CN111440799A

CN111440799A - Kit for realizing multiple immune checkpoint gene editing immune cells through CRISPR-Cpf1 mediation and application thereof

Info

Publication number: CN111440799A
Application number: CN202010302913.4A
Authority: CN
Inventors: 徐振宇; 何连君; 黄后宝; 肖占刚
Original assignee: Yijishan Hospital of Wannan Medical College
Current assignee: Wuhu Wofei Biotechnology Partnership LP
Priority date: 2020-04-17
Filing date: 2020-04-17
Publication date: 2020-07-24
Anticipated expiration: 2040-04-17
Also published as: CN111440799B

Abstract

The invention relates to a kit for realizing multiple immune checkpoint gene editing immune cells through CRISPR-Cpf1 mediation and application thereof, and mainly comprises tandem sgRNAs (S-sgRNAs) or corresponding DNA expression vectors and AsCpf1 purified proteins which can simultaneously target two or more immune checkpoints including PD-1, CT L A-4, TIM-3 and L AG-3 but not limited to PD-1, CT L A-4, TIM-3 and L AG-3, and the like.

Description

Kit for realizing multiple immune checkpoint gene editing immune cells through CRISPR-Cpf1 mediation and application thereof

Technical Field

The invention relates to a kit for realizing multiple immune checkpoint gene editing immune cells mediated by CRISPR-Cpf1 and application thereof.

Background

Gene editing is a technique for precise modification at the genome level, and can accomplish site-directed deletion mutation of genes, site-directed insertion mutation of genes, simultaneous mutation of multiple sites, deletion of small fragments, and the like. The present gene editing technology can be used for gene function and disease pathogenesis research, biological treatment, and diagnosis and treatment of genetic and tumor related diseases.

At present, CRISPR (clustered regularly interspaced short palindromic repeats) becomes the fastest-developing technology in the field of gene editing, and the technology has a breakthrough treatment effect on the treatment of tumors after the T cells are subjected to specific modification. The CRISPR/Cas9 system is found for the first time, the protein in the system identifies DNA sequences more accurately, cytotoxicity is reduced, the construction of the CRISPR/Cas9 system only needs to design gRNA complementary with target sequences, and the system is simpler and cheaper, and the efficiency and the simplicity of gene operation are greatly improved. However, with the ongoing research, the CRISPR/Cas9 system also exposes its drawbacks and limitations, such as severe off-target effects, the need for longer sgrnas, etc. Therefore, scientists also aim to find a new gene editing system, and the 2015 Zhang Feng group reports a novel CRISPR effector protein Cpf1, compared with Cas9, Cpf1 is small in molecular weight, can enter cells to play a role more easily, is low in off-target rate, and Cpf1 only needs a single-stranded RNA consisting of 42-44 nucleotides to recognize and cut DNA, so that the experimental design steps are simplified, and polygene editing is facilitated, wherein AsCpf1 has the advantages of higher cutting efficiency and lower off-target efficiency, and therefore the kit selects AsCpf1 protein as a cutting protein.

The tumor immunotherapy mainly comprises recombinant antigen vaccine, CAR-T cells, TCR-T cells, oncolytic virus, immune checkpoint blockade and the like, wherein the immune checkpoint blockade obtains positive curative effect in tumor therapy, and the method does not directly act on the tumor cells, but removes the inhibition of immune cells from a tumor microenvironment to further enhance the recognition and killing capacity of the tumor cells on tumors.

However, the target gene therapy using antibody drugs is limited in that the action of antibodies is only temporarily blocked and cannot be inhibited for a long time; inhibitory receptors are diverse, and how to use multiple antibodies to simultaneously block multiple inhibitory receptors is not a good strategy at present; the development difficulty of effective antibody drugs is high, and the high cost brings challenges to the clinical application of the antibody drugs. The CRISPR technology is rapid, simple, convenient and efficient in specific target gene knockout, and provides a feasible strategy for realizing tumor immunotherapy. However, the existing gene editing is limited to single gene editing or multi-plasmid co-transfection for multi-target knockout, the operation is complex, and the editing efficiency is low.

Disclosure of Invention

Aiming at the problem that the existing immunosuppressive molecule antibody medicine can simultaneously block and treat tumors by carrying out multiple immune checkpoint genes, the invention provides a kit for realizing multiple immune checkpoint gene editing immune cells through CRISPR-Cpf1 mediation and application thereof, which are used for simultaneously blocking multiple immunosuppressive molecules, can block multiple immunosuppressive molecules of immune cells such as TI L, NK, CAR-T, TCR-T and the like, and can enhance the killing effect of the immune cells on the tumor cells.

The invention provides a shorter and more efficient xccrRNA, which is used for connecting a plurality of sgRNAs (which are nucleotide molecules with nuclease guide function) in series, and is electrotransferred into an immune cell together with the AsCpf1 protein, so that the efficient knockout of a plurality of immune checkpoint genes is realized, and a foundation is laid for the subsequent immune cell technology upgrading.

The invention provides a shorter and more efficient xcrRNA, a plurality of sgRNAs are connected in series, and a plurality of genes are targeted, so that the design steps are greatly simplified, and the experiment cost is reduced.

In order to solve the technical problem, the technical scheme adopted by the invention is that the S-sgRNA molecule for knocking out multiple immune checkpoint in an immune cell is characterized in that the targeted knocking out of the multiple immune checkpoint including but not limited to PD-1, CT L A-4, TIM-3 and L AG-3 is performed, wherein the multiple immune checkpoint includes PD-1, CT L A-4, TIM-3 and L AG-3.

The S-sgRNAs are formed by connecting sgRNAs targeting different genes in series, wherein the different sgRNAs are separated by an xcrRNA which can be cleaved by eukaryotic cells in an intracellular manner, and the sequences of the xcrRNA are as follows: 5 'AUUUCUACUCUUGUAG 3'; the sgRNA is selected from at least two groups of (A) - (D);

(A) sgRNA targeting PD 1:

1, 2, 3, 4, 5;

(B) sgRNA targeting CT L a-4:

one of SEQ ID NO 6, SEQ ID NO 7, SEQ ID NO 8, SEQ ID NO 9, SEQ ID NO 10, SEQ ID NO 11, SEQ ID NO 12, SEQ ID NO 13, SEQ ID NO 14, SEQ ID NO 15, SEQ ID NO 16, SEQ ID NO 17, SEQ ID NO 18, SEQ ID NO 19, SEQ ID NO 20;

(C) sgRNA targeting TIM-3:

one of SEQ ID NO 21, SEQ ID NO 22, SEQ ID NO 23, SEQ ID NO 24, SEQ ID NO 25, SEQ ID NO 26, SEQ ID NO 27, SEQ ID NO 28, SEQ ID NO 29, SEQ ID NO 30, SEQ ID NO 31, SEQ ID NO 32, SEQ ID NO 33, SEQ ID NO 34, SEQ ID NO 35, and SEQ ID NO 36.

(D) sgRNA targeting L AG-3:

37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57.

The examples of the present invention are exemplified by S-sgRNAs shown in SEQ ID NOS 59 and 60. 59 SEQ ID NO: AUUUCUACUCUUGUAGGUCACAAGAACUUUUgaacuggccggcuggccuggAUUUCUACUCUUGUAG GUCACAAGAACUUUUuucuucucuucaucccuguc; SEQ ID NO 60 sequence AUUUCUACUCUUGUAGGUCACAAGAACUUUUgaacuggccggcuggccuggAUUUCUACUCUUGUAGGUCACAAGAACUUUUuucuucucuucaucccugucAUUUCUACUCUUGUAGGUCACAAGAACUUUUcaaggaugcuuaccaccagg.

The invention also provides an expression vector containing the S-sgRNAs molecules, and specifically comprises (1) S-sgRNAs molecules simultaneously targeting two genes including PD-1, CT L A-4, TIM-3 and L AG-3, but not limited to PD-1, CT L0A-4, TIM-3 and L1 AG-3, (2) S-sgRNAs molecules simultaneously targeting three genes including PD-1, CT L A-4, TIM-3 and L AG-3, but not limited to PD-1, CT L A-4, TIM-3 and L AG-3, and (3) S-sgRNAs molecules simultaneously targeting four genes including PD-1, CT L A-4, TIM-3 and L AG-3, but not limited to PD-1, CT L A-4, TIM-3 and L AG-3.

It is another object of the invention to provide a composition comprising the aforementioned S-sgRNAs molecule or the aforementioned vector, and further comprising an ascif 1 protein.

It is a further object of the present invention to provide an agent for simultaneously knocking out various immune checkpoint in an immune cell, comprising the aforementioned S-sgRNAs molecule or the aforementioned vector. Preferably, the protein also comprises AsCpf1 protein.

