CN111411161A

CN111411161A - Primer group and kit for detecting K antigen genotyping of vibrio parahaemolyticus

Info

Publication number: CN111411161A
Application number: CN202010254527.2A
Authority: CN
Inventors: 扈庆华; 路琳英; 李民旭; 姜伊祥; 左乐; 石晓路; 李迎慧; 江敏
Original assignee: SHENZHEN CENTER FOR DISEASE CONTROL AND PREVENTION
Current assignee: SHENZHEN CENTER FOR DISEASE CONTROL AND PREVENTION
Priority date: 2020-04-02
Filing date: 2020-04-02
Publication date: 2020-07-14
Anticipated expiration: 2040-04-02
Also published as: CN111411161B

Abstract

The invention provides a primer group SEQ ID No. 1-SEQ ID No.114 for detecting K antigen genotyping of vibrio parahaemolyticus, wherein the primer group is based on a fluorescent probe melting curve technology of multiple hybridization connection reaction, biological informatics method analysis is carried out according to the whole genome of 418 vibrio parahaemolyticus, 18 specific gene sequences of the vibrio parahaemolyticus in a public database are analyzed, specific genes and specific gene regions of 57K antigens of the vibrio parahaemolyticus are obtained and screened, the primer group is designed aiming at the specific genes of the 57K antigens of the vibrio parahaemolyticus, the primer group can be used for simultaneously detecting the K antigen genotyping of the 57 vibrio parahaemolyticus based on the fluorescent probe melting curve method, and the detection time and the detection accuracy of the antigen genotyping of the vibrio parahaemolyticus are improved.

Description

Primer group and kit for detecting K antigen genotyping of vibrio parahaemolyticus

Technical Field

The invention relates to the field of biological detection, in particular to a primer group and a kit for detecting K antigen genotyping of vibrio parahaemolyticus.

Background

Vibrio parahaemolyticus, also known as Vibrio enteritis, belongs to the genus Vibrio, gram-negative, facultative anaerobe, is a polymorphous or Vibrio parahaemolyticus, is a common pathogenic bacterium, and is mainly inhabited in seawater. If the seafood polluted by the fungus is eaten, food poisoning is caused, and the seafood is one of main diseases of human beings. Moreover, the vibrio parahaemolyticus is a food-borne pathogenic bacterium with multiple serotypes, and the serotype typing is mainly carried out according to a thallus lipopolysaccharide O antigen and a capsular polysaccharide K antigen of the vibrio parahaemolyticus, wherein the O antigens have 13 types, the K antigens have more than 70 types, and the serotypes are represented by the formula of O: forms of K are shown (e.g., common serotypes O3: K6, O4: K8, etc.).

At present, the detection method for vibrio parahaemolyticus comprises the following aspects of 1, hemogram observation, wherein the total number of white blood cells is increased at the initial stage of disease occurrence and is mostly (10-20) × 10⁹L, classifying over 80 percent of neutrophils, judging whether infection is caused directly, 2, performing stool microscopic examination, wherein white blood cells or pus cells are visible, red blood cells are often accompanied, and are easy to misdiagnose as bacillary dysentery, detecting vibrio parahaemolyticus by stool culture, most of vibrio parahaemolyticus are rapidly turned to negative, only a few of vibrio parahaemolyticus are continuously positive for 2-4 days, not directly detecting antigen genotyping of vibrio parahaemolyticus 3, performing bacterial culture for 1-2 days, ensuring that the positive rate of the stool culture is high, reducing the positive rate after 2 days, ensuring long detection time, not directly detecting antigen genotyping of vibrio parahaemolyticus 4, performing serum agglutination test: the serum agglutination titers were high at the early stage of the disease and most of them turned negative soon thereafter. If the titer reaches 1: 80-1: 160, the disease can be diagnosed; the antigen genotyping of Vibrio parahaemolyticus cannot be directly detected. 5. By adopting the common PCR detection, only the infection can be rapidly determined, but the antigen genotyping of the vibrio parahaemolyticus cannot be directly detected.

Because the antigen genotyping quantity of the vibrio parahaemolyticus is large, the detection method adopted at present has the defects of large workload, poor detection accuracy and incapability of quickly and accurately judging the antigen genotyping of the vibrio parahaemolyticus. Therefore, improvements are needed in existing detection methods.

Disclosure of Invention

The invention aims to provide a primer group and a kit for detecting K antigen genotyping of vibrio parahaemolyticus, and aims to solve the problem that the antigen genotyping of the vibrio parahaemolyticus cannot be rapidly and accurately judged in the prior art.

In order to achieve the purpose, the invention adopts the following technical scheme:

a primer group for detecting K antigen genotyping of Vibrio parahaemolyticus, the primer group detects 57K antigen genotyping of Vibrio parahaemolyticus based on a fluorescent probe melting curve method, the primer group comprises:

hybrid connecting primers SEQ ID No.1 and SEQ ID No.2 for detecting K1 antigen genotyping;

hybrid connecting primers SEQ ID No.3 and SEQ ID No.4 for detecting K3 antigen genotyping;

hybrid connecting primers SEQ ID No.5 and SEQ ID No.6 for detecting K4 antigen genotyping;

hybrid connecting primers SEQ ID No.7 and SEQ ID No.8 for detecting K5 antigen genotyping;

hybrid connecting primers SEQ ID No.9 and SEQ ID No.10 for detecting K6 antigen genotyping;

hybrid connecting primers SEQ ID No.11 and SEQ ID No.12 for detecting K7 antigen genotyping;

hybrid connecting primers SEQ ID No.13 and SEQ ID No.14 for detecting K8 antigen genotyping;

