CN111440793A

CN111440793A - Novel coronavirus nucleic acid detection kit

Info

Publication number: CN111440793A
Application number: CN202010202917.5A
Authority: CN
Inventors: 姚杰; 程诚; 王恩慧; 陈威巍; 许文; 杨俊连; 杨欣欣; 李胜
Original assignee: Wuhan Bojie Biomedical Science And Technology Co ltd; Zhongnan Hospital of Wuhan University; Fifth Medical Center of PLA General Hospital
Current assignee: Wuhan Bojie Biomedical Science And Technology Co ltd; Zhongnan Hospital of Wuhan University; Fifth Medical Center of PLA General Hospital
Priority date: 2020-03-20
Filing date: 2020-03-20
Publication date: 2020-07-24
Anticipated expiration: 2040-03-20
Also published as: CN111440793B

Abstract

The invention provides a novel coronavirus nucleic acid detection kit, which comprises two pieces of crDNA or two pieces of crRNA. The crDNA includes: crDNA targeting E gene: the sequence is shown in any one of SEQ ID NO. 3-5; crDNA targeting N gene: the sequence of the polypeptide is shown in any one of SEQ ID NO. 6-8. The crRNA includes: crRNA targeting E gene: the sequence is shown in any one of SEQ ID NO. 9-11; crRNA targeting N gene: the sequence of the polypeptide is shown in any one of SEQ ID NO. 12-14. The invention designs crRNA related to novel coronavirus E gene and N gene, and combines a CRISPR-cpf1 system to carry out screening detection, and the method has the characteristics of simplicity, high speed, high sensitivity, strong specificity and strong practicability.

Description

Novel coronavirus nucleic acid detection kit

Technical Field

The invention relates to the technical field of biological detection, in particular to a novel coronavirus nucleic acid detection kit.

Background

The modern molecular biology diagnosis method has good specificity and high sensitivity, and the prior market mostly adopts a detection kit of an RT-PCR method, the novel coronavirus is used as a newly discovered virus, is suitable for spring transportation, peak of human flow and high transmission speed, and the conventional virus separation method and the immunology method have a time-consuming preparation period of specific antibodies, so that the detection method can not meet the detection requirements of a plurality of clinical suspected patients.

Disclosure of Invention

The invention aims to overcome the defects of the prior art and provides a novel coronavirus nucleic acid detection kit which is strong in specificity and high in sensitivity, and the lowest detection limit reaches 10 copies/u L.

The invention is realized by the following steps:

one of the objects of the present invention is to provide a crDNA for detecting a novel coronavirus, the crDNA comprising:

crDNA targeting E gene: the sequence is shown in any one of SEQ ID NO. 3-5;

crDNA targeting N gene: the sequence of the polypeptide is shown in any one of SEQ ID NO. 6-8.

It is another object of the present invention to provide a crRNA for detecting a novel coronavirus, the crRNA comprising:

crRNA targeting E gene: the sequence is shown in any one of SEQ ID NO. 9-11;

crRNA targeting N gene: the sequence of the polypeptide is shown in any one of SEQ ID NO. 12-14.

The invention also aims to provide a novel coronavirus nucleic acid detection kit, which contains the crDNA or the crRNA.

Preferably, the kit further comprises cpf1 protein and a fluorescent probe.

The fluorescent probe is selected from one of the following probes:

fluorescent probe 1: the sequence is shown in SEQ ID NO. 15;

and (3) fluorescent probe 2: the sequence is shown as SEQ ID NO. 16;

fluorescent probe 3: the sequence is shown in SEQ ID NO. 17;

preferably, the kit further comprises a dnase inhibitor.

The use method of the novel coronavirus nucleic acid detection kit comprises the following steps:

s1, the required sample is virus RNA, and the required DNA amplification product is obtained by RT isothermal amplification system amplification;

s2, detecting the detection system consisting of the amplification product, crRNA, cpf1 protein, the fluorescent probe shown in any one of SEQ ID NO.26-28 and enzyme-free water.

The kit is a liquid kit, and a fluorescence value is measured by a fluorescence detector or a fluorescence spectrophotometer after the detection system is incubated, specifically, a fluorescence detector is added into cpf1/crRNA complex solution, a fluorescent probe is added into the solution, and the fluorescence value is measured by the fluorescence detector after the incubation without enzyme water, when a fluorescence detection machine is adopted, 5 'ends of fluorescent probe sequences are all marked with fluorescent groups, 3' ends of the fluorescent probe sequences are all marked with quenching groups, the fluorescent groups comprise one of FAM, VIC, HEX, TRT, Cy3, Cy5, ROX, JOE and Texas Red, and the quenching groups comprise one of TAMRA, DABCY L, MGB, BHQ-1, BHQ-2 and BHQ-3.