The invention also provides a kit, which comprises a first component and a second component, wherein the first component is the S-sgRNAs molecule or the DNA expression vector, the second component is AsCpf1 protein, and a certain container in the first component and the AsCpf1 protein in the second component are selected to be combined as required;

the first component of the kit comprises the following contents:

(a) a first container and S-sgRNAs or corresponding DNA expression vectors located within the first container for targeting two genes including PD-1, CT L a-4, TIM-3, L AG-3, but not limited to PD-1, CT L a-4, TIM-3, L AG-3;

(b) a second container and S-sgRNAs or corresponding DNA expression vectors located in the second container for targeting three genes including PD-1, CT L A-4, TIM-3, L AG-3 but not limited to PD-1, CT L A-4, TIM-3, L AG-3;

(c) a third container and S-sgRNAs or corresponding DNA expression vectors located in the third container for targeting four genes including PD-1, CT L A-4, TIM-3, L AG-3, but not limited to PD-1, CT L A-4, TIM-3, L AG-3.

The kit simultaneously targets multiple immune checkpoint including but not limited to PD-1, CT L A-4, TIM-3, L AG-3, TIM-3, L AG-3 and PD-1, CT L A-4.

The invention also provides a reaction mixture comprising (a) the aforementioned S-sgRNAs molecules, the aforementioned vectors, the aforementioned reagents or the aforementioned kits, and (b) immune cells including but not limited to TI L, NK, CAR-T, TCR-T, etc., and containing genes such as PD-1, CT L A-4, TIM-3, L AG-3.

The invention also provides application of the S-sgRNAs molecules, the vectors, the reagents and the kits in preparation of medicines for knocking out multiple immune checkpoint in immune cells and in preparation of medicines for tumor immunotherapy.

Compared with the prior art, the kit has the following advantages in the application of simultaneously blocking various immune checkpoint for treating tumors: (1) the single cell realizes permanent function loss of a plurality of immune checkpoint genes; (2) by establishing a Cpf1 editing system, sgRNAs are expressed in a shorter series connection mode, so that the editing efficiency is greatly improved, and the off-target rate is reduced; (3) the expansibility is good, and the target genes needing to be edited can be increased or decreased at will.

Drawings

FIG. 1 shows S-sgRNAs simultaneously targeting multiple immunocapture sites including, but not limited to, PD-1, CT L A-4, TIM-3, L AG-3, and not limited to, PD-1, CT L A-4, TIM-3, L AG-3;

FIG. 2 shows DNA vectors simultaneously targeting multiple immunocapture sites including, but not limited to, PD-1, CT L A-4, TIM-3, L AG-3, and not limited to, PD-1, CT L A-4, TIM-3, L AG-3;

FIG. 3 shows SDS-PAGE analysis of purified AsCpf1 protein, M representing protein maker, A representing AsCpf1 protein

FIG. 4 shows the mutation efficiency of the positive control assay;

FIG. 5 shows the efficiency of S-sgRNAs targeting both PD-1, CT L A-4 sites simultaneously to cause genomic mutations;

FIG. 6 shows the efficiency of S-sgRNAs targeting simultaneously the PD-1, CT L A-4, TIM-3 sites to cause genomic mutations;

FIG. 7 shows the results of sequencing of S-sgRNAs knock-out PD-1, CT L A-4 genes simultaneously targeting PD-1, CT L A-4 sites;

FIG. 8 shows the results of sequencing of S-sgRNAs knock-out PD-1, CT L A-4, TIM-3 genes simultaneously targeting PD-1, CT L A-4, TIM-3 sites.

Detailed Description

The following describes embodiments of the present invention with reference to the drawings and examples.

In a first aspect of the invention, there is provided sgRNAs or expression vectors therefor for simultaneously targeting multiple immunocapture sites including PD-1, CT L a-4, TIM-3, L AG-3 but not limited to PD-1, CT L a-4, TIM-3, L AG-3, said sgRNAs being selected from one or more nucleotide sequences targeted to PD-1 but not limited to PD-1, CT L a-4, TIM-3, L AG-3 and including PD-1, CT L a-4, TIM-3, L AG-3, and separating the selected sgRNAs sequences by an xcrRNA sequence that can be cleaved intracellularly by a eukaryotic cell, followed by in vitro transcription into S-sgRNAs or corresponding DNA expression vectors having U6 as a promoter, the sgRNAs sequence being located between nl and saiil (as shown in fig. 1 and 2).

The S-sgRNAs or corresponding DNA expression vector segments are selected from the group consisting of:

(1) simultaneously target S-sgRNAs including two genes among PD-1, CT L A-4, TIM-3, L AG-3, but not limited to PD-1, CT L A-4, TIM-3, L AG-3.

(2) Simultaneously target S-sgRNAs including three genes of PD-1, CT L A-4, TIM-3 and L AG-3, but not limited to PD-1, CT L A-4, TIM-3 and L AG-3.

(3) Simultaneously target S-sgRNAs including four genes in PD-1, CT L A-4, TIM-3, L AG-3 but not limited to PD-1, CT L A-4, TIM-3, L AG-3.

In a second aspect of the invention, sgrnas are provided for targeting PD1, CT L a-4, TIM-3, L AG-3 genes, but not limited to PD1, CT L a-4, TIM-3, L AG-3:

(A) sgRNA targeting PD1 gene:

PD1-sgRNA1、PD1-sgRNA2、PD1-sgRNA3、PD1-sgRNA4、PD1-sgRNA5。

preferably, the following steps: PD1-sgRNA1, PD1-sgRNA3, PD1-sgRNA4 and PD1-sgRNA 5.

(B) sgRNA targeting the CT L a-4 gene:

CT A-sgRNA, CT 0A-sgRNA, CT 1A-sgRNA, CT 2A-sgRNA, CT 3A-sgRNA, CT 4A-sgRNA, CT 5A-sgRNA, CT 6A-sgRNA, CT 7A-sgRNA, CT 8A-sgRNA, CT 9A-sgRNA, CT 0A-sgRNA, and CT A-sgRNA 15.

(C) sgRNA targeting TIM-3:

TIM3-sgRNA1、TIM3-sgRNA2、TIM3-sgRNA3、TIM3-sgRNA4、TIM3-sgRNA5、TIM3-sgRNA6、TIM3-sgRNA7、TIM3-sgRNA8、TIM3-sgRNA9、TIM3-sgRNA10、TIM3-sgRNA11、TIM3-sgRNA12、TIM3-sgRNA13、TIM3-sgRNA14、TIM3-sgRNA15、TIM3-sgRNA16。

preferably, the following steps: TIM3-sgRNA2, TIM3-sgRNA5, TIM3-sgRNA6, TIM3-sgRNA9, and TIM3-sgRNA 15.

(D) sgRNA targeting L AG-3:

LAG3-sgRNA1、LAG3-sgRNA2、LAG3-sgRNA3、LAG3-sgRNA4、LAG3-sgRNA5、LAG3-sgRNA6、LAG3-sgRNA7、LAG3-sgRNA8、LAG3-sgRNA9、LAG3-sgRNA10、LAG3-sgRNA11、LAG3-sgRNA12、LAG3-sgRNA13、LAG3-sgRNA14、LAG3-sgRNA15、LAG3-sgRNA16、LAG3-sgRNA17、LAG3-sgRNA18、LAG3-sgRNA19、LAG3-sgRNA20、LAG3-sgRNA21。

preferably L AG3-sgRNA2, L AG3-sgRNA4, L AG3-sgRNA6, L AG3-sgRNA7, L AG3-sgRNA10 and L AG3-sgRNA 16.

According to a third aspect of the present invention, there is provided a kit comprising the first and second aspects, the kit comprising two components, the first component being S-sgRNAs or corresponding DNA expression vectors, and the second component being an aspcf 1 protein, and optionally selecting one container of the first component to combine with the aspcf 1 protein of the second component:

(1) the first component of the kit comprises the following contents:

(c) a third container and S-sgRNAs or corresponding DNA expression vectors located in the third container for targeting four genes including PD-1, CT L A-4, TIM-3, L AG-3, but not limited to PD-1, CT L A-4, TIM-3, L AG-3;

(2) the second component of the kit comprises the ascipf 1 protein.

As described above, the present invention provides a gene editing kit for simultaneous blocking of multiple immunosuppressive molecules, the kit mainly comprises tandem sgRNAs (S-sgRNAs) or corresponding DNA expression vectors, AsCpf1 purified proteins, etc. which are customized to simultaneously target two or more immune checkpoint including PD-1, CT L A-4, TIM-3, L AG-3, but not limited to PD-1, CT L A-4, TIM-3, L AG-3, the selected sgRNAs sequences are separated by an xcrRNA (SEQ ID NO: 61: 5 'AUUUCUACUCUUGUAG 3') sequence which can be engineered to be cleaved by eukaryotic cells intracellularly, and then transcribed into S-sgRNAs in vitro or synthesized into corresponding DNA expression vectors.

