CN111420048B

CN111420048B - Application of anti-BASIGAN humanized antibody in preparation of medicine for treating novel coronavirus pneumonia

Info

Publication number: CN111420048B
Application number: CN202010166717.9A
Authority: CN
Inventors: 陈志南; 朱平; 边惠洁; 张征; 尉丁; 杨向民
Original assignee: Fourth Military Medical University FMMU
Current assignee: Fourth Military Medical University FMMU
Priority date: 2020-03-11
Filing date: 2020-03-11
Publication date: 2023-09-19
Anticipated expiration: 2040-03-11
Also published as: CN111420048A; WO2021180110A1

Abstract

The invention discloses application of an anti-human BASIGN humanized antibody in preparing a medicament for treating novel coronavirus pneumonia, wherein the amino acid sequence of a light chain variable region of the anti-human BASIGN humanized antibody is shown as SEQ ID NO. 1, and the amino acid sequence of a heavy chain is shown as SEQ ID NO. 3; the nucleotide sequence of the light chain variable region is shown as SEQ ID NO. 2, and the nucleotide sequence of the heavy chain variable region is shown as SEQ ID NO. 4; the antibody can specifically recognize and bind to a virus invasion host epithelial cell co-receptor CD147, block interaction of CD147 and a novel coronavirus S protein and interaction of CD147 and cyclophilin A (CyPA), and further inhibit infection of host cells by the novel coronavirus.

Description

Application of anti-BASIGAN humanized antibody in preparation of medicine for treating novel coronavirus pneumonia

Technical Field

The invention belongs to the technical field of treatment of viral pneumonia by using novel antibody medicines, and particularly relates to application of an anti-BASIGIN humanized antibody in preparation of a medicine for treating novel coronavirus (COVID-19) pneumonia.

Background

Coronaviruses are a single-stranded positive strand RNA virus which can infect humans and various vertebrates, are important pathogens causing common cold and upper respiratory tract infection of humans, and seriously threaten human health. The novel coronavirus (COVID-19) which is popular in the end of 2019 has the characteristics of quick transmission, heavy epidemic situation and quick progress. Resulting in progressive dysfunction of respiratory function and causing death in some patients. At present, 2019-nCoV is mainly treated by supporting symptomatic treatment and antiviral treatment, and lacks specific medicines, so that development of new prevention and treatment medicines is urgently needed.

Coronaviruses (CoVs) belong to the family Coronaviridae (Coronaviridae), which include the following 4 genera: alpha Coronavirus (α -CoV), beta Coronavir (β -CoV), gamma Coronavirus (γ -CoV), delta Coronavirus (δ -CoV). Six types of human coronaviruses are known to date. Two coronaviruses have high infection rate and high death rate, namely, severe acute respiratory syndrome coronavirus (SARS-CoV) and middle east respiratory syndrome coronavirus (MERS-CoV) which respectively cause SARS in Guangdong province and MERS in Saint in 2003 and belong to beta coronavirus. MERS symptoms typically include fever, cough and shortness of breath, even developing pneumonia, with a mortality rate of about 34.4%. SARS symptoms typically include fever, chills and body pain, even developing pneumonia, with a mortality rate of about 9.6%.

The new coronavirus pneumonia, abbreviated as "new coronavirus pneumonia", is pneumonia caused by new coronavirus (covd-19) infection. By analyzing the gene sequence (WH-human_1, 30,473 bp), it was possible to determine that the novel coronavirus was 80% or less similar to the SARS whole genome (GenBank: AY274119.3,29,751 bp), but that the similarity of the different gene segments was 60-90% respectively. The virus was isolated from a patient sample of a novel coronavirus positive result, and was visualized under electron microscopy in a typical coronavirus form with a number of regularly arranged protrusions on the surface. CoVs are enveloped viruses with a positive RNA genome, belonging to the subgenera Nidovirales of the coronaviridae, divided into four genera (α, β, γ and δ), whereas the novel coronavirus (COVID-19) belongs to the genus β.

Coronaviruses contain at least four structural proteins: spike protein S protein (spike), E protein (Envelope), M protein (membrane), and N protein (nucleoapsid). Wherein the S protein promotes host attachment and fusion of the virus and cell membrane during virus infection. The N protein is mainly involved in maintaining the stability of the genome and the composition of the nucleocapsid.

Studies show that the N protein can be combined with CyPA in the intracellular assembly synthesis process of coronaviruses, and the CyPA plays an important role in the processes of virus replication, assembly, release and infection. In particular, cyPA is not only directly involved in budding and release of progeny virus, but alsoThe virus is released and then appears on the surface of the virus membrane, and the cooperative S protein participates in the identification and combination process of coronavirus and target cells. Our earlier studies also demonstrated that there is an interaction relationship between the SARS coronavirus N protein and CyPA, and the affinity constant K _D ＝0.04μmol/L。

It has been shown that CD147 molecule is one of the receptor molecules of CyPA, and is a co-receptor for invasion of coronavirus into host cells by binding to CyPA through extracellular Pro180 and Gly181 sites. We demonstrate an interaction between CD147 and CyPA, and ELISA results indicate that half maximal effector concentration (EC ₅₀ ) 135 μg/mL; SPR results showed affinity constants (K _D ) 8.7X10 ^-6 M. Our earlier studies showed that by blocking the binding site of the CD147 molecule of CyPA, the infection of target cells by SARS-CoV can be effectively blocked, enabling the treatment of viral infections. In this study, we also demonstrated that anti-BASIGIN humanized antibodies block the interaction between CyPA and CD147, IC ₅₀ ＝1.28μg/mL。