As one of the above embodiments, the detection kit is a colloidal gold detection kit; the colloidal gold detection kit comprises the detection reagent and a colloidal gold carrier, wherein the colloidal gold carrier comprises a bottom plate, and a sample pad, a combination pad, a chromatography matrix and a water absorption pad which are adhered to the bottom plate and are sequentially overlapped; the binding pad is coated with a colloidal gold compound coated by a monoclonal antibody; a quality control line is arranged on one side, close to the combination pad, of the chromatography matrix, and a detection line is arranged on one side, close to the water absorption pad, of the chromatography matrix; the quality control line is coated with streptavidin; the detection control line is coated with a capture antibody. When the colloidal gold kit is used for detection, the 5 'end or the 3' end of the sequence of the fluorescent probe is marked with a fluorescent group, and the 3 'end or the 5' end is marked with biotin. Specifically, biotin is marked at the 3 'end of the sequence of the fluorescent probe, and one of FAM, VIC, HEX, TRT, Cy3, Cy5, ROX, JOE and Texas Red is marked at the 5' end.

When the colloidal gold detection kit is used, the amplification product and cpf1 protein/crRNA compound solution are added into a fluorescent probe and incubated in enzyme-free water, and then added into a sample detection area of a colloidal gold test strip. Dropwise adding the detection system on a sample pad in the kit, and observing a quality control band and a detection band; if a macroscopic colored line is formed on the detection belt, judging the detection belt to be positive; otherwise, the result is negative.

The colloidal gold detection kit integrates a detection reagent (CRISPR/Cpf1 detection system) consisting of crRNA for detecting the novel coronavirus and RPA isothermal amplification into one step, presents a detection result in the form of a colloidal gold test strip, is simple and convenient to operate, short in time, free of instruments and capable of carrying out isothermal reaction, and has a strong application range and place and strong practicability.

Compared with the prior art, the invention has the following advantages and effects:

the crRNA and the kit for detecting the novel coronavirus, provided by the invention, are used for designing the crRNA related to the novel coronavirus Egene and N gene, and a method for detecting by combining the crRNA with a CRISPR-cpf1 system has the advantages of low cost, repeated detection for many times, simplicity, high detection speed, sensitivity (the lowest detection limit reaches 10 copies/u L), specificity and capability of detecting whether corresponding target nucleic acid is contained or not through the change of a fluorescence signal in a short time:

(1) in the detection of the novel coronavirus E gene, the fluorescence signal of a positive sample is obviously higher than that of a negative sample when the reaction is carried out for 20-30 minutes, and the sensitivity can reach 10 copies/u L.

(2) In the detection of the novel coronavirus N gene, the fluorescence signal of a positive sample is obviously higher than that of a negative sample when the reaction is carried out for 20-30 minutes, and the sensitivity can reach 10 copies/u L.

The crRNA and the kit for detecting the novel coronavirus provided by the invention can detect whether the CRRNA and the kit contain corresponding target nucleic acid or not through a chromogenic reaction in a short time:

(1) in the detection of the novel coronavirus E gene, a detection system is added for 3-5min, and a positive sample and a negative sample can be distinguished through the existence of the detection line, wherein the sensitivity can reach 10 copies/u L.

(2) In the detection of the novel coronavirus N gene, a detection system is added for 3-5min, and a positive sample and a negative sample can be distinguished through the existence of the detection line, wherein the sensitivity can reach 10 copies/u L.

Drawings

FIG. 1 shows the specific detection result of the liquid detection kit provided in example 2 of the present invention on the novel coronavirus E gene;

FIG. 2 shows the specific detection result of the liquid detection kit provided in example 2 of the present invention on the novel coronavirus N gene;

FIG. 3 is a graph showing the results of the sensitivity test of the liquid detection kit provided in example 2 of the present invention on the novel coronavirus E gene;

FIG. 4 shows the result of the sensitivity detection of the liquid detection kit provided in example 2 of the present invention on the novel coronavirus N gene;

FIG. 5 is a schematic view of a detection paper structure in the colloidal gold detection kit provided in example 3 of the present invention; in the figure: 1. a base plate; 2. a sample pad; 3. a bonding pad; 4. a nitrocellulose membrane; 5. a quality control line; 6. detecting lines; 7. a water absorbent pad;

FIG. 6 shows the specific detection result of the colloidal gold detection kit provided in example 3 of the present invention on the novel coronavirus E gene;

FIG. 7 shows the specific detection result of the colloidal gold detection kit provided in example 3 of the present invention on the novel coronavirus N gene;

FIG. 8 shows the result of the detection of the sensitivity of the colloidal gold assay kit provided in example 3 of the present invention on the novel coronavirus E gene;

FIG. 9 shows the result of the detection of the sensitivity of the colloidal gold assay kit provided in example 3 of the present invention on the novel coronavirus N gene.