The sgRNA sequences are shown in Table 1, and have 80% -95% homology.

The sequences in the present invention are all 5 '-3'.

Table 1: sgRNA sequence

The kit is used for preparing a plurality of immune suppressor molecules simultaneously blocked immune cells, and the method mainly comprises the following steps:

1) separating immune cells to be modified in human peripheral blood;

2) S-sgRNAs or corresponding DNA expression vectors and AsCpf1 protein are introduced into immune cells to be modified in an electrotransfection mode (the amino acid sequence of the AsCpf1 protein is shown as SEQ ID NO:58, and the mass ratio range of the S-sgRNAs to the AsCpf1 protein is as follows: 1 (1-8), the mass ratio range of the corresponding DNA expression vector to the AsCpf1 protein is as follows: 1, (1-8);

3) t7 enzyme digestion detection knockout efficiency.

Example 1 specific knock-out of PD1, CT L A-4 genes in human T cells using AsCpf1

1. Construction and synthesis of S-sgRNAs (shown as SEQ ID NO. 59) simultaneously targeting human PD1 and CT L A-4 genes

1) Respectively selecting PD1 and sgRNA of CT L A-4 gene as SEQ ID NO:4 and SEQ ID NO:18 shown in Table 1, connecting the sequences in series through an xccrRNA sequence, inserting a T7 start sequence SEQ ID NO.62 (5'-TAATACGACTCACTATAG-3') at the front end of the sequence, entrusting general biosynthesis of Anhui, using the sequence as a template chain (the sequence of the template chain is SEQ ID NO. 73: 5'-taatacgactcactatagatttctactcttgtaggtcacaagaacttttgaactggccggctggcctggatttctactcttgtaggtcacaagaacttttttcttctcttcatccctgtcaaaa-3'), designing and synthesizing a forward nucleotide chain and a reverse nucleotide chain (the sequence of F1: SEQ ID NO.635 '-TAATACGACTCACTATAG-3'; the sequence of R1: SEQ ID NO. 645 '-TTTTGACAGGGATGAAGA-3').

Setting up a PCR reaction

The reaction temperature was set as follows:

after the reaction is completed, collecting PCR products.

3) Setting up an in vitro transcription reaction

Incubation at 37 ℃ for 1 hour;

add 1 u L DNase I to the reaction mixture and incubate at 37 ℃ for 15 minutes;

adjusting the volume of the reaction to 200 μ L with nuclease-free water;

add 100. mu. L binding buffer;

300 μ L ethanol (> 96%) was added and mixed by pipette;

transferring the mixture to RNA purification micro-column, centrifuging at 14,000 × g for 30-60 s, and discarding the flow-through;

add 700 μ L Wash buffer 1 (diluted with 13m L > 96% ethanol) and centrifuge at 14,000 × g for 30-60 seconds;

the empty purification column was centrifuged at 14,000 × g for 60 seconds to completely remove residual wash buffer before transferring the purification column to a clean 1.5m L collection tube;

10 μ L nuclease-free water was added to the center of the purification column filter, and centrifuged at 14000 × g for 60 seconds to elute the gRNA.

Preparation of AsCpf1 protein

1) Construction of prokaryotic expression vector

The vector construction plasmid pTrcHis2B (purchased from Invitrogen company) adds a his tag sequence at the 3' end of the gene sequence AsCpf1 and inserts the gene sequence between the NcoI enzyme cutting sites and the XhoI enzyme cutting sites of the plasmid to obtain a recombinant expression vector pTrcHis2B-AsCpf1, and the construction of the prokaryotic expression vector is finished by Anhui general biology Limited. The sequence of the AsCpf1 gene is shown as SEQ ID NO. 72.

2) Expression and purification of AsCpf1 protein

Transferring a prokaryotic expression vector into an expression host bacterium, picking and inoculating a single clone into a fresh L B culture medium (containing ampicillin), adding 0.8mM IPTG (isopropyl-B-D-thiogalactose) to induce expression of AsCpf1 after the bacterium is amplified for about 8 hours, collecting the bacterium after induction for 6 hours, adding a crushing buffer solution (pH7.520mM Tris-HCl, 50mM NaCl, 1% Triton-100, 20% glycerol), carrying out ultrasonic crushing to obtain a supernatant, passing the supernatant through a nickel column, washing the nickel column by using an eluent (20mM Tris-HCl pH7.5, 50mM NaCl, 0.1% TritonX-100, 500mM imidazole, 20% glycerol) after sample loading is finished, collecting the eluent, dialyzing the collected protein into 20mM Tris,50mM NaCl pH7.5, 20% glycerol, and carrying out ultrafiltration concentration after dialysis is finished.

The purified AsCpf1 protein was identified by electrophoresis on a 10% SDS-PAGE gel followed by Coomassie blue staining, and the results are shown in FIG. 3. In FIG. 3, M represents the protein maker, lane 1 represents the band of purified AsCpf1 protein loaded at 1. mu.l, and lane 2 represents the band of purified AsCpf1 protein loaded at 3. mu.l, with a molecular weight of approximately 150kD and a theoretical molecular weight. The sequence of the purified AsCpf1 protein is shown as SEQ ID NO. 58.

3. Human peripheral blood T cell separation and culture

Human peripheral blood is from a healthy donor, after the peripheral blood is collected, the whole blood is diluted by PBS buffer solution according to the dilution ratio of 1:1 and transferred into a 50ml centrifuge tube, 15ml of human peripheral blood lymphocyte separation liquid (TBD) is firstly added into the new 50ml centrifuge tube, then 25ml of diluted whole blood is carefully added along the wall, the interface between the two liquids can not be damaged, 750g speed centrifugation is carried out for 25-30 minutes, a centrifuge is arranged to slowly rise and fall, after the centrifugation, most of erythrocyte running parts are centrifuged to the bottom of the tube, red blood cells, ficoll layers, leukocyte layers and serum layers are sequentially arranged from bottom to top, the leukocyte layers are sucked into the new 50ml centrifuge tube, PBS is added, supernatant is removed after washing, RPMI 1640 culture medium is used for carrying out resuspension, CD3 antibody beads (MACS) are used for separating CD3 positive T cells, cell stimulation factors CD3, CD28 and I L-2 are respectively carried out for three days, and the final concentration is 200ng/ml, 200ng/ml, 40ng/ml, and culturing is carried out for three days.

4. Gene knockout by electrotransfer

Taking the cultured T cells stimulated in the previous step, centrifuging according to 20 μ l system/electric shock cup (Celetrix LL C), discarding the culture Medium, washing the cells with 1640 incomplete culture Medium, resuspending the cells with electrotransfer solution (Post Electroporation Medium PEM-2), adjusting the cell density to 2.0X10⁶Add AsCpf1 protein and S-sgRNAs (ratio 1. mu.g: 1. mu.g, sequence of S-sgRNAs as shown in SEQ ID NO: 59) to 20. mu.l and add to the cuvette, taking care that NO air bubbles are present. The electrotransfer condition is 510V and 20ms (the voltage can be selected between 490 and 530V according to the cell state), the parameters are adjusted before the electrotransfer, and preheating is carried out. After the completion of the Electroporation, the electroporated cells were taken out and cultured in an Electroporation Buffer 103

Enzyme digestion detection of T7EN1

The T cells after the electroporation enrichment were collected, genomic DNA was extracted using L sys buffer AB (GBI kit) at 37 ℃ for 5min and 93 ℃ for 10min, and the extracted genomic DNA was subjected to PCR (primer sequences are:

PD1:F1:GTGGGTGTCCCCTCCTGCAC(SEQ ID NO.65)R1:GGGGAGGCGGGAGTGAGGGC(SEQID NO.66)；

CTLA-4:F1:TCCTGAAAGGTTTTGCTCTA(SEQ ID NO.67)R1:CTTCCAGTCTCATAGAAGGG(SEQ ID NO.68)：

after the PCR reaction is finished, collecting PCR products, performing agarose gel electrophoresis, and then, preparing gel to recover and purify DNA fragments.

200ng of the purified PCR product was diluted in 20. mu. L containing lxnEBuffer2(NEB), rapidly denatured and gradually cooled for reannealing in a thermal cycler, the annealed product was mixed with 1. mu. L T7EN1 enzyme (NEB) and gently blown, and then incubated in a water bath at 37 ℃ for 15 minutes, using 2% agarose gel electrophoresis, the electropherogram was analyzed for band cleavage efficiency using Image J Image analysis software, indicating that S-sNAs produced cleavage efficiency, FIG. 4 is the cleavage efficiency of a positive control, wherein M represents DNAmaker, P represents a positive control sample, which was designed as a DNA sample containing 50% mismatch (the positive control was designed to exclude the effects of the procedure and reagents, where the positive control is a pre-designed DNA sample with 50% mismatch inside (i.e., a DNA sequence), regardless of the knocked out gene), the cleavage efficiency finally detected by the procedure was 42%, FIG. 5 shows that the cleavage efficiency of S-sNAs-4 gRNAs targeting PD-1, CT L A-4, and CT 3% PCR-gRNA cleavage efficiency detected as 38732, respectively, and PCR efficiency detected as negative control, and PCR efficiency detected as 38732.