CD147 is a highly glycosylated, transmembrane glycoprotein with a molecular weight of 50-60 kD, which is a member of the immunoglobulin superfamily (IgSF) and has a different designation in different tissues, such as EMMPRIN, neurothelin, M6 antigen, BASIGIN, etc. In humans, CD147 is composed of 269 amino acids and is divided into extracellular, transmembrane and intracellular domains. The first 21 residues after N-terminal initial translation are signal peptides, 22-205 form extracellular regions, 206-229 are transmembrane regions, a typical leucine zipper structure is provided, and the C-terminal 230-269 is an intracellular region.

Previous researches show that the CD147 molecule is a multifunctional membrane protein target molecule, not only participates in the tumor development process, but also plays an important role in the process of facilitating virus invasion of host cells. The antagonistic peptides HAb18G-AP-1, AP-6 and AP-9 which are designed, screened and synthesized by taking CD147 molecules as targets in the early stage of the center have an inhibitory effect on 293 cells infected by SARS-CoV, and the AP-9 has a certain protective effect on 293 cells infected by SARS-CoV. A specific possible mechanism of action is that CyPA, by binding to the N protein of SARS-CoV, after which the exposed CyPA, by binding to the host cell membrane molecule CD147, causes viral entry. While the CD147 antagonistic peptide HAb18G-AP-9 prevents viral entry by blocking CD147 to the effect of preventing its circulatory life cycle. Or the CD147 antagonistic peptide can enter the infected cells to inhibit the sprouting and forming processes of viruses by blocking the combination of SARS-CoV N protein and CyPA and CD147 on ER, thereby achieving the effect of blocking the invasion of viruses, and the related research content is published in J effect Dis.2005,191 (5): 755-760.

In addition, our studies have also found that the interaction between the novel coronavirus S protein and CD147 on the host cell mediates the process of invasion of the novel coronavirus into the host cell, suggesting that CD147 is a receptor molecule for coronavirus invasion cells including the novel coronavirus, and that the BASIGN molecule on the targeted cell is expected to become an important target for new drugs against the novel coronavirus.

Monoclonal antibodies (McAb) have the advantages of high specificity, high affinity, small toxic and side effects, low immunogenicity, long in vivo action time, capability of utilizing an in vivo autoimmune system to exert curative effects and the like, are widely applied to diagnosis and treatment of a plurality of diseases, become novel medicines, and particularly provide an effective way for preventing and treating viruses by using antiviral neutralizing antibodies. However, repeated injection of murine mcabs into humans can cause patients to elicit a response to human anti-murine antibodies (human anti mouse antibody, HAMA), develop systemic allergic toxic responses and block the development of antibody efficacy. Therefore, humanized antibodies and humanized antibodies are becoming a mainstream trend of antibody drug development with their unique advantages.

Based on the research background, the biological activity of the anti-BASIGAN humanized antibody for inhibiting the infection of host cells by the novel coronavirus is verified through experiments.

Disclosure of Invention

In view of the defects and shortcomings in the prior art, the invention aims to provide an application of an anti-BASIGN humanized antibody in inhibiting infection of a host cell by a new coronavirus and inhibiting new coronapneumonia.

One of the purposes of the present invention is to provide the application of an anti-human BASIGIN humanized antibody (hereinafter referred to as "Basignin-hAb") for preparing a medicament for treating novel coronavirus pneumonia.

The humanized antibody of the invention is based on hybridoma cell strain HAb18Gedomab2 (collection number CCTCC-C200636, patent number: ZL 200710007452.2) of murine antibody 6H8 (also called HAb18GC 2) secreting anti-human BASIGIN molecules, the CDR and FR regions of the light and heavy chain variable regions of the antibody are defined through bioinformatics, the framework region of the humanized antibody is designed by utilizing a computer-aided antibody structural design means, and the whole molecule gene construction is carried out by utilizing a molecular biological means, so that the anti-human BASIGIN humanized antibody (ZL 201610285139.4) is expressed in a eukaryotic manner.

On the basis of the earlier-stage patent, the research not only further proves that the antibody can specifically perform target CD147 binding, and the specificity of the parent antibody for recognizing the antigen is maintained; determination of SPR protein binding Activity affinity constant (K) of CD147 with CyPA _D )＝8.7×10 ^-6 Affinity constant of M, CD147 to S protein (K _D )＝1.85×10 ^-7 M, ELISA results showed half-maximal effect concentrations of CD147 with CyPA and S proteins (EC ₅₀ ) 135 μg/mL and 68.83 μg/mL, respectively; the competition ELISA results show that the anti-BASIGPin humanized antibody can effectively block the interaction between CD147 and CyPA and S proteins, and half inhibition concentration (IC ₅₀ ) 1.28 μg/mL and 16.44 μg/mL, respectively; it was further confirmed that the anti-BASIGIN humanized antibody of the present invention was effective in inhibiting the infection of host cells with novel coronavirus (COVID-19), half the effective concentration (EC ₅₀ ) =35.98 μg/mL, effective in inhibiting viral nucleic acid copy number, half inhibition concentration (IC ₅₀ ) =17.58 μg/mL. Thus, the use of humanized antibodies against human BASIGIN in the treatment of novel coronavirus pneumonitis is described in detail in this patent.