Detailed Description

Example 1 design and acquisition of Targeted Virus-specific site crRNA

1. Discovery of novel coronavirus detection site based on CRISPR-cpf1 system

We obtained novel coronavirus specific regions according to the latest RT-PCR guide issued by CDC. crRNA was designed for these different regions and the CRISPR/cpf1 system was constructed for study. The result shows that the region sequence shown in SEQ ID NO.1-2 is the detection region based on the CRISPR/cpf1 system, and has good detection effect.

TABLE 1

2. Design of targeting specific region crRNA

(1) Targeting specific region crRNA design principle

Since the CRISPR-cpf1 system is a novel targeted DNA gene editing system in which cpf1 binds to crRNA to form a monitoring complex, the guide region of the crRNA recognizes the target DNA with complementary sequences, and cpf1 degrades the target DNA strand, the crRNA design requires: the crRNA includes a protein anchor sequence and a guide sequence in the sequence format: 5 '-anchor sequence binding to cpf1 protein-crRNA guide sequence-3', protein anchor sequence needs to be determined according to cpf1 protein, so that it can match and bind to selected cpf1 protein; the guide sequence is matched to a fragment in the targeting DNA. The crRNA guide sequence cannot be too close to the initiation codon (ATG); the length is 22-24 nucleotides.

2. Selection of crDNA sequences

The anchor sequence TAATTTCTACTCTTGTAGAT that binds to cpf1 protein; the crRNA guide sequence is designed according to a mutation site region in a sequence shown by SEQ ID NO. 1-2; finally, 2 regions of crDNA fragments were obtained as shown below. crDNA targeting E gene: the sequence is shown in any one of SEQ ID NO. 3-5; crDNA targeting N gene: the sequence of the polypeptide is shown in any one of SEQ ID NO. 6-8.

TABLE 2

3. Obtaining crRNA

The obtained 2 regions of the crDNA fragments were each subjected to T7 RNA polymerase (transcription reaction system shown in Table 3) to generate RNA, which was recovered and purified to obtain crRNA.

TABLE 3

The resulting crRNA includes: crRNA targeting E gene: the sequence is shown in any one of SEQ ID NO. 9-11; crRNA targeting N gene: the sequence of the polypeptide is shown in any one of SEQ ID NO. 12-14.

TABLE 4

Example 2 novel coronavirus fluorescent detection kit and detection method

1. Composition of the kit

(A)2 pieces of crRNA (the sequence of the CRRNA targeting the E gene is shown in any one of SEQ ID NO. 9-11; the sequence of the crRNA targeting the Ngene is shown in any one of SEQ ID NO. 12-14) or 2 pieces of crDNA (the sequence of the crDNA targeting the E gene is shown in any one of SEQ ID NO. 3-5; the sequence of the crDNA targeting the N gene is shown in any one of SEQ ID NO. 6-8; when the crDNA is contained in the kit, an operator needs to firstly generate RNA by the action of T7 RNA polymerase on a crDNA fragment, and the crRNA is obtained by recovery and purification);

(B) a specific fluorescent probe (the sequence is shown in Table 3, and any one probe shown as SEQ ID NO.15-17 is shown in the sequence, the 5 'end of the sequence of the fluorescent probe is marked with a fluorescent group, the 3' end of the sequence of the fluorescent probe is marked with a quenching group, wherein the fluorescent group comprises one of FAM, VIC, HEX, TRT, Cy3, Cy5, ROX, JOE and Texas Red, and the quenching group comprises one of TAMRA, DABCY L, MGB, BHQ-1, BHQ-2 and BHQ-3);

TABLE 5

Fluorescent probe	Sequence (5 '-3')
		Probe 1	HEX- (CH2)6-CTCACTACAGACGCACGCTA-BHQ1 (shown as SEQ ID NO. 15)
Probe 2	HEX-CTCACTACAGACGCACGCTA-BHQ1 (shown as SEQ ID NO. 16)
		Probe 3	HEX-CACATCAGCAGCCTACAGCA-BHQ1 (shown as SEQ ID NO. 17)