6. Single cell sequencing

1) And taking the T cells after the electricity conversion, and obtaining the single cells in a flow sorting mode.

2) Single cell whole genome DNA amplification

Complementing the single cell suspension to 9 mu L with Enzyme-free water, adding 1 mu L10X cell lysate (containing protease K) to thoroughly mix with a PCR instrument at 50 ℃ for 60min and 99 ℃ for 4min, cooling the lysate and ice after the reaction is finished, adding 2 mu L of1 xPCR buffer, 1 mu L Stabilization Solution and 95 ℃ for 2min to the lysate, cooling the lysate and ice to add 1 mu L Stabilization Enzyme to thoroughly mix with the PCR instrument, and setting the following reaction conditions:

after the reaction was completed, the reaction product was taken out, and after adding 7.5. mu. L10X Amplification Master Mix, 48.5. mu. L Water, 5.0. mu. L DNA Polymerase and mixing them, the following reaction conditions were set in PCR:

and after the reaction is finished, carrying out DNA purification.

3) Gene sequencing

The purified DNA was recovered and submitted to GeneCommunity of Anhui for gene sequencing, and it was found that both the target genes PD1 and CT L A-4 lacked a sequence and the gene knockout was successful according to the sequencing results (see FIG. 7).

Example 2 specific knock-out of PD1, CT L A-4, TIM-3 genes in human T cells using AsCpf1

1. Simultaneously targeting human PD1, CT L A-4 and S-sgRNAs of TIM-3 genes (shown as SEQ ID NO. 60) and synthesizing 1) respectively selecting a PD1, CT L A-4 and sgRNAs of TIM-3 genes as SEQ ID NO. 4, SEQ ID NO. 18 and SEQ ID NO. 26 shown in Table 1, connecting the sequences in series through an xccrRNA sequence, inserting a T7 start sequence SEQ ID NO.62(TAATACGACTCACTATAG) at the front end of the sequence, entrusting general biosynthesis of Anhui, designing and synthesizing a forward nucleotide chain (the sequence of a template DNA chain is 5'-taatacgactcactatagatttctactcttgtaggtcacaagaacttttgaactggccggctggcctggatttctactcttgtaggtcacaagaacttttttcttctcttcatccctgtcatttctactcttgtaggtcacaagaacttttcaaggatgcttaccaccagg aaaa-3'), namely SEQ ID NO. 74), and a forward nucleotide chain and a reverse nucleotide chain (the sequence of F1: 5'-TAATACGACTCACTATAG-3' (SEQ ID NO.63) and the sequence of R1: 5'-TTTTCCTGGTGGTAAGCA-3' (SEQ ID NO.69)

Setting up a PCR reaction

The reaction temperature was set as follows:

after the reaction is completed, collecting PCR products.

3) Setting up an in vitro transcription reaction

Incubation at 37 ℃ for 1 hour;

adjusting the volume of the reaction to 200 μ L with nuclease-free water;

add 100. mu. L binding buffer;

300 μ L ethanol (> 96%) was added and mixed by pipette;

10 μ L nuclease-free water was added to the center of the purification column filter, and the gRNA was eluted by centrifugation at 14000 × g for 60 seconds, to obtain S-sgRNAs.

Preparation of AsCpf1 protein

1) Construction of prokaryotic expression vector

Vector construction plasmid pTrcHis2B (purchased from Invitrogen company), and a his tag sequence added at the 3' end of the AsCpf1 gene sequence (NC-012778.1) is inserted between NcoI and XhoI enzyme cutting sites of the plasmid to obtain a recombinant expression vector pTrcHis2B-AsCpf1, and the construction of the prokaryotic expression vector is finished by Anhui general biology Limited. The sequence of the AsCpf1 gene is shown as SEQ ID NO. 72.

2) Expression and purification of AsCpf1 protein

Transferring a prokaryotic expression vector into an expression host bacterium, selecting a monoclonal and inoculating the monoclonal into a fresh L B culture medium (containing ampicillin), adding 0.8mM IPTG (isopropyl-B-D-thiogalactose) to induce AsCpf1 to express after the bacterium is amplified for about 8 hours, collecting the bacterium after inducing for 6 hours, adding a crushing buffer solution (pH 7.520mM Tris-HCl, 50mM NaCl, 1% Triton-100, 20% glycerol), carrying out ultrasonic crushing to obtain a supernatant, passing the supernatant through a nickel column, washing the nickel column by using an eluent (20mM Tris-HCl pH7.5, 50mM NaCl, 0.1% Triton X-100, 500mM imidazole, 20% glycerol) after the sample loading is finished, collecting the eluent, dialyzing the collected protein into 20mM Tris,50mM NaCl pH7.5, 20% glycerol, and carrying out ultrafiltration concentration after the dialysis is finished.

3. Human peripheral blood T cell separation and culture

4. Gene knockout by electrotransfer

Taking the cultured T cells stimulated in the previous step, centrifuging according to 20 μ l system/electric shock cup (Celetrix LL C), discarding the culture Medium, washing the cells with 1640 incomplete culture Medium, resuspending the cells with electrotransfer solution (Post Electroporation Medium PEM-2), adjusting the cell density to 2.0X10⁶Add AsCpf1 protein and S-sgRNAs (ratio 1. mu.g: 1. mu.g, sequence of S-sgRNAs as shown in SEQ ID NO: 60) to 20. mu.l and add to the cuvette, taking care that NO air bubbles are present. The electrotransfer condition is 510V and 20ms (the voltage can be selected between 490 and 530V according to the cell state), the parameters are adjusted before the electrotransfer, and preheating is carried out. After completion of the Electroporation, the electroporated cells were taken and cultured in an Electroporation Buffer 103.

Enzyme digestion detection of T7EN1

CTLA-4:F1:TCCTGAAAGGTTTTGCTCTA(SEQ ID NO.67)R1:CTTCCAGTCTCATAGAAGGG(SEQ ID NO.68)；

TIM3:F1:TAAGCTTTCTGGCTCAGAT(SEQ ID NO.70)R1:AGGTGATGGGCTTTATTCTA(SEQID NO.71)：

200ng of the purified PCR product is diluted in a 20 mu L system containing lxnEBuffer2(NEB), rapidly denatured and gradually cooled for reannealing in a thermal cycler, 1 mu L T7EN1 enzyme (NEB) is added to the annealed product and gently blown and evenly mixed, then the mixture is incubated in a water bath at 37 ℃ for 15 minutes, agarose gel electrophoresis with the concentration of 2% is used, an electrophoretogram analyzes the band cutting efficiency by Image J Image analysis software to indicate that S-sgRNAs generates the cutting efficiency, FIG. 4 shows the cutting efficiency of a positive control, wherein M represents DNA maker, P represents a positive control sample, the positive control is designed as a DNA sample containing 50% of mismatch rate, the final cutting efficiency detected by the operational digestion is 42%, FIG. 6 shows the efficiency of genome mutation caused by S-sgRs simultaneously targeting PD-1, CT L A-4 and gRNAs gRNA-3 sites, PD1, CT L A4 and TIM-3 respectively detect 36%, 38% and 36% of negative control.

6. Single cell sequencing

1) Obtaining the single cells from the T cells after the electricity conversion in a flow sorting mode;

2) single cell whole genome DNA amplification

Supplementing enzyme-free water to 9 μ L, adding 1 μ L10X cell lysate (containing proteinase K) and mixing completely, mixing with PCR instrument at 50 deg.C for 60min and 99 deg.C for 4min, cooling the lysate and ice, and adding the lysate into 2 μ L of

1 XPreptation buffer, 1. mu. L Stabilization Solution, 2min at 95 ℃, cooling on ice, adding 1. mu. L precipitation Enzyme thoroughly mixing the PCR instrument and setting the following reaction conditions:

and after the reaction is finished, carrying out DNA purification.

3) Gene sequencing

The purified DNA was recovered and assigned to the general biology of Anhui Ltd for gene sequencing, and based on the sequencing results, it was found that all the target genes PD1, CT L A-4, TIM-3 lacked a sequence and the gene knockout was successful (see FIG. 8).

The foregoing illustrates and describes the principles, general features, and advantages of the present invention. It should be understood by those skilled in the art that the above embodiments do not limit the present invention in any way, and all technical solutions obtained by using equivalent alternatives or equivalent variations fall within the scope of the present invention.