The invention also provides an anti-human BASIGIN humanized antibody, wherein the amino acid sequence of the light chain variable region is shown as SEQ ID NO. 1, and the amino acid sequence of the heavy chain variable region is shown as SEQ ID NO. 3; the nucleotide sequence of the light chain variable region is shown as SEQ ID NO. 2, and the nucleotide sequence of the heavy chain variable region is shown as SEQ ID NO. 4; each comprising an immunoglobulin light chain variable region and an immunoglobulin heavy chain variable region;

(1) The immunoglobulin light chain variable region comprises CDR1: as shown in SEQ ID NO. 5 of the sequence table; CDR2: as shown in SEQ ID NO. 6 of the sequence table; CDR3: as shown in SEQ ID NO 7 of the sequence table;

(2) The immunoglobulin heavy chain variable region comprises CDR1: as shown in SEQ ID NO. 8 of the sequence table; CDR2: as shown in SEQ ID NO 9 of the sequence table; CDR3: as shown in SEQ ID NO. 10 of the sequence Listing. The monoclonal antibody is a humanized IgG2 antibody which is expressed by CHO cells (CHO DG44, a Chinese hamster ovary cell after mutation) in a recombination mode, and the molecule is formed by linking two heavy chains containing 442 amino acids and 2 light chains containing 214 amino acids through disulfide bonds.

In particular:

the application of humanized antibody of anti-human BASIGIN in preparing medicine for treating coronavirus pneumonia.

Anti-human BASIGIN humanized antibodies block the interaction of CD147 molecules with novel coronavirus S proteins; anti-human BASIGN humanized antibodies block the interaction of CD147 molecules with cyclophilin A (CyPA).

Alternatively, the amino acid sequence of the light chain variable region (VL) of the anti-human BASIGIN humanized antibody is shown as SEQ ID NO. 1, and the amino acid sequence of the heavy chain variable region (VH) is shown as SEQ ID NO. 3.

Alternatively, the nucleotide sequence of the light chain variable region (VL) of the anti-human BASIGN humanized antibody is shown as SEQ ID NO. 2, and the nucleotide sequence of the heavy chain variable region (VH) is shown as SEQ ID NO. 4.

Alternatively, the light chain (VL) constant region of the anti-human basign humanized antibody is kappa and the heavy chain (VH) constant region is IgG2.

Alternatively, the anti-human BASIGIN humanized antibody comprising a heavy chain variable region (VH), wherein the VH comprises: an amino acid sequence as shown in SEQ ID NO. 3.

Alternatively, the anti-human BASIGIN humanized antibody, wherein the VH contains as shown in SEQ ID NO 8, SEQ ID NO 9 or SEQ ID NO 10 amino acid sequence.

Alternatively, the anti-human BASIGN humanized antibody, which comprises a light chain variable region (VL), wherein the VL comprises CDRs as shown in SEQ ID NO. 5, SEQ ID NO. 6 or SEQ ID NO. 7.

Alternatively, the anti-human BASIGIN humanized antibody, wherein the light chain variable region (VL) comprises the amino acid sequence shown in SEQ ID NO. 1.

Alternatively, the anti-human BASIGIN humanized antibody, wherein the light chain variable region (VL) comprises the nucleotide sequence set forth in SEQ ID NO. 2.

The beneficial effects of the invention are as follows:

the invention confirms that CD147 molecules can interact with the novel coronavirus S protein and the virus binding protein CyPA to mediate the invasion of the novel coronavirus into host cells; the interaction between CD147, new coronavirus S protein and virus binding protein CyPA is blocked by the humanized antibody of anti-human BASIGIN, so that the virus can be effectively inhibited from infecting target cells, and the chemotaxis mediated by CyPA is inhibited, thereby realizing the treatment of virus-infected host cells. Thus, the present invention provides for the first time the use of humanized antibodies against human BASIGIN in the treatment of novel coronavirus pneumonitis.

Drawings

In order to more clearly illustrate the technical solutions of the embodiments of the present invention, the drawings that are required to be used in the description of the embodiments will be briefly described below.

FIG. 1 shows the results of determining the affinity between CD147 and novel coronavirus S protein COVID-19Spike-RBD by the SPR method of the invention, wherein the curves respectively show the binding kinetics IP curves of 0.4, 0.6, 0.8, 1.0 and 1.2 mu MCOVID-19Spike-RBD protein and CD 147;

FIG. 2 shows the results of SPR assay of novel coronavirus N protein and CyPA affinity, wherein the curves represent the binding kinetics curves of 200, 400 and 800nMSARS-CoV-2N protein and CyPA, respectively;

FIG. 3 shows the results of SPR assay of CD147 and CyPA affinity according to the present invention, wherein the curves represent the binding kinetics of 1 and 30. Mu. MCyPA protein to CD147, respectively;

FIG. 4 results of the ELISA method of the invention for determining CD147 interaction with novel coronavirus S protein COVID-19 Spike-RBD; wherein the abscissa represents the logarithmic value of the concentration of the CD147-his fusion protein with different concentrations, and the ordinate represents the Optical Density (OD) value of 450 nm;