(C) cpf1 protein, enzyme free water, dnase inhibitors;

preferably, the kit may further comprise:

(D) an amplification system: comprises an isothermal amplification primer pair, wherein the sequence of the isothermal amplification primer pair of the E gene is shown as SEQ ID NO. 18-20; the sequence of the isothermal amplification primer pair of the N gene is shown in SEQ ID NO. 21-23; the amplification system also includes reverse transcriptase (single-stranded to double-stranded), recombinase, DNA polymerase, ssDNA binding protein, and the like. The RPA primer of the amplification system is designed by the inventor and synthesized by a foundry company; other components required by the amplification system adopt a purchased reverse transcription isothermal amplification kit

Basic; TABAS03 KIT. In order to reverse transcribe viral RNA prior to RPA isothermal amplification, the amplification system further comprises RT reverse transcriptase.

TABLE 6

Primer and method for producing the same	Sequence (5 '-3')
		F1-E	CGACTACTAGCGTGCCTTTGTAAGCACAAGC(SEQ ID NO.18)
R1-E	ATATTTAGTTCGTTTAGACCAGAAGATCAGG (shown in SEQ ID NO. 19)
		R2-E	AGTTCGTTTAGACCAGAAGATCAGGAACTCT (shown as SEQ ID NO. 20)
F1-N	CGGCAGTCAAGCCTCTTCTCGTTCCTCATC (shown as SEQ ID NO. 21)
		R1-N	GCCTCAGCAGCAGATTTCTTAGTGACAGTTT (shown in SEQ ID NO. 22)
R2-N	CCTCAGCAGCAGATTTCTTAGTGACAGTTTGG (shown in SEQ ID NO. 23)

2. Method for detecting novel coronavirus

The viral nucleic acid in the sample is extracted as RNA of the sample by the existing technology or product.

(1) 50-100ng of RNA of a sample to be detected is added into a reverse transcription isothermal amplification system. The amplification system is shown in Table 7;

TABLE 7

(2) Mixing the obtained amplification product with the detection reagent: crRNA, cpf1 protein, fluorescent probe, and enzyme-free water were made into detection systems, as shown in table 8.

TABLE 8

(3) And (3) incubating the detection system, and then measuring the fluorescence value by using a fluorescence detector. And (5) after the reaction is finished, counting and analyzing the change condition of the fluorescence value. The fluorescence value of the sample to be tested increased over time compared to the blank control group, indicating the presence of new coronavirus.

Example 3 colloidal gold assay kit and assay method for novel coronavirus

1. Composition of the kit

(1) The detection reagent is the same as the detection reagent in the embodiment 2, except that the specific fluorescent probe in the embodiment is any one probe shown in SEQ ID NO.15-17, the 3 'end of the sequence is marked with biotin, and the 5' end of the sequence is marked with one of FAM, VIC, HEX, TRT, Cy3, Cy5, ROX, JOE and Texas Red; in this example, FAM was labeled at the 5' end.

(2) When the detection kit is prepared into a colloidal gold detection kit, as shown in fig. 5, the colloidal gold detection kit comprises a bottom plate 1, a sample pad 2, a combination pad 3, a nitrocellulose membrane 4 and a water absorption pad 7 which are adhered to the bottom plate 1 and are sequentially lapped; a quality control line 5 is arranged on one side, close to the combination pad 3, of the nitrocellulose membrane 4, and a detection line 6 is arranged on one side, close to the water absorption pad 7, of the nitrocellulose membrane 4; the binding pad 3 is coated with colloidal gold coated with the cy5 monoclonal antibody; the quality control line 5 is coated with streptavidin; and the detection control line 6 is coated with a mouse antibody. The bottom plate 1 is a PVC plate; the sample pad is a nitrocellulose membrane; the material of the bonding pad is a glass cellulose membrane; the absorbent pad 7 is absorbent filter paper. The detection test paper is packaged by a hard plastic card.

2. Preparation method of colloidal gold detection kit

(1) Preparing colloidal gold solution with proper particle size

(2) Coating colloidal gold by using a rabbit anti-Cy 5 monoclonal antibody to obtain a coated colloidal gold solution;

(3) spraying the coated colloidal gold solution on the bonding pad, and drying for later use;

(4) spraying a mouse-resistant solution on the detection line position on the nitrocellulose membrane; spraying a streptavidin solution at the position of the quality control line, and drying for later use;

(5) and sequentially overlapping and adhering the sample pad, the combination pad, the nitrocellulose membrane and the water absorption pad on the base plate, cutting the sample pad, the combination pad, the nitrocellulose membrane and the water absorption pad into a detection test strip, and packaging the detection test strip by using a rigid plastic card.