Sequence listing

<110> the first subsidiary Hospital of southern Anhui medical school (Yijieshan Hospital of southern Anhui medical school)

<120> kit for realizing multiple immune checkpoint gene editing immune cells through CRISPR-Cpf1 mediation and application thereof

<160>74

<170>SIPOSequenceListing 1.0

<210>1

<211>35

<212>RNA

<213> Artificial Sequence (Artificial Sequence)

<400>1

gucacaagaa cuuuuggacg aagcucucug augug 35

<210>2

<211>35

<212>RNA

<213> Artificial Sequence (Artificial Sequence)

<400>2

gucacaagaa cuuuucuagc ggaaugggca ccuca 35

<210>3

<211>35

<212>RNA

<213> Artificial Sequence (Artificial Sequence)

<400>3

gucacaagaa cuuuucagug gcgagagaag acccc 35

<210>4

<211>35

<212>RNA

<213> Artificial Sequence (Artificial Sequence)

<400>4

gucacaagaa cuuuugaacu ggccggcugg ccugg 35

<210>5

<211>35

<212>RNA

<213> Artificial Sequence (Artificial Sequence)

<400>5

gucacaagaa cuuuuaucug cgccuugggg gccag 35

<210>6

<211>35

<212>RNA

<213> Artificial Sequence (Artificial Sequence)

<400>6

gucacaagaa cuuuuacaua gaccccuguu guaag 35

<210>7

<211>35

<212>RNA

<213> Artificial Sequence (Artificial Sequence)

<400>7

gucacaagaa cuuuucacug gaggugcccg ugcag 35

<210>8

<211>35

<212>DNA/RNA

<213> Artificial Sequence (Artificial Sequence)

<400>8

gucacaagaa cuuuucctgg agaugcauac ucaca 35

<210>9

<211>35

<212>DNA/RNA

<213> Artificial Sequence (Artificial Sequence)

<400>9

gucacaagaa cuuuuagcgg cacaaggcuc agcug 35

<210>10

<211>35

<212>DNA/RNA

<213> Artificial Sequence (Artificial Sequence)

<400>10

gucacaagaa cuuuugcaau uacauaaauc ugggu 35

<210>11

<211>35

<212>DNA/RNA

<213> Artificial Sequence (Artificial Sequence)

<400>11

gucacaagaa cuuuucacau agaccccugu uguaa 35

<210>12

<211>35

<212>DNA/RNA

<213> Artificial Sequence (Artificial Sequence)

<400>12

gucacaagaa cuuuucagaa gacagggaug aagag 35

<210>13

<211>35

<212>DNA/RNA

<213> Artificial Sequence (Artificial Sequence)

<400>13

gucacaagaa cuuuuugugu gaguaugcau cucca 35

<210>14

<211>35

<212>DNA/RNA

<213> Artificial Sequence (Artificial Sequence)

<400>14

gucacaagaa cuuuucuuua gcaauuacau aaauc 35

<210>15

<211>35

<212>DNA/RNA

<213> Artificial Sequence (Artificial Sequence)

<400>15

gucacaagaa cuuuucuucu cuucaucccu gucuu 35

<210>16

<211>35

<212>DNA/RNA

<213> Artificial Sequence (Artificial Sequence)

<400>16

gucacaagaa cuuuuucuuc ucuucauccc ugucu 35

<210>17

<211>35

<212>DNA/RNA

<213> Artificial Sequence (Artificial Sequence)

<400>17

gucacaagaa cuuuuuuuag caauuacaua aaucu 35

<210>18

<211>35

<212>DNA/RNA

<213> Artificial Sequence (Artificial Sequence)

<400>18

gucacaagaa cuuuuuucuu cucuucaucc cuguc 35

<210>19

<211>35

<212>DNA/RNA

<213> Artificial Sequence (Artificial Sequence)

<400>19

gucacaagaa cuuuuuguaa uugcuaaaua aaaga 35

<210>20

<211>35

<212>DNA/RNA

<213> Artificial Sequence (Artificial Sequence)

<400>20

gucacaagaa cuuuuuucuc uucaucccug ucuuc 35

<210>21

<211>35

<212>DNA/RNA

<213> Artificial Sequence (Artificial Sequence)

<400>21

gucacaagaa cuuuucccca gcagacgggc acgag 35

<210>22

<211>35

<212>DNA/RNA

<213> Artificial Sequence (Artificial Sequence)

<400>22

gucacaagaa cuuuuaaugu ggcaacgugg ugcuc 35

<210>23

<211>35

<212>DNA/RNA

<213> Artificial Sequence (Artificial Sequence)

<400>23

gucacaagaa cuuuucauca uucauuaugc cuggg 35

<210>24

<211>35

<212>DNA/RNA

<213> Artificial Sequence (Artificial Sequence)

<400>24

gucacaagaa cuuuucgcaa aggagaugug ucccu 35

<210>25

<211>35

<212>DNA/RNA

<213> Artificial Sequence (Artificial Sequence)

<400>25

gucacaagaa cuuuuaucag uccugagcac cacgu 35

<210>26

<211>35

<212>DNA/RNA

<213> Artificial Sequence (Artificial Sequence)

<400>26

gucacaagaa cuuuucaagg augcuuacca ccagg 35

<210>27

<211>35

<212>DNA/RNA

<213> Artificial Sequence (Artificial Sequence)

<400>27

gucacaagaa cuuuugccag uaucuggaug uccaa 35

<210>28

<211>35

<212>DNA/RNA

<213> Artificial Sequence (Artificial Sequence)

<400>28

gucacaagaa cuuuuaucau ucauuaugcc uggga 35

<210>29

<211>35

<212>DNA/RNA

<213> Artificial Sequence (Artificial Sequence)

<400>29

gucacaagaa cuuuugaucc ggcagcagua gaucc 35

<210>30

<211>35

<212>DNA/RNA

<213> Artificial Sequence (Artificial Sequence)

<400>30

gucacaagaa cuuuucggaa auccccauuu agcca 35

<210>31

<211>35

<212>DNA/RNA

<213> Artificial Sequence (Artificial Sequence)

<400>31

gucacaagaa cuuuuucauc auucauuaug ccugg 35

<210>32

<211>35

<212>DNA/RNA

<213> Artificial Sequence (Artificial Sequence)

<400>32

gucacaagaa cuuuuacauc uucccuuuga cugug 35

<210>33

<211>35

<212>DNA/RNA

<213> Artificial Sequence (Artificial Sequence)

<400>33

gucacaagaa cuuuucacau cuucccuuug acugu 35

<210>34

<211>35

<212>DNA/RNA

<213> Artificial Sequence (Artificial Sequence)

<400>34

gucacaagaa cuuuuaugac caacuucagg uuaaa 35

<210>35

<211>35

<212>DNA/RNA

<213> Artificial Sequence (Artificial Sequence)

<400>35

gucacaagaa cuuuuacugu guccugcugc ugcug 35

<210>36

<211>35

<212>DNA/RNA

<213> Artificial Sequence (Artificial Sequence)

<400>36

gucacaagaa cuuuuaccug aaguugguca ucaaa 35

<210>37

<211>35

<212>DNA/RNA

<213> Artificial Sequence (Artificial Sequence)

<400>37

gucacaagaa cuuuuugcag ccgcuuuggg uggcu 35

<210>38

<211>35

<212>DNA/RNA

<213> Artificial Sequence (Artificial Sequence)

<400>38

gucacaagaa cuuuuggugg cuccagugaa gccuc 35

<210>39

<211>35

<212>DNA/RNA

<213> Artificial Sequence (Artificial Sequence)

<400>39

gucacaagaa cuuuuaacug cuccuucagc cgccc 35

<210>40

<211>35

<212>DNA/RNA

<213> Artificial Sequence (Artificial Sequence)

<400>40

gucacaagaa cuuuugaacu gcuccuucag ccgcc 35

<210>41

<211>35

<212>DNA/RNA

<213> Artificial Sequence (Artificial Sequence)

<400>41

gucacaagaa cuuuucgcua aguggugaug ggggg 35

<210>42

<211>35

<212>DNA/RNA

<213> Artificial Sequence (Artificial Sequence)

<400>42

gucacaagaa cuuuugguca ccuggauccc ugggg 35

<210>43

<211>35

<212>DNA/RNA

<213> Artificial Sequence (Artificial Sequence)

<400>43

gucacaagaa cuuuuggagu cacugugaug auugc 35

<210>44

<211>35

<212>DNA/RNA

<213> Artificial Sequence (Artificial Sequence)

<400>44

gucacaagaa cuuuucucac ugccaagugg acucc 35

<210>45

<211>35

<212>DNA/RNA

<213> Artificial Sequence (Artificial Sequence)