FIG. 5 shows the results of a competition ELISA method for determining the interaction between CD147 inhibition by anti-BASIGIN humanized antibody and novel coronavirus S protein (COVID-19 Spike-RBD), wherein the abscissa represents the logarithmic value of the concentration of anti-BASIGIN humanized antibody and the ordinate represents the Optical Density (OD) value of 450 nm;

FIG. 6 shows the results of a competition ELISA assay for inhibiting CD147 interaction with CyPA by anti-BASIGIN humanized antibody, wherein the abscissa represents the logarithmic value of the concentration of anti-BASIGIN humanized antibody and the ordinate represents the Optical Density (OD) value at 450 nm;

FIG. 7 shows inhibition of CyPA-mediated cell chemotaxis by anti-BASIGN humanized antibodies of the present invention;

FIG. 8 is a graph showing the quantitative-efficacy of anti-BASIGIN humanized antibody against COVID-19 infected cells according to the present invention;

FIG. 9 shows the copy number-effect curve of anti-BASIGIN humanized antibody against the COVID-19 virus nucleic acid.

Detailed Description

Term interpretation:

immunoglobulins refer to a class of structurally related glycoproteins consisting of two pairs of polypeptide chains, a pair of low molecular weight light chains (L) and a pair of high molecular weight heavy chains (H), all four chains being interconnected by disulfide bonds. Each heavy chain typically consists of a heavy chain variable region (abbreviated herein as VH) and a heavy chain constant region (abbreviated herein as CH). Each light chain typically consists of a light chain variable region (abbreviated herein as VL) and a light chain constant region (abbreviated herein as CL). The light chain constant region typically consists of one domain CL. VH and VL can be further subdivided into regions of hypervariability (or regions of hypervariability in sequence and/or in the form of structurally defined loops), also known as Complementarity Determining Regions (CDRs), interspersed with regions that are more conserved, known as Framework Regions (FR). Each VH and VL is typically composed of three CDRs and four FRs, arranged from amino-terminus to carboxy-terminus in the following order, FR1, CDR1, FR2, CDR2, FR3, CDR3, FR4 (see Chothia and Lesk, 1987). Typically, numbering of amino acid residues in this region can be performed by the method described by Kabat et al.

"humanized antibody", as used herein, refers to an antibody derived from a non-human antibody, typically a murine antibody, which retains or substantially retains the antigen binding properties of the parent antibody (parent antibody) but which is less immune in humans. Since the antibodies of the present invention are defined by structural and functional features, "humanized antibodies" may be used interchangeably with "antibodies".

Complementarity Determining Regions (CDRs), as used herein, refer to a variety of amino acid sequences that collectively define the binding affinity and specificity of the variable fragment (Fv) region of an immunoglobulin binding site.

Framework Regions (FR), as used herein, refer to amino acid sequences inserted between CDRs. These parts of the antibody are used to hold the CDRs in place (allowing the CDRs to bind antigen). The light chain variable region and the heavy chain variable region each comprise a Framework Region (FR) and typically three CDRs.

Constant Region (CR), as used herein, refers to the portion of an antibody molecule that confers effector function. The constant regions of the subject humanized antibodies are derived from human immunoglobulins. The heavy chain constant region may be selected from five isoforms: alpha, delta, epsilon, gamma or mu. Further, the heavy chains of the various subclasses (e.g., the IgG subclasses of heavy chains) can cause different effector functions, and thus, by selecting the desired heavy chain constant regions, antibodies with the desired effector functions can be produced. Preferred heavy chain constant regions are γ1 (IgG 1), γ2 (IgG 2), γ3 (IgG 3) and γ4 (IgG 4), more preferably γ2 (IgG 2). The light chain constant region may be kappa or lambda type, preferably kappa type.

The skilled artisan will appreciate that the variable or constant regions of an immunoglobulin heavy or light chain can be linked as described by using standard recombinant DNA techniques to create a polynucleotide that can be expressed in a suitable host (thereby producing the immunoglobulin chain (s)), or can be linked by chemical synthesis using peptides.

The parent antibody of the humanized antibody of the present invention, namely, murine antibody 6H8, which is called an anti-human BASIGAN molecule, is produced by the hybridoma cell line HAb18Gedomab2, which is deposited with the China center for type culture Collection (CCTCC-C200636, patent number: ZL 200710007452.2) at 12/13 of 2006. The humanized antibody of the invention retains the ability of specifically binding to the antigen recognized by the parent antibody used for producing such humanized antibody HP6H8-1, and is specifically disclosed in the invention (application number: 201610285139.4).

The present invention will be described in further detail with reference to examples. It is to be understood, however, that these examples are set forth merely for purposes of illustration and are not intended to limit the invention. All other embodiments, which can be made by those skilled in the art based on the embodiments of the invention without making any inventive effort, are intended to be within the scope of the invention.

The experimental methods used in the following examples are conventional methods unless otherwise specified. Materials, reagents and the like used in the examples described below are commercially available unless otherwise specified.