Preferably, the diameter of the colloidal gold is 13-40nm, a plurality of influence factors of the synthesis of the colloidal gold are provided, the operation is ensured to be consistent as much as possible in each synthesis, the difference between batches of the synthesized colloidal gold is reduced, in addition, the color and full spectrum scanning comparison are carried out on the colloidal gold synthesized each time, the size of the synthesized colloidal gold nano-particles can be roughly judged, 1% (m/v) chloroauric acid is prepared and stored in a brown reagent bottle for 4 refrigerators for standby, 1m L1% (m/v) chloroauric acid solution and 99m L ultrapure water are taken, the volume is fixed in a brown 100m L volumetric flask and uniformly mixed, the mixed solution is added into a preheated and dried 250m L conical flask and heated to boiling for 15min, a reducing agent 1% (m/v) sodium citrate is rapidly added, 2.75m L is added, the process of adding the reducing agent is rapid and continuous, the boiling is heated for about 5min continuously, the solution is cooled to room temperature, the solution is firstly changed into gray and then rapidly changed into black, and is changed into wine red in order to reduce evaporation, when the stable wine is changed into 5min, the boiling and the.

Preferably, the first and second electrodes are formed of a metal,coating colloidal gold with FAM monoclonal antibody, placing 20m L prepared colloidal gold solution in 50m L conical flask, adjusting the highest absorption value of colloidal gold to about 0.4-0.6, adding 480 μ L2% K2CO3 to adjust pH, adding 1.2m L to dilute to 1mg/m L SPA, and continuously stirring at room temperature for 30min (when labeling antibody, adding 960 μ L2% K₂CO₃Adjusting pH, adding 1.8 m L of a mouse anti-cy 5 antibody, dropwise adding 1.6m L of prepared 10% (m/v) BSA, continuously stirring at room temperature for 30min, dropwise adding 10% (m/v) PEG-40001.6 m L, continuously stirring at room temperature for 30min, subpackaging, centrifuging at 12000 r/min 4 ℃ for 30min, carefully removing supernatant, washing twice with 10 mmol/L pH 8.0 Tris-Base buffer solution, washing off unlabeled protein, finally centrifuging at low speed of 1000 r/min for 30min, removing large precipitated colloidal gold particles, then using 2m L10 mmol/L pH 8.0 Tris-Base buffer solution, and placing in a refrigerator at 4 ℃ for storage, if long-term storage is required, adding 0.05% sodium azide and 1% BSA as protective stabilizers, measuring absorption spectrum of the labeled immune colloidal gold, and judging the absorption quality of the immune colloidal gold.

Preferably, the immune colloidal gold combined pad has the adsorption capacity of 54 mu L/cm²The glass fiber membrane is treated by TBST containing 1% BSA with 0.01 mol/L pH 8.0 for half an hour, the surface of an activating material is enabled to release colloidal gold more easily, after being dried in an incubator at 37 ℃, the treated glass fiber membrane is cut into the size of 0.5cm × 6cm, each glass fiber membrane is sucked by a 200 mu L pipette to 150 mu L immune labeled colloidal gold and is evenly smeared, the glass fiber membrane is placed in the incubator at 37 ℃ and the humidity of about 40% for 2 hours to be dried, and test strips are required to be placed in aluminum foil bags filled with drying agents for sealed storage if the test strips are not assembled immediately after being dried.

The test selects the climbing speed of 50-225s, the specification of which is 2.5cm × 50m Pall viid 170, and the nitrocellulose membrane is the most commonly used nitrocellulose membrane, the pore diameter of which is 8 microns, and the spraying film amount of which is 0.6 microns L-0.8 microns L, so that the spraying film amount of a T line (streptavidin) and a C line (mouse antibody) is determined to be 0.8 microns L, the concentration of the streptavidin at the T line is set to be 2mg/m L, the concentration of the mouse antibody at the C line is set to be 2mg/m L, the nitrocellulose membrane is placed in a clean sealing bag to be dried at 37 ℃ for 30min, and then is sealed after being added with a drying agent, and the nitrocellulose membrane is stored at room temperature for later use.

Preferably, to make the sample more releasable and reduce nonspecific adsorption of immune reactions, the sample pad is treated with 0.01 mol/L pH 8.0 TBST containing 1% BSA for half an hour, dried in an incubator at 37 ℃ and cut into 2.1cm strips of × 30cm, placed in a clean sealed bag, and the absorbent pad is cut into 1.6cm strips of × 30cm, placed in a clean sealed bag.