<400>45

gucacaagaa cuuuucccuu cgacuagagg augug 35

<210>46

<211>35

<212>DNA/RNA

<213> Artificial Sequence (Artificial Sequence)

<400>46

gucacaagaa cuuuugagaa gacaguggcg aaacc 35

<210>47

<211>35

<212>DNA/RNA

<213> Artificial Sequence (Artificial Sequence)

<400>47

gucacaagaa cuuuucugcc uuagagcaag ggauu 35

<210>48

<211>35

<212>DNA/RNA

<213> Artificial Sequence (Artificial Sequence)

<400>48

gucacaagaa cuuuuucagg accuuggcug gaggc 35

<210>49

<211>35

<212>DNA/RNA

<213> Artificial Sequence (Artificial Sequence)

<400>49

gucacaagaa cuuuuccagc cuuggcaaug ccagc 35

<210>50

<211>35

<212>DNA/RNA

<213> Artificial Sequence (Artificial Sequence)

<400>50

gucacaagaa cuuuugguga cuggagccuu uggcu 35

<210>51

<211>35

<212>DNA/RNA

<213> Artificial Sequence (Artificial Sequence)

<400>51

gucacaagaa cuuuuugccu uagagcaagg gauuc 35

<210>52

<211>35

<212>DNA/RNA

<213> Artificial Sequence (Artificial Sequence)

<400>52

gucacaagaa cuuuugugac uggagccuuu ggcuu 35

<210>53

<211>35

<212>DNA/RNA

<213> Artificial Sequence (Artificial Sequence)

<400>53

gucacaagaa cuuuuugugg agcucucugg acacc 35

<210>54

<211>35

<212>DNA/RNA

<213> Artificial Sequence (Artificial Sequence)

<400>54

gucacaagaa cuuuuaccuu uggagaagac agugg 35

<210>55

<211>35

<212>DNA/RNA

<213> Artificial Sequence (Artificial Sequence)

<400>55

gucacaagaa cuuuugcuuu caccuuugga gaaga 35

<210>56

<211>35

<212>DNA/RNA

<213> Artificial Sequence (Artificial Sequence)

<400>56

gucacaagaa cuuuuucugc uccuuuuggu gacug 35

<210>57

<211>35

<212>DNA/RNA

<213> Artificial Sequence (Artificial Sequence)

<400>57

gucacaagaa cuuuuucauc cuuggugucc uuucu 35

<210>58

<211>1307

<212>PRT

<213> Artificial Sequence (Artificial Sequence)