Embodiment one: SPR method for determining interaction between novel coronavirus S protein (COVID-19 Spike-RBD) and CD147

Based on Surface Plasmon Resonance (SPR) technology, the molecular binding kinetics parameters between the novel coronavirus S protein (COVID-19 Spike-RBD) and CD147 were determined using the BIAcore 3000 system and CM5 sensor chip. The detection buffer system is PBS (pH 7.4), and the detection temperature is 25 ℃; fixing 35 mu gCD147 on the surface of a CM5 chip in an amino coupling mode; detecting interaction by adopting a Kinetic Analysis/Concentration Series/Direct Binding mode, setting the flow rate to be 10 mu L/min, the Binding time to be 10min, and the dissociation time to be 10min; samples to be tested, 0.4,0.8, 1.0 and 1.2. Mu.M of the novel coronavirus S protein (COVID-19 Spike-RBD) were injected into the different channels, respectively. And fitting analysis is carried out on the results by using BIAevaluation software, and the dynamics constant is determined.

The results are shown in FIG. 1: binding rate constant (k) between CD147 and novel coronavirus S protein (COVID-19 Spike-RBD) _a ) Is 1.11 multiplied by 10 ⁴ M ^-1 ·s ^-1 Dissociation rate constant (k _d ) Is 2.06X10 ^-3 s ^-1 Affinity constant (K) _D ) 1.85×10 ^- ⁷ M. The results suggest that CD147 has an interaction relationship with the novel coronavirus S protein (COVID-19 Spike-RBD), and that CD147 is involved in the process of infecting cells with the novel coronavirus.

Embodiment two: SPR method for determining interaction between N protein of novel coronavirus and cyclophilin A (CyPA)

Based on Surface Plasmon Resonance (SPR) technology, the molecular binding kinetics parameters between the novel coronavirus N protein and cyclophilin a (CyPA) were determined using the BIAcore 3000 system and CM5 sensor chip. The detection buffer system is PBS (pH 7.4), and the detection temperature is 25 ℃; fixing the CyPA on the surface of the CM5 chip in an amino coupling mode; the chip was inactivated with 1M ethane-HCl (Bio-Rad); after 90 degrees rotation the chip was rinsed with buffer (PBS/0.005% Tween 20) to baseline plateau. Injecting 0.2, 0.4 and 0.8 mu M new coronavirus N protein on the horizontal channel respectively, setting the flow rate to be 10 mu L/min, the combination time to be 10min and the dissociation time to be 10min; interaction was detected using Kinetic Analysis/Concentration Series/Direct Binding mode. And fitting analysis is carried out on the results by using BIAevaluation software, and the dynamics constant is determined.

The results are shown in FIG. 2: the interaction relationship exists between the N protein of the novel coronavirus and the CyPA molecule, and the binding rate constant (k _a ) Is 1.89 multiplied by 10 ^-4 M ^-1 ·s ^-1 Dissociation rate constant (k _d ) 5.03X10 ^-3 s ^-1 Affinity constant (K) _D ) Is 2.67 multiplied by 10 ^-7 M. The results suggest that CyPA forms a CyPA-new coronavirus complex with the new coronavirus. CyPA is involved in the process of infecting cells with the new coronavirus.

Embodiment III: SPR method to determine interaction between CD147 and cyclophilin A (CyPA)

CD147 binding to cyclophilin a (CyPA) was monitored in real time using SPR, and the affinity of CD147 to CyPA was reflected by determining the affinity constant (KD). Affinity assays for CD147 and cyclophilin A (CyPA) were performed using a Proteon XPR36 (Bio-Rad, XPR 36) instrument. GLC chips (Bio-Rad, 1765011) were activated with 0.04M EDC+0.01Msulfo-NHS (Bio-Rad). CD147 to 10mM was diluted with 10mM NAAc (pH 4.5) and injected onto the chip at 30ul/min to couple the antigen to the activated chip via amino groups. Finally, inactivating the chip by using 1M ethane-HCl (Bio-Rad); after 90 degrees rotation the chip was rinsed with buffer (PBS/0.005% Tween 20) to baseline plateau. Samples of 1 and 30. Mu.M cyclophilin A (CyPA) were injected on horizontal channels, respectively. The sample injection speed is 30ul/min. Sample binding time is 60s, and dissociation time is 900s; data analysis was performed using Langmuir kinetics (Kinetic-Langmuir) model.

The results are shown in FIG. 3, which shows the CyPA binding rate constant with CD147 (k _a ) 92M ^-1 ·s ^-1 Dissociation rate constant (k _d ) Is 8 multiplied by 10 ^-4 s ^-1 Affinity constant is about 8.7X10 ^-6 M. The results suggest that CD147 acts as a receptor for CyPA on cells, mediating the process of new coronavirus infection of cells.

Embodiment four: ELISA method for determining interaction ability between CD147 and novel coronavirus S protein (COVID-19 Spike-RBD)

The ability of CD147 to interact with the novel coronavirus S protein (COVID-19 Spike-RBD) was tested by ELISA. 5. Mu.g/mL of the COVID-19Spike-RBD-his fusion protein was coated on a microplate and then incubated with different concentrations of CD147-his fusion protein (2-fold dilution, 400-0.195. Mu.g/mL) for 1 hour at 37 ℃. After three washes with PBST, incubation with HAb18 murine anti-CD 147 antibody for 1 hour; the HRP-labeled goat anti-mouse antibody was further incubated for 1 hour. 100. Mu.L TMB was added and developed for 4 minutes, followed by the addition of 50. Mu.L 2M H2SO4 to terminate the reaction. Optical Density (OD) values at 450nm were measured with a full wavelength microplate reader (Epoch, bioTek Instruments, inc.) and the half maximal Effective Concentration (EC) was calculated using a four parameter fit ₅₀ )。

The results are shown in FIG. 4, where there is an interaction relationship between CD147 and the novel coronavirus S protein (COVID-19 Spike-RBD), half maximal effective concentration (EC ₅₀ ) Is 68.83 mug/mL.

