttgga gggatttgtg tagtagtagc agcggcgccg 1740

cggggacgga tgcggatggt ggcgctttcg gtggcgtttt cccggggggg ttttggtttg 1800

gcgcttgggg gggatggcat ggcgcggcgt gcggctgcac gccacacaca cgcgcgcgca 1860

cgcacgtacg tcgtcgtcgc cgcgggcgga cggtagctta gggtggtgtg ttccgcgcgc 1920

gggcgcggat tgttccatgc cgatcgattt ggcgccaccc tcgccgcggc tcttgtcgcg 1980

tcgtgcgcct ctctcgcgcg gtttgtcctt gtcgcgttgc tcagccggcg acgggggcac 2040

ggacattggc gatgtagccc tgcacgtgtc ggcctctccg ttgatgaatg atgatgtatg 2100

tatgtatttt tttttgtctg aaggaatttg tggggaattg ttgtgtgtgc aggcgctgtc 2160

gaacgggagg tataagagct gcctgcacag ggcggtggtg aaccagcggc gggagcggcg 2220

gtcgctggcg ttcttcctgt gcccgcggga ggacagggtg gtgcggccgc cgccgagcgc 2280

cgccacgccg cagcactacc cggacttcac ctgggccgac ctcatgcgct tcacgcagcg 2340

ccactaccgc gccgacaccc gcacgctcga cgccttcacg cgctggctcg cgccgccggc 2400

cgccgacgcc gccgcgacgg cgcaggtcga ggcggccagc tgatcgccga acggaacgaa 2460

acggaacgaa cagaagccga tttttggcgg ggcccacgcc cacgtgaggc cccacgtgga 2520

cagtgggccc gggcggaggt ggcacccacg tggaccgcgg gccccgcgcc gccttccaat 2580

tttggaccct accgctgtac atattcatat attgcaagaa gaagcaaaac gtacgtgtgg 2640

gttgggttgg gcttctctct attactaaaa aaaatataat ggaacgacgg atgaatggat 2700

gctt 2704

Claims (3)

1. The application of the multi-gene knockout mutant in dry rice breeding is characterized in that the gene GW2 exon4 of the multi-gene knockout mutant is positioned in the 2087 th base A deletion of the genome, and the base sequence is shown as SEQ ID NO.1; meanwhile, the 1 st exon of the gene SD1 of the multi-gene knockout mutant is inserted with a base A between 359 th and 360 th positions of a genome, 384bp between 377 th and 760 th positions of the genome is replaced by A, and the base sequence is shown as SEQ ID NO.2; the upland rice is upland rice Liu Yin and 46.

2. The use of the multiple gene knockout mutant according to claim 1 in dry rice breeding, wherein the primers for detecting the multiple gene knockout mutant are as follows:

GW2-F：AAAAGGGATATGCACCG；

GW2-R：CCAGGCTACAATGACACC；

SD1-F：TCTCATCTCCAATCTCATGGTGGCC；

SD1-R：CAGGTCGGTTTCTTCCCGCTTTC。

3. use of a multiple gene knockout mutant according to claim 1 in dry rice breeding, characterized in that the multiple gene knockout mutant is obtained by the following method: constructing a multi-target expression vector by using a CRISPR/cas9 gene knockout system, transforming the multi-target expression vector into a dry rice callus by using an agrobacterium-mediated method, and performing fixed-point knockout on genes GW2 and SD1 to obtain a multi-gene knockout mutant edited by the genes GW2 and SD1 simultaneously.

Images