<400>58

Met Thr Gln Phe Glu Gly Phe Thr Asn Leu Tyr Gln Val Ser Lys Thr

1 5 10 15

Leu Arg Phe Glu Leu Ile Pro Gln Gly Lys Thr Leu Lys His Ile Gln

20 25 30

Glu Gln Gly Phe Ile Glu Glu Asp Lys Ala Arg Asn Asp His Tyr Lys

35 40 45

Glu Leu Lys Pro Ile Ile Asp Arg Ile Tyr Lys Thr Tyr Ala Asp Gln

50 55 60

Cys Leu Gln Leu Val Gln Leu Asp Trp Glu Asn Leu Ser Ala Ala Ile

65 70 75 80

Asp Ser Tyr Arg Lys Glu Lys Thr Glu Glu Thr Arg Asn Ala Leu Ile

85 90 95

Glu Glu Gln Ala Thr Tyr Arg Asn Ala Ile His Asp Tyr Phe Ile Gly

100 105 110

Arg Thr Asp Asn Leu Thr Asp Ala Ile Asn Lys Arg His Ala Glu Ile

115 120 125

Tyr Lys Gly Leu Phe Lys Ala Glu Leu Phe Asn Gly Lys Val Leu Lys

130 135 140

Gln Leu Gly Thr Val Thr Thr Thr Glu His Glu Asn Ala Leu Leu Arg

145 150 155 160

Ser Phe Asp Lys Phe Thr Thr Tyr Phe Ser Gly Phe Tyr Glu Asn Arg

165 170 175

Lys Asn Val Phe Ser Ala Glu Asp Ile Ser Thr Ala Ile Pro His Arg

180 185 190

Ile Val Gln Asp Asn Phe Pro Lys Phe Lys Glu Asn Cys His Ile Phe

195 200 205

Thr Arg Leu Ile Thr Ala Val Pro Ser Leu Arg Glu His Phe Glu Asn

210 215 220

Val Lys Lys Ala Ile Gly Ile Phe Val Ser Thr Ser Ile Glu Glu Val

225 230 235 240

Phe Ser Phe Pro Phe Tyr Asn Gln Leu Leu Thr Gln Thr Gln Ile Asp

245 250 255

Leu Tyr Asn Gln Leu Leu Gly Gly Ile Ser Arg Glu Ala Gly Thr Glu

260 265 270

Lys Ile Lys Gly Leu Asn Glu Val Leu Asn Leu Ala Ile Gln Lys Asn

275 280 285

Asp Glu Thr Ala His Ile Ile Ala Ser Leu Pro His Arg Phe Ile Pro

290 295 300

Leu Phe Lys Gln Ile Leu Ser Asp Arg Asn Thr Leu Ser Phe Ile Leu

305 310 315 320

Glu Glu Phe Lys Ser Asp Glu Glu Val Ile Gln Ser Phe Cys Lys Tyr

325 330 335

Lys Thr Leu Leu Arg Asn Glu Asn Val Leu Glu Thr Ala Glu Ala Leu

340 345 350

Phe Asn Glu Leu Asn Ser Ile Asp Leu Thr His Ile Phe Ile Ser His

355 360 365

Lys Lys Leu Glu Thr Ile Ser Ser Ala Leu Cys Asp His Trp Asp Thr

370 375 380

Leu Arg Asn Ala Leu Tyr Glu Arg Arg Ile Ser Glu Leu Thr Gly Lys

385 390 395 400

Ile Thr Lys Ser Ala Lys Glu Lys Val Gln Arg Ser Leu Lys His Glu

405 410 415

Asp Ile Asn Leu Gln Glu Ile Ile Ser Ala Ala Gly Lys Glu Leu Ser

420 425 430

Glu Ala Phe Lys Gln Lys Thr Ser Glu Ile Leu Ser His Ala His Ala

435 440 445

Ala Leu Asp Gln Pro Leu Pro Thr Thr Leu Lys Lys Gln Glu Glu Lys

450 455 460

Glu Ile Leu Lys Ser Gln Leu Asp Ser Leu Leu Gly Leu Tyr His Leu

465 470 475 480

Leu Asp Trp Phe Ala Val Asp Glu Ser Asn Glu Val Asp Pro Glu Phe

485 490 495

Ser Ala Arg Leu Thr Gly Ile Lys Leu Glu Met Glu Pro Ser Leu Ser

500 505 510

Phe Tyr Asn Lys Ala Arg Asn Tyr Ala Thr Lys Lys Pro Tyr Ser Val

515 520 525

Glu Lys Phe Lys Leu Asn Phe Gln Met Pro Thr Leu Ala Ser Gly Trp

530 535 540

Asp Val Asn Lys Glu Lys Asn Asn Gly Ala Ile Leu Phe Val Lys Asn

545 550 555 560

Gly Leu Tyr Tyr Leu Gly Ile Met Pro Lys Gln Lys Gly Arg Tyr Lys

565 570 575

Ala Leu Ser Phe Glu Pro Thr Glu Lys Thr Ser Glu Gly Phe Asp Lys

580 585 590

Met Tyr Tyr Asp Tyr Phe Pro Asp Ala Ala Lys Met Ile Pro Lys Cys

595 600 605

Ser Thr Gln Leu Lys Ala Val Thr Ala His Phe Gln Thr His Thr Thr

610 615 620

Pro Ile Leu Leu Ser Asn Asn Phe Ile Glu Pro Leu Glu Ile Thr Lys

625 630 635 640

Glu Ile Tyr Asp Leu Asn Asn Pro Glu Lys Glu Pro Lys Lys Phe Gln

645 650 655

Thr Ala Tyr Ala Lys Lys Thr Gly Asp Gln Lys Gly Tyr Arg Glu Ala

660 665 670

Leu Cys Lys Trp Ile Asp Phe Thr Arg Asp Phe Leu Ser Lys Tyr Thr

675 680 685

Lys Thr Thr Ser Ile Asp Leu Ser Ser Leu Arg Pro Ser Ser Gln Tyr

690 695 700

Lys Asp Leu Gly Glu Tyr Tyr Ala Glu Leu Asn Pro Leu Leu Tyr His

705 710 715 720

Ile Ser Phe Gln Arg Ile Ala Glu Lys Glu Ile Met Asp Ala Val Glu

725 730 735

Thr Gly Lys Leu Tyr Leu Phe Gln Ile Tyr Asn Lys Asp Phe Ala Lys

740 745 750

Gly His His Gly Lys Pro Asn Leu His Thr Leu Tyr Trp Thr Gly Leu

755 760 765

Phe Ser Pro Glu Asn Leu Ala Lys Thr Ser Ile Lys Leu Asn Gly Gln

770 775 780

Ala Glu Leu Phe Tyr Arg Pro Lys Ser Arg Met Lys Arg Met Ala His

785 790 795 800

Arg Leu Gly Glu Lys Met Leu Asn Lys Lys Leu Lys Asp Gln Lys Thr

805 810 815

Pro Ile Pro Asp Thr Leu Tyr Gln Glu Leu Tyr Asp Tyr Val Asn His

820 825 830

Arg Leu Ser His Asp Leu Ser Asp Glu Ala Arg Ala Leu Leu Pro Asn

835 840 845

Val Ile Thr Lys Glu Val Ser His Glu Ile Ile Lys Asp Arg Arg Phe

850 855 860

Thr Ser Asp Lys Phe Phe Phe His Val Pro Ile Thr Leu Asn Tyr Gln

865 870 875 880

Ala Ala Asn Ser Pro Ser Lys Phe Asn Gln Arg Val Asn Ala Tyr Leu

885 890 895

Lys Glu His Pro Glu Thr Pro Ile Ile Gly Ile Asp Arg Gly Glu Arg

900 905 910

Asn Leu Ile Tyr Ile Thr Val Ile Asp Ser Thr Gly Lys Ile Leu Glu

915 920 925

Gln Arg Ser Leu Asn Thr Ile Gln Gln Phe Asp Tyr Gln Lys Lys Leu

930 935 940

Asp Asn Arg Glu Lys Glu Arg Val Ala Ala Arg Gln Ala Trp Ser Val

945 950 955 960

Val Gly Thr Ile Lys Asp Leu Lys Gln Gly Tyr Leu Ser Gln Val Ile

965 970 975

His Glu Ile Val Asp Leu Met Ile His Tyr Gln Ala Val Val Val Leu

980 985 990

Glu Asn Leu Asn Phe Gly Phe Lys Ser Lys Arg Thr Gly Ile Ala Glu

995 1000 1005

Lys Ala Val Tyr Gln Gln Phe Glu Lys Met Leu Ile Asp Lys Leu Asn

1010 1015 1020

Cys Leu Val Leu Lys Asp Tyr Pro Ala Glu Lys Val Gly Gly Val Leu

1025 1030 1035 1040

Asn Pro Tyr Gln Leu Thr Asp Gln Phe Thr Ser Phe Ala Lys Met Gly

1045 1050 1055

Thr Gln Ser Gly Phe Leu Phe Tyr Val Pro Ala Pro Tyr Thr Ser Lys

1060 1065 1070

Ile Asp Pro Leu Thr Gly Phe Val Asp Pro Phe Val Trp Lys Thr Ile

1075 1080 1085

Lys Asn His Glu Ser Arg Lys His Phe Leu Glu Gly Phe Asp Phe Leu

1090 1095 1100

His Tyr Asp Val Lys Thr Gly Asp Phe Ile Leu His Phe Lys Met Asn

1105 1110 1115 1120

Arg Asn Leu Ser Phe Gln Arg Gly Leu Pro Gly Phe Met Pro Ala Trp

1125 1130 1135

Asp Ile Val Phe Glu Lys Asn Glu Thr Gln Phe Asp Ala Lys Gly Thr

1140 1145 1150

Pro Phe Ile Ala Gly Lys Arg Ile Val Pro Val Ile Glu Asn His Arg

1155 1160 1165

Phe Thr Gly Arg Tyr Arg Asp Leu Tyr Pro Ala Asn Glu Leu Ile Ala

1170 1175 1180

Leu Leu Glu Glu Lys Gly Ile Val Phe Arg Asp Gly Ser Asn Ile Leu

1185 1190 1195 1200

Pro Lys Leu Leu Glu Asn Asp Asp Ser His Ala Ile Asp Thr Met Val

1205 1210 1215

Ala Leu Ile Arg Ser Val Leu Gln Met Arg Asn Ser Asn Ala Ala Thr

1220 1225 1230

Gly Glu Asp Tyr Ile Asn Ser Pro Val Arg Asp Leu Asn Gly Val Cys

1235 1240 1245

Phe Asp Ser Arg Phe Gln Asn Pro Glu Trp Pro Met Asp Ala Asp Ala

1250 1255 1260

Asn Gly Ala Tyr His Ile Ala Leu Lys Gly Gln Leu Leu Leu Asn His

1265 1270 1275 1280

Leu Lys Glu Ser Lys Asp Leu Lys Leu Gln Asn Gly Ile Ser Asn Gln

1285 1290 1295

Asp Trp Leu Ala Tyr Ile Gln Glu Leu Arg Asn

1300 1305

<210>59

<211>102

<212>DNA/RNA

<213> Artificial Sequence (Artificial Sequence)

<400>59

auuucuacuc uuguagguca caagaacuuu ugaacuggcc ggcuggccug gauuucuacu 60

cuuguagguc acaagaacuu uuuucuucuc uucaucccug uc 102

<210>60

<211>153

<212>DNA/RNA

<213> Artificial Sequence (Artificial Sequence)

<400>60

auuucuacuc uuguagguca caagaacuuu ugaacuggcc ggcuggccug gauuucuacu 60

cuuguagguc acaagaacuu uuuucuucuc uucaucccug ucauuucuac ucuuguaggu 120

cacaagaacu uuucaaggau gcuuaccacc agg 153

<210>61

<211>16

<212>DNA/RNA

<213> Artificial Sequence (Artificial Sequence)