Fifth embodiment: competitive inhibition assay for inhibiting CD147 interaction with novel coronavirus S protein (COVID-19 Spike-RBD) by anti-BASIGAN humanized antibody

The ability of anti-BASIGIN humanized antibodies to compete with the novel coronavirus S protein (COVID-19 Spike-RBD) for CD147 binding was tested by competitive inhibition ELISA. 100. Mu.L of CD147-his fusion protein (5. Mu.g/mL) was packagedIs placed on the microplate. Then with 200 mug/mL COVID-19Spike-RBD and different concentrations of anti-BASIGIN humanized antibody (2-fold dilution, from 200-0.781 mug/mL) incubated for 1 hour. Three washes with PBST, incubate with anti-CD 147 murine antibody HAb18, and incubate with HRP-labeled goat anti-murine antibody after washing. After addition of 100. Mu.l TMB, the color development was carried out for 4 minutes, followed by addition of 1M H ₂ SO ₄ The reaction was terminated. Optical Density (OD) values at 450nm were measured with a microplate spectrophotometer (Epoch, bioTek Instruments, inc.).

The results are shown in FIG. 5, where anti-BASIGIN humanized antibodies blocked CD147 interactions with COVID-19Spike-RBD in a dose-dependent manner. Half maximal Inhibitory Concentration (IC) ₅₀ ) 16.44. Mu.g/mL. The results show that the anti-BASIGIN humanized antibody can specifically block the interaction between CD147 and COVID-19Spike-RBD, and suggest that the anti-BASIGIN humanized antibody can inhibit the invasion of a new coronavirus into a host cell by blocking the interaction between CD147 and a new coronavirus S protein.

Example six: competitive inhibition assay for inhibiting CD147 interaction with its ligand CyPA by anti-BASIGAN humanized antibody

The ability of anti-BASIGIN humanized antibodies to compete for CD147 binding to CyPA was tested by competitive inhibition ELISA. The prepared CyPA-his fusion protein was coated on a microplate. Then with 1mg/mL CD147-Tag fusion protein and different concentrations of anti BASIGIN humanized antibody (2 times dilution, from 200-0.049 u g/mL) incubated for 1 hr. Three washes with PBST, incubate with anti-CD 147 murine antibody HAb18, and incubate with HRP-labeled goat anti-murine antibody after washing. After addition of 100. Mu.l TMB, the color development was carried out for 4 minutes, followed by addition of 1M H ₂ SO ₄ The reaction was terminated. Optical Density (OD) values at 450nm were measured with a microplate spectrophotometer (Epoch, bioTek Instruments, inc.).

The results are shown in figure 6, where anti-basign humanized antibodies blocked CD147 interactions with CyPA in a dose-dependent manner. Half maximal Inhibitory Concentration (IC) ₅₀ ) 1.28. Mu.g/mL. The results show that the anti-BASIGIN humanized antibody can specifically block the interaction between CD147 and CyPA, and suggest that the anti-BASIGIN humanized antibody can inhibit the new antibody by blocking the interaction between CD147 and CyPACoronaviruses invade host cells.

Embodiment seven: anti-BASIGAN humanized antibodies inhibit CyPA-mediated chemotaxis experiments

Inhibition of CyPA-mediated chemotaxis by anti-BASIGIN humanized antibodies was assessed using a Transwell chamber. Human peripheral blood mononuclear cells were isolated and peripheral blood mononuclear cells were suspended in RPMI1640 medium containing 20% fbs. 100. Mu.l of cell suspension (2X 10) was added to the Transwell plate upper chamber ⁵ Individual cells). The experiments were divided into a serum-free control group, an anti-BASIGN humanized antibody group (10. Mu.g/mL, upper chamber), a CyPA group (200. Mu.g/L, lower chamber) and a Meppe bead (10. Mu.g/mL, upper chamber) +CyPA (200. Mu.g/L, lower chamber) group. After incubation in a incubator at 37℃for 2 hours, the crystal violet stains and counts cells on the membrane of the Transwell chamber and the cells in the lower chamber that have penetrated the membrane. Chemotactic Index (CI) was calculated as formula CI = treatment group cell number/control group cell number.

The results are shown in FIG. 7, with respect to 1640 group, the CI of the CyPA group, the Meperot bead group, and the Meperot bead group+CyPA group are 4.477.+ -. 0.922, 0.820.+ -. 0.200, and 2.073.+ -. 0.583, respectively. Compared with the CyPA group, the CI of the Meperot bead+CyPA group is 0.448+/-0.092. The above results indicate that anti-basign humanized antibodies can significantly inhibit the chemotactic effect of CyPA on PBMC (p=0.0234), suggesting that anti-basign humanized antibodies can reduce severe inflammatory response caused by new coronaries.