3. Method of using kit

The detection system is prepared in the same way as in example 2, the detection system is evenly mixed and incubated at 37 ℃ for 30-90 min, and meanwhile, a negative control group is set. Incubating the detection system and then adding the incubated detection system into a colloidal gold test strip sample detection area for detection; the judgment rule is as follows:

A. when the detection area is colored and the quality control area is also colored, the detection result of the sample to be detected is positive;

B. when the detection area does not develop color and the quality control area develops color, the detection result of the sample to be detected is negative;

C. when the quality control area does not develop color, the test strip is ineffective, and a new test strip is needed for re-determination.

Specifically, the principle of the detection of the colloid detection kit is as follows: as shown in fig. 5, a sample to be tested is added into the sample application hole, and the sample to be tested is chromatographed along the sample pad, the bonding pad and the nitrocellulose membrane towards the end of the absorbent filter paper under the capillary action; during detection, if a sample to be detected contains the novel coronavirus as a detection object, the gold-labeled antibody on the binding pad is redissolved, the redissolved mixture is continuously chromatographed on the nitrocellulose membrane, biotin is captured by streptavidin on the quality control line, so that red for marking colloidal gold appears at the position of the detection line, the marked gold particles and FAM continue to move forwards, and when the marked gold particles reach the area of the detection line, the marked gold particles are combined with the capture antibody coated on the marked gold particles to show a red line of the colloidal gold, and the red line is used as the detection line; during detection, if the object to be detected does not contain the novel coronavirus, the sample is firstly combined with the gold-labeled antibody on the combination pad and redissolved, the redissolved mixture is continuously chromatographed on the nitrocellulose membrane and captured by streptavidin on the quality control line, the biotin-FAM report probe is simultaneously intercepted, the labeled gold particles are continuously moved forward, and when reaching the detection line area, the labeled gold particles cannot be combined with the capture antibody coated on the labeled gold particles, and the red line of the colloidal gold cannot be displayed, so that the detection line is formed.

Test example 1 Performance of the fluorescent detection kit for the novel coronavirus of example 2

Specific detection of crRNA

Plasmids carrying the E gene and N gene sequences of the novel coronavirus were prepared and their specificity was examined using the 2-region targeted crRNA described above, respectively. The effectiveness of in vitro cutting of the crRNA prepared in example 2 is verified in a CRISPR-cpf1 system.

The reaction mixture was incubated with 1-2.5uM purified cpf1, 2.5-5uM crRNA, 1-5. mu.l of synthetic fluorescent probe, 2. mu. L DNase inhibitor, target plasmid DNA at different dilution concentrations for 1-2 hours at 37 ℃ in assay buffer (NEBuffer 3), while negative controls were established with the idling plasmid, several sets of reaction mixtures were reacted simultaneously in a portable detector (temperature set at 37 ℃ C., kinetic detection was performed every 10min for 1 hour), and the change in the fluorescence signal of the system was detected using a quantitative fluorescence PCR instrument.

(1) Specific detection of E genes

We tested the effect of crRNA targeting E gene on target and idle plasmids, and FIG. 1 shows the fluorescence results. The result shows that after the target plasmid and the template of the idle plasmid are added, the idle plasmid has no obvious trend of change, and the fluorescence value of the target plasmid is continuously increased along with the time.

2. Specific detection of N genes

We tested the effect of crRNA targeting N gene on target and idle plasmids, and FIG. 2 shows the fluorescence results. The result shows that after the target plasmid and the template of the idle plasmid are added, the idle plasmid has no obvious trend of change, and the fluorescence value of the target plasmid is continuously increased along with the time.

In conclusion, the results all show that the trend of the change of the fluorescence value of the system for detecting the target DNA by the target crRNA is obviously higher than that of the negative control. It is shown that 2 crRNAs for detecting the novel coronavirus can specifically detect corresponding specific regions respectively.

Sensitivity test of crRNA

To determine the minimum detectable amount of the present method, the synthetic plasmid standards were diluted to 10⁵、10³、10²、 10¹Copying/mu L and other 4 concentration gradients, and then using the concentration gradients as a template to detect, wherein the results are shown in FIGS. 3 and 4.

Test example 2 Performance of the novel coronavirus colloidal gold assay kit of example 3

First, specificity detection

Plasmids carrying the Egene and Ngene sequences of the novel coronavirus were prepared and their specificity was examined using the 2-region targeted crRNA described above, respectively. The effectiveness of in vitro cutting of the crRNA prepared in example 3 is verified in a CRISPR-cpf1 system.