<400>61

auuucuacuc uuguag 16

<210>62

<211>18

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>62

taatacgact cactatag 18

<210>63

<211>18

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>63

taatacgact cactatag 18

<210>64

<211>18

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>64

ttttgacagg gatgaaga 18

<210>65

<211>20

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>65

gtgggtgtcc cctcctgcac 20

<210>66

<211>20

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>66

ggggaggcgg gagtgagggc 20

<210>67

<211>20

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>67

tcctgaaagg ttttgctcta 20

<210>68

<211>20

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>68

cttccagtct catagaaggg 20

<210>69

<211>18

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>69

ttttcctggt ggtaagca 18

<210>70

<211>19

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>70

taagctttct ggctcagat 19

<210>71

<211>20

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>71

aggtgatggg ctttattcta 20

<210>72

<211>3918

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>72

acacagttcg agggctttac caacctgtat caggtgagca agacactgcg gtttgagctg 60

atcccacagg gcaagaccct gaagcacatc caggagcagg gcttcatcga ggaggacaag 120

gcccgcaatg atcactacaa ggagctgaag cccatcatcg atcggatcta caagacctat 180

gccgaccagt gcctgcagct ggtgcagctg gattgggaga acctgagcgc cgccatcgac 240

tcctatagaa aggagaaaac cgaggagaca aggaacgccc tgatcgagga gcaggccaca 300

tatcgcaatg ccatccacga ctacttcatc ggccggacag acaacctgac cgatgccatc 360

aataagagac acgccgagat ctacaagggc ctgttcaagg ccgagctgtt taatggcaag 420

gtgctgaagc agctgggcac cgtgaccaca accgagcacg agaacgccct gctgcggagc 480

ttcgacaagt ttacaaccta cttctccggc ttttatgaga acaggaagaa cgtgttcagc 540

gccgaggata tcagcacagc catcccacac cgcatcgtgc aggacaactt ccccaagttt 600

aaggagaatt gtcacatctt cacacgcctg atcaccgccg tgcccagcct gcgggagcac 660

tttgagaacg tgaagaaggc catcggcatc ttcgtgagca cctccatcga ggaggtgttt 720

tccttccctt tttataacca gctgctgaca cagacccaga tcgacctgta taaccagctg 780

ctgggaggaa tctctcggga ggcaggcacc gagaagatca agggcctgaa cgaggtgctg 840

aatctggcca tccagaagaa tgatgagaca gcccacatca tcgcctccct gccacacaga 900

ttcatccccc tgtttaagca gatcctgtcc gataggaaca ccctgtcttt catcctggag 960

gagtttaaga gcgacgagga agtgatccag tccttctgca agtacaagac actgctgaga 1020

aacgagaacg tgctggagac agccgaggcc ctgtttaacg agctgaacag catcgacctg 1080

acacacatct tcatcagcca caagaagctg gagacaatca gcagcgccct gtgcgaccac 1140

tgggatacac tgaggaatgc cctgtatgag cggagaatct ccgagctgac aggcaagatc 1200

accaagtctg ccaaggagaa ggtgcagcgc agcctgaagc acgaggatat caacctgcag 1260

gagatcatct ctgccgcagg caaggagctg agcgaggcct tcaagcagaa aaccagcgag 1320

atcctgtccc acgcacacgc cgccctggat cagccactgc ctacaaccct gaagaagcag 1380

gaggagaagg agatcctgaa gtctcagctg gacagcctgc tgggcctgta ccacctgctg 1440

gactggtttg ccgtggatga gtccaacgag gtggaccccg agttctctgc ccggctgacc 1500

ggcatcaagc tggagatgga gccttctctg agcttctaca acaaggccag aaattatgcc 1560

accaagaagc cctactccgt ggagaagttc aagctgaact ttcagatgcc tacactggcc 1620

cggggctggg acgtgaatgt ggagaagaac cggggcgcca tcctgtttgt gaagaacggc 1680

ctgtactatc tgggcatcat gccaaagcag aagggcaggt ataaggccct cagcttcgag 1740

cccacagaga aaaccagcga gggctttgat aagatgtact atgactactt tccggatgcc 1800

gccaagatga tcccaaagtg cagcacccag ctgaaggcgg tgaccgccca ctttcagacc 1860

cacacaaccc ccatcctgct gtccaacaat ttcatcgagc ctctggagat cacaaaggag 1920

atctacgacc tgaacaatcc tgagaaggag ccaaagaagt ttcagacagc gtacgccaag 1980

aaaaccggcg accagaaggg ctacagagag gccctgtgca agtggatcga cttcacaagg 2040

gattttctgt ccaagtatac caagacaacc tctatcgatc tgtctagcct gcggccatcc 2100

tctcagtata aggacctggg cgagtactat gccgagctga atcccctgct gtaccacatc 2160

agcttccaga gaatcgccga gaaggagatc atggatgccg tggagacagg caagctgtac 2220

ctgttccaga tctataacaa ggactttgcc aagggccacc acggcaagcc taatctgcac 2280

acactgtatt ggaccggtct gttttctcca gagaacctgg ccaagacaag catcaagctg 2340

aatggccagg ccgagctgtt ctaccgccct aagtccagga tgaagaggat ggcacaccgg 2400

ctgggagaga agatgctgaa caagaagctg aaggatcaga aaaccccaat ccccgacacc 2460

ctgtaccagg agctgtacga ctatgtgaat cacagactgt cccacgacct gtctgatgag 2520

gccagggccc tgctgcccaa cgtgatcacc aaggaggtgt ctcacgagat catcaaggat 2580

aggcgcttta ccagcgacaa gttctttttc cacgtgccta tcacactgaa ctatcaggcc 2640

gccaattccc catctaagtt caaccagagg gtgaatgcct acctgaagga gcaccccgag 2700

acacctatca tcggcatcga tcggggcgag agaaacctga tctatatcac agtgatcgac 2760

tccaccggca agatcctgga gcagcggagc ctgaacacca tccagcagtt tgattaccag 2820

aagaagctgg acaacaggga gaaggagagg gtggcagcaa ggcaggcctg gtctgtggtg 2880

ggcacaatca aggatctgaa gcagggctat ctgagccagg tcatccacga gatcgtggac 2940

ctgatgatcc actaccaggc cgtggtggtg ctggagaacc tgaatttcgg ctttaagagc 3000

aagaggaccg gcatcgccga gaaggccgtg taccagcagt tcgagaagat gctgatcgat 3060

aagctgaatt gcctggtgct gaaggactat ccagcagaga aagtgggagg cgtgctgaac 3120

ccataccagc tgacagacca gttcacctcc tttgccaaga tgggcaccca gtctggcttc 3180

ctgttttacg tgcctgcccc atatacatct aagatcgatc ccctgaccgg cttcgtggac 3240

cccttcgtgt ggaaaaccat caagaatcac gagagccgca agcacttcct ggagggcttc 3300

gactttctgc actacgacgt gaaaaccggc gacttcatcc tgcactttaa gatgaacaga 3360

aatctgtcct tccagagggg cctgcccggc tttatgcctg catgggatat cgtgttcgag 3420

aagaacgaga cacagtttga cgccaagggc acccctttca tcgccggcaa gagaatcgtg 3480

ccagtgatcg agaatcacag attcaccggc agataccggg acctgtatcc tgccaacgag 3540

ctgatcgccc tgctggagga gaagggcatc gtgttcaggg atggctccaa catcctgcca 3600

aagctgctgg agaatgacga ttctcacgcc atcgacacca tggtggccct gatccgcagc 3660

gtgctgcaga tgcggaactc caatgccgcc acaggcgagg actatatcaa cagccccgtg 3720

cgcgatctga atggcgtgtg cttcgactcc cggtttcaga acccagagtg gcccatggac 3780

gccgatgcca atggcgccta ccacatcgcc ctgaagggcc agctgctgct gaatcacctg 3840

aaggagagca aggatctgaa gctgcagaac ggcatctcca atcaggactg gctggcctac 3900

atccaggagc tgcgcaac 3918

<210>73

<211>124

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>73

taatacgact cactatagat ttctactctt gtaggtcaca agaacttttg aactggccgg 60

ctggcctgga tttctactct tgtaggtcac aagaactttt ttcttctctt catccctgtc 120

aaaa 124

<210>74

<211>175

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>74

taatacgact cactatagat ttctactctt gtaggtcaca agaacttttg aactggccgg 60

ctggcctgga tttctactct tgtaggtcac aagaactttt ttcttctctt catccctgtc 120

atttctactc ttgtaggtca caagaacttt tcaaggatgc ttaccaccag gaaaa 175

Claims

1. A S-sgRNAs molecule for knocking out multiple immune checkpoint in immune cells, wherein the targeted knock-out includes multiple immune checkpoint including but not limited to PD-1, CT L A-4, TIM-3, L AG-3, PD-1, CT L A-4, TIM-3, L AG-3.

2. The S-sgRNAs used for knocking out multiple immune checkpoint in an immune cell according to claim 1, wherein the S-sgRNAs are formed by connecting sgRNAs targeting different genes in series, wherein different sgRNAs are separated by an xcrRNA which can be cleaved by a eukaryotic cell in an intracellular manner, and the xcrRNA sequences are as follows: 5 'AUUUCUACUCUUGUAG 3'; the sgRNA is selected from at least two groups of (A) - (D);

(A) sgRNA targeting PD 1:

1, 2, 3, 4, 5;

(B) sgRNA targeting CT L a-4:

(C) sgRNA targeting TIM-3:

one of SEQ ID NO 21, SEQ ID NO 22, SEQ ID NO 23, SEQ ID NO 24, SEQ ID NO 25, SEQ ID NO 26, SEQ ID NO 27, SEQ ID NO 28, SEQ ID NO 29, SEQ ID NO 30, SEQ ID NO 31, SEQ ID NO 32, SEQ ID NO 33, SEQ ID NO 34, SEQ ID NO 35, SEQ ID NO 36;

(D) sgRNA targeting L AG-3:

3. A vector comprising the S-sgRNAs molecule of claim 1 or 2, comprising (1) S-sgRNAs molecules simultaneously targeting two genes including PD1, CT L a-4, TIM-3, L AG-3, but not limited to PD1, CT L0A-4, TIM-3, L1 AG-3, (2) S-sgRNAs molecules simultaneously targeting three genes including PD1, CT L a-4, TIM-3, L AG-3, but not limited to PD1, CT L a-4, TIM-3, L AG-3, and (3) S-sgRNAs molecules simultaneously targeting four genes including PD1, CT L a-4, TIM-3, L AG-3, but not limited to PD1, CT L a-4, TIM-3, L AG-3.

4. An agent for simultaneous knock-out of multiple immune checkpoint in an immune cell, comprising the S-sgRNAs molecule of claim 1 or 2 or the vector of claim 3.

5. The reagent of claim 4, further comprising an AsCpf1 protein.

6. A kit comprising a first component which is the S-sgRNAs molecule of claim 1 or 2 or the vector of claim 3 and a second component which is the aspcf 1 protein, optionally in combination with the aspcf 1 protein of the second component;

the first component of the kit comprises the following contents:

7. A reaction mixture, comprising: (a) the S-sgRNAs molecule of claim 1 or 2, the vector of claim 3, the agent of claim 4 or 5, or the kit of claim 6, and (b) an immune cell.

8. Use of the S-sgRNAs molecule of claim 1 or 2, the vector of claim 3, the agent of claim 4 or 5, the kit of claim 6 for the preparation of a medicament for knocking out multiple immune checkpoint in an immune cell.

9. Use of the S-sgRNAs molecule of claim 1 or 2, the vector of claim 3, the reagent of claim 4 or 5, or the kit of claim 6 in the preparation of a medicament for immunotherapy of tumor.