Example eight: anti-BASIGIN humanized antibodies inhibit New coronavirus (COVID-19) infection of host cells experiments

The efficacy of anti-BASIGIN humanized antibodies in inhibiting the infection of host epithelial cells by novel coronavirus (COVID-19) was evaluated using a 96-well plate virus minivirus inhibition assay.

1×10 ⁴ Vero E6 cells/well were plated in 96-well plates at 37 ℃ overnight. The supernatant was aspirated, 100. Mu.l of culture broth (containing 3.125, 6.25, 12.5, 25, 50, 100, 150, 200. Mu.g/mL Meppe bead antibody concentration) was added, incubated at 37℃for 1h, and 100. Mu.l of virus solution (containing 100 TCID) was added ₅₀ Well) was incubated for 1h, the above liquid was removed, and washed 5 times with PBS. 200 μl of cell culture broth (containing 3.125, 6.25, 12.5, 25, 50, 100, 150, 200 μg/mL Meppe antibody concentration group) was added, and the culture was continued for 2 daysCytopathy is observed. The supernatant was pipetted, 50. Mu.l of staining solution was added to each well, the wells were left at room temperature for 30 minutes, the staining solution was washed off with water, and the residual water was blotted off, 100. Mu.l of decolorizing solution was added to each well, the absorbance at 570nm was measured, and the inhibition was calculated from the absorbance. The EC was calculated by plotting the dose-response curve with Graphpad prism ₅₀ . And simultaneously setting a virus control group and a blank control group.

As shown in FIG. 8, the anti-BASIGIN humanized antibody was effective in reducing the cytopathic effect, and had a dose-dependent relationship, EC ₅₀ ＝35.98μg/mL(R ² = 0.9928), suggesting that anti-basic humanized antibodies may inhibit infection of host cells by new coronaviruses.

Example nine: anti-BASIGIN humanized antibodies against New coronavirus (COVID-19) viral nucleic acid copy number pharmacodynamic experiments

1×10 ⁴ Vero E6 cells/well were plated in 96-well plates at 37 ℃ overnight. The supernatant was aspirated, 100. Mu.l of culture broth (containing 3.125, 6.25, 12.5, 25, 50, 100, 150, 200. Mu.g/mL Meppe bead antibody concentration) was added, incubated at 37℃for 1h, and 100. Mu.l of virus solution (containing 100 TCID) was added ₅₀ Well) was incubated for 1h, the above liquid was removed, and washed 5 times with PBS. Mu.l of cell culture medium (containing 3.125, 6.25, 12.5, 25, 50, 100, 150, 200. Mu.g/mL of Meppe bead antibody concentration group) was added thereto, and the culture was continued for 2 days to observe cytopathy. Absorbing the supernatant, adopting a fluorescent quantitative PCR method, taking a standard plasmid as a standard substance, serially diluting, establishing a standard curve, detecting the copy number of virus nucleic acid in the culture solution, and calculating the inhibition rate. The EC was calculated by plotting the dose-response curve with Graphpad prism ₅₀ . And simultaneously setting a virus control group and a blank control group.

As shown in FIG. 9, the MEPERBUK can effectively reduce the copy number of viral nucleic acid, and has dose dependency relationship and IC ₅₀ ＝17.58μg/mL(R ² = 0.9883), also suggesting that anti-basic humanized antibodies may inhibit infection of host cells by new coronaviruses.

The preferred embodiments of the present disclosure have been described in detail above with reference to the accompanying drawings, but the present disclosure is not limited to the specific details of the above embodiments, and various simple modifications may be made to the technical solutions of the present disclosure within the scope of the technical concept of the present disclosure, and all the simple modifications belong to the protection scope of the present disclosure.

In addition, the specific features described in the foregoing embodiments may be combined in any suitable manner, and in order to avoid unnecessary repetition, the present disclosure does not further describe various possible combinations.

Moreover, any combination between the various embodiments of the present disclosure is possible as long as it does not depart from the spirit of the present disclosure, which should also be construed as the disclosure of the present disclosure.

Nucleotide sequence Listing electronic document

<110> Chinese people's liberation army fourth army university

<120> application of anti-BASIGIN humanized antibody in preparation of medicine for treating novel coronavirus pneumonia

<210>1

<211>107

<212>PRT

<213> humanization

<220> amino acid sequence of light chain variable region (VL) of anti-BASIGIN humanized antibody

<400>1

Asp Ile Gln Met Thr Gln Ser Pro Ser Thr Leu Ser Ala Ser Val Gly Asp Arg Val Thr

1 5 10 15 20

Leu Ser Cys Lys Ala Ser Glu Asn Val Gly Thr Tyr Val Ser Trp Tyr Gln Gln Lys Pro

21 25 30 35 40

Gly Lys Ala Pro Lys Leu Leu Ile Tyr Gly Ala Ser Asn Arg Tyr Thr Gly Val Pro Ser

41 45 50 55 60

Arg Phe Thr Gly Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr Ile Ser Ser Leu Gln Pro

61 65 70 75 80

Glu Asp Phe Ala Thr Tyr Tyr Cys Gly Gln Ser Tyr Ser Tyr Pro Phe Thr Phe Gly Ser

81 85 90 95 100

Gly Thr Lys Leu Glu Ile Lys

101 105 107

<210>2

<211>321

<212>DNA

<213> humanization

<220> anti-BASIGIN humanized antibody light chain variable region (VL) nucleotide sequence