1-2.5uM of purified cpf1, 2.5-5uM of crRNA, 1-5 ul of synthesized fluorescent probe, 2 u L of DNase inhibitor and target plasmid DNA with different dilution concentrations are used for incubation for 1-3 hours at 37 ℃ in a detection buffer (NEBuffer 3), meanwhile, an idle plasmid is used for setting up a negative control and a blank control, the blank control is a signal group without crRNA and cpf1 corresponding to each experimental group, and a plurality of groups of reaction mixtures are simultaneously detected in a colloidal gold test strip respectively.

1. Specific detection of E genes

We tested the effect of crRNA targeting E gene on target and idle plasmids, and FIG. 6 shows the results of colloidal gold. The results show that the blank has no bands at the detection line position; after addition of the target plasmid, the line positions were detected to show bands.

2. Specific detection of N genes

We tested the effect of crRNA targeting N gene on target and idle plasmids, and FIG. 7 shows the results of colloidal gold. The results show that the blank has no bands at the detection line position; after addition of the target plasmid, the line positions were detected to show bands.

In conclusion, the results show that the system for detecting the target DNA by the target crRNA has a band display. It is shown that 2 crRNAs for detecting the novel coronavirus can specifically detect corresponding specific regions respectively.

Second, sensitivity test

To determine the minimum detectable amount of the present method, the synthetic plasmid standards were diluted to 10⁷、10⁶、10⁵、 10⁴、10³、10²、10¹The results are shown in FIGS. 8 and 9, and it can be seen from the results of FIGS. 8 and 9 that the present invention has a wide detection range with a minimum detection limit of 10¹Copy/. mu. L.

The invention is not to be considered as limited to the particular embodiments shown, but is to be accorded the widest scope consistent with the principles and novel features herein disclosed.

Sequence listing

<110> Wuhan Bojie biomedical science and technology Limited, fifth medical center of general Hospital of Ji Min, Central and south Hospital of Wuhan university

<120> a novel coronavirus nucleic acid detection kit

<160>23

<170>SIPOSequenceListing 1.0

<210>1

<211>300

<212>DNA

<213> novel coronavirus (COVID-19)

<400>1

acgacgacta ctagcgtgcc tttgtaagca caagctgatg agtacgaact tatgtactca 60

ttcgtttcgg aagagacagg tacgttaata gttaatagcg tacttctttt tcttgctttc 120

gtggtattct tgctagttac actagccatc cttactgcgc ttcgattgtg tgcgtactgc 180

tgcaatattg ttaacgtgag tcttgtaaaa ccttcttttt acgtttactc tcgtgttaaa 240

aatctgaatt cttctagagt tcctgatctt ctggtctaaa cgaactaaat attatattag 300

<210>2

<211>300

<212>DNA

<213> novel coronavirus (COVID-19)

<400>2

gccaaaaggc ttctacgcag aagggagcag aggcggcagt caagcctctt ctcgttcctc 60

atcacgtagt cgcaacagtt caagaaattc aactccaggc agcagtaggg gaacttctcc 120

tgctagaatg gctggcaatg gcggtgatgc tgctcttgct ttgctgctgc ttgacagatt 180

gaaccagctt gagagcaaaa tgtctggtaa aggccaacaa caacaaggcc aaactgtcac 240

taagaaatct gctgctgagg cttctaagaa gcctcggcaa aaacgtactg ccactaaagc 300

<210>3

<211>69

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>3

gcttcgattg tgtgcgtact gctgatctac aagagtagaa attaccctat agtgagtcgt 60

attaatttc 69

<210>4

<211>68

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>4

cttcgattgt gtgcgtactg ctgatctaca agagtagaaa ttaccctata gtgagtcgta 60

ttaatttc 68

<210>5

<211>66

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>5

tcgattgtgt gcgtactgct gatctacaag agtagaaatt accctatagt gagtcgtatt 60

aatttc 66

<210>6

<211>69

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>6

tgctttgctg ctgcttgaca gattatctac aagagtagaa attaccctat agtgagtcgt 60

attaatttc 69

<210>7

<211>68

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>7

gctttgctgc tgcttgacag attatctaca agagtagaaa ttaccctata gtgagtcgta 60

ttaatttc 68

<210>8

<211>66

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>8

tttgctgctg cttgacagat tatctacaag agtagaaatt accctatagt gagtcgtatt 60

aatttc 66

<210>9

<211>44

<212>RNA

<213> Artificial Sequence (Artificial Sequence)