<400>2

gacattcagatgacccaatctccctccaccctgtccgcctcagtgggcga 50

cagggtcaccctctcctgcaaggccagtgagaatgtgggtacttatgtat 100

cctggtatcaacagaaaccaggcaaggcccctaaactgctgatatacggg 150

gcatccaaccggtacactggggtcccctcccgcttcaccggcagtggatc 200

tggcacagatttcactctgaccatcagcagtctgcagcccgaggacttcg 250

caacctattactgtggacagagttacagctatccattcacgttcggctcg 300

gggacaaagttggaaataaaa 321

<210>3

<211>116

<212>PRT

<213> humanization

<220> amino acid sequence of heavy chain variable region (VH) of anti-BASIGIN humanized antibody

<400>3

Glu Val Gln Leu Val Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly Ser Leu Arg Leu

1 5 10 15 20

Ser Cys Ala Ala Ser Gly Phe Thr Phe Ser Asn Phe Trp Met Asn Trp Val Arg Gln Ala

21 25 30 35 40

Pro Gly Lys Gly Leu Glu Trp Val Ser Glu Ile Arg Leu Lys Ser Asn Asn Tyr Ala Thr

41 45 50 55 60

His Tyr Ala Glu Ser Val Lys Gly Arg Phe Thr Ile Ser Arg Asp Asp Ser Lys Asn Thr

61 65 70 75 80

Leu Tyr Leu Gln Met Asn Ser Leu Lys Thr Glu Asp Thr Ala Val Tyr Tyr Cys Thr Ser

81 85 90 95 100

Tyr Asp Tyr Glu Tyr Trp Gly Gln Gly Thr Leu Val Thr Val Ser Ala

101 105 110 115 116

<210>4

<211>348

<212>DNA

<213> humanization

<220> anti-BASIGIN humanized antibody heavy chain variable region (VH) nucleotide sequence

<400>4

gaagtgcagcttgtggagtctggaggaggcttggtgcaacctggaggatc 50

cctgaggctctcctgtgccgcctctggattcactttcagtaacttctgga 100

tgaactgggtccgccaggctccagggaaggggcttgagtgggtttccgaa 150

attagattgaaatctaataattatgcaacacattatgcggagtctgtgaa 200

agggaggttcaccatctcaagagatgattccaaaaacaccctgtacctgc 250

agatgaactccttaaagactgaagacactgccgtgtattactgtaccagc 300

tatgattacgaatactggggccaagggactctggtcactgtctctgca 348

<210>5

<211>11

<212>PRT

<213>

<220> light chain CDR-1 amino acid sequence

<400>5

Lys Ala Ser Glu Asn Val Gly Thr Tyr Val Ser

1 5 10 11

<210>6

<211>7

<212>PRT

<213>

<220> light chain CDR-2 amino acid sequence

<400>6

Gly Ala Ser Asn Arg Tyr Thr

1 5 7

<210>7

<211>9

<212>PRT

<213>

<220> light chain CDR-3 amino acid sequence

<400>7

Gly Gln Ser Tyr Ser Tyr Pro Phe Thr

1 5 9

<210>8

<211>10

<212>PRT

<213>

<220> heavy chain CDR-1 amino acid sequence

<400>8

Gly Phe Thr Phe Ser Asn Phe Trp Met Asn

1 5 10

<210>9

<211>19

<212>PRT

<213>

<220> heavy chain CDR-2 amino acid sequence

<400>9

Glu Ile Arg Leu Lys Ser Asn Asn Tyr Ala

1 5 10

Thr His Tyr Ala Glu Ser Val Lys Gly

11 15 19

<210>10

<211>5

<212>PRT

<213>

<220> heavy chain CDR-3 amino acid sequence

<400>10

Tyr Asp Tyr Glu Tyr

1 5

Claims

1. The application of the anti-human BASIGN humanized antibody in preparing medicaments for treating novel coronavirus pneumonia is characterized in that the amino acid sequence of a light chain variable region (VL) of the anti-human BASIGN humanized antibody is shown as SEQ ID NO. 1, and the amino acid sequence of a heavy chain variable region (VH) is shown as SEQ ID NO. 3.

2. The use of claim 1, wherein the anti-human basignin humanized antibody blocks the interaction of CD147 molecules with novel coronavirus S proteins;

anti-human BASIGN humanized antibodies block the interaction of CD147 molecules with cyclophilin A (CyPA).

3. The use according to claim 1 or 2, wherein the anti-human BASIGIN humanized antibody light chain variable region (VL) has the nucleotide sequence shown in SEQ ID No. 2 and heavy chain variable region (VH) has the nucleotide sequence shown in SEQ ID No. 4.

4. The use according to claim 1 or 2, wherein the light chain (VL) constant region of the anti-human BASIGIN humanized antibody is kappa and the heavy chain (VH) constant region is IgG2.

5. The use according to claim 1 or 2, wherein said anti-human BASIGIN humanized antibody, wherein said VH comprises the amino acid sequence set forth in SEQ ID No. 8, SEQ ID No. 9 or SEQ ID No. 10.

6. The use according to claim 1 or 2, wherein the anti-human BASIGIN humanized antibody comprises a light chain variable region (VL), wherein the VL comprises CDRs as set forth in SEQ ID No. 5, SEQ ID No. 6 or SEQ ID No. 7.