<400>9

uaauuucuac ucuuguagau cagcaguacg cacacaaucg aagc 44

<210>10

<211>43

<212>RNA

<213> Artificial Sequence (Artificial Sequence)

<400>10

uaauuucuac ucuuguagau cagcaguacg cacacaaucg aag 43

<210>11

<211>41

<212>RNA

<213> Artificial Sequence (Artificial Sequence)

<400>11

uaauuucuac ucuuguagau cagcaguacg cacacaaucg a 41

<210>12

<211>44

<212>RNA

<213> Artificial Sequence (Artificial Sequence)

<400>12

uaauuucuac ucuuguagau aaucugucaa gcagcagcaa agca 44

<210>13

<211>43

<212>RNA

<213> Artificial Sequence (Artificial Sequence)

<400>13

uaauuucuac ucuuguagau aaucugucaa gcagcagcaa agc 43

<210>14

<211>41

<212>RNA

<213> Artificial Sequence (Artificial Sequence)

<400>14

uaauuucuac ucuuguagau aaucugucaa gcagcagcaa a 41

<210>15

<211>20

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>15

ctcactacag acgcacgcta 20

<210>16

<211>20

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>16

ctcactacag acgcacgcta 20

<210>17

<211>20

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>17

cacatcagca gcctacagca 20

<210>18

<211>31

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>18

cgactactag cgtgcctttg taagcacaag c 31

<210>19

<211>31

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>19

atatttagtt cgtttagacc agaagatcag g 31

<210>20

<211>31

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>20

agttcgttta gaccagaaga tcaggaactc t 31

<210>21

<211>30

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>21

cggcagtcaa gcctcttctc gttcctcatc 30

<210>22

<211>31

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>22

gcctcagcag cagatttctt agtgacagtt t 31

<210>23

<211>32

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>23

cctcagcagc agatttctta gtgacagttt gg 32

Claims

1. A crDNA for detecting a novel coronavirus, wherein the crDNA comprises:

crDNA targeting E gene: the sequence is shown in any one of SEQ ID NO. 3-5;

2. A crRNA for detecting a novel coronavirus, the crRNA comprising:

crRNA targeting E gene: the sequence is shown in any one of SEQ ID NO. 9-11;

3. A novel coronavirus nucleic acid detection kit comprising the crDNA according to claim 1 or the crRNA according to claim 2.

4. The test kit of claim 3, further comprising cpf1 protein and a fluorescent probe.

5. The test kit of claim 4, wherein the fluorescent probe is selected from one of the following probes:

fluorescent probe 1: the sequence is shown as SEQ ID NO. 26;

and (3) fluorescent probe 2: the sequence is shown as SEQ ID NO. 27;

fluorescent probe 3: the sequence is shown in SEQ ID NO. 28.

6. The detection kit of claim 4, wherein the fluorescent probe has a sequence with a fluorophore labeled at the 5 'end and a quencher labeled at the 3' end, wherein the fluorophore comprises one of FAM, VIC, HEX, TRT, Cy3, Cy5, ROX, JOE and Texas Red, and the quencher comprises one of TAMRA, DABCY L, MGB, BHQ-1, BHQ-2 and BHQ-3;

or biotin is labeled at the 3 'end of the sequence of the fluorescent probe, and one of FAM, VIC, HEX, TRT, Cy3, Cy5, ROX, JOE and Texas Red is labeled at the 5' end.

7. The test kit of claim 3, wherein the kit further comprises a DNase inhibitor.

8. The detection kit according to any one of claims 3 to 7, wherein the detection kit is a colloidal gold detection kit; the colloidal gold detection kit comprises the detection reagent according to any one of claims 3 to 7 and a colloidal gold carrier, wherein the colloidal gold carrier comprises a bottom plate, and a sample pad, a binding pad, a chromatography matrix and a water absorption pad which are adhered to the bottom plate and are sequentially overlapped; the binding pad is coated with a colloidal gold compound coated by a monoclonal antibody; a quality control line is arranged on one side, close to the combination pad, of the chromatography matrix, and a detection line is arranged on one side, close to the water absorption pad, of the chromatography matrix; the quality control line is coated with streptavidin; the detection control line is coated with a capture antibody.

9. The test kit of any one of claims 3-7, wherein the test kit is a fluorescent test kit.

10. Use of the crDNA of claim 1, the crRNA of claim 2, and the kit of any one of claims 3 to 9 for detecting a novel coronavirus.