hybrid connecting primers SEQ ID No.15 and SEQ ID No.16 for detecting K9 antigen genotyping;

hybrid connecting primers SEQ ID No.17 and SEQ ID No.18 for detecting K11 antigen genotyping;

hybrid connecting primers SEQ ID No.19 and SEQ ID No.20 for detecting K12 antigen genotyping;

hybrid connecting primers SEQ ID No.21 and SEQ ID No.22 for detecting K13 antigen genotyping;

hybrid connecting primers SEQ ID No.23 and SEQ ID No.24 for detecting K15 antigen genotyping;

hybrid connecting primers SEQ ID No.25 and SEQ ID No.26 for detecting K17 antigen genotyping;

hybrid connecting primers SEQ ID No.27 and SEQ ID No.28 for detecting K18 antigen genotyping;

hybrid connecting primers SEQ ID No.29 and SEQ ID No.30 for detecting K19 antigen genotyping;

hybrid connecting primers SEQ ID No.31 and SEQ ID No.32 for detecting K20 antigen genotyping;

hybrid connecting primers SEQ ID No.33 and SEQ ID No.34 for detecting K21 antigen genotyping;

hybrid connecting primers SEQ ID No.35 and SEQ ID No.36 for detecting K22 antigen genotyping;

hybrid connecting primers SEQ ID No.37 and SEQ ID No.38 for detecting K23 antigen genotyping;

hybrid connecting primers SEQ ID No.39 and SEQ ID No.40 for detecting K24 antigen genotyping;

hybrid connecting primers SEQ ID No.41 and SEQ ID No.42 for detecting K25 antigen genotyping;

hybrid connecting primers SEQ ID No.43 and SEQ ID No.44 for detecting K28 antigen genotyping;

hybrid connecting primers SEQ ID No.45 and SEQ ID No.46 for detecting K29 antigen genotyping;

hybrid connecting primers SEQ ID No.47 and SEQ ID No.48 for detecting K30 antigen genotyping;

hybrid connecting primers SEQ ID No.49 and SEQ ID No.50 for detecting K31 antigen genotyping;

hybrid connecting primers SEQ ID No.51 and SEQ ID No.52 for detecting K32 antigen genotyping;

hybrid connecting primers SEQ ID No.53 and SEQ ID No.54 for detecting K33 antigen genotyping;

hybrid connecting primers SEQ ID No.55 and SEQ ID No.56 for detecting K34 antigen genotyping;

hybrid connecting primers SEQ ID No.57 and SEQ ID No.58 for detecting K36 antigen genotyping;

hybrid connecting primers SEQ ID No.59 and SEQ ID No.60 for detecting K37 antigen genotyping;

hybrid connecting primers SEQ ID No.61 and SEQ ID No.62 for detecting K38 antigen genotyping;

hybrid connecting primers SEQ ID No.63 and SEQ ID No.64 for detecting K39 antigen genotyping;

hybrid connecting primers SEQ ID No.65 and SEQ ID No.66 for detecting K40 antigen genotyping;

hybrid connecting primers SEQ ID No.67 and SEQ ID No.68 for detecting K41 antigen genotyping;

hybrid connecting primers SEQ ID No.69 and SEQ ID No.70 for detecting K42 antigen genotyping;

hybrid connecting primers SEQ ID No.71 and SEQ ID No.72 for detecting K43 antigen genotyping;

hybrid connecting primers SEQ ID No.73 and SEQ ID No.74 for detecting K44 antigen genotyping;

hybrid connecting primers SEQ ID No.75 and SEQ ID No.76 for detecting K45 antigen genotyping;

hybrid connecting primers SEQ ID No.77 and SEQ ID No.78 for detecting K46 antigen genotyping;

hybrid connecting primers SEQ ID No.79 and SEQ ID No.80 for detecting K48 antigen genotyping;

hybrid connecting primers SEQ ID No.81 and SEQ ID No.82 for detecting K49 antigen genotyping;

hybrid connecting primers SEQ ID No.83 and SEQ ID No.84 for detecting K51 antigen genotyping;

hybrid connecting primers SEQ ID No.85 and SEQ ID No.86 for detecting K52 antigen genotyping;

hybrid connecting primers SEQ ID No.87 and SEQ ID No.88 for detecting K53 antigen genotyping;

hybrid connecting primers SEQ ID No.89 and SEQ ID No.90 for detecting K54 antigen genotyping;

hybrid connecting primers SEQ ID No.91 and SEQ ID No.92 for detecting K55 antigen genotyping;

hybrid connecting primers SEQ ID No.93 and SEQ ID No.94 for detecting K56 antigen genotyping;

hybrid connecting primers SEQ ID No.95 and SEQ ID No.96 for detecting K59 antigen genotyping;

hybrid connecting primers SEQ ID No.97 and SEQ ID No.98 for detecting K60 antigen genotyping;

hybrid connecting primers SEQ ID No.99 and SEQ ID No.100 for detecting K63 antigen genotyping;

hybrid connecting primers SEQ ID No.101 and SEQ ID No.102 for detecting K64 antigen genotyping;

hybrid connecting primers SEQ ID No.103 and SEQ ID No.104 for detecting K65 antigen genotyping;

hybrid connecting primers SEQ ID No.105 and SEQ ID No.106 for detecting K67 antigen genotyping;

hybrid connecting primers SEQ ID No.107 and SEQ ID No.108 for detecting K68 antigen genotyping;

hybrid connecting primers SEQ ID No.109 and SEQ ID No.110 for detecting K69 antigen genotyping;

hybrid connecting primers SEQ ID No.111 and SEQ ID No.112 for detecting K70 antigen genotyping;

hybrid connecting primers SEQ ID No.113 and SEQ ID No.114 for detecting K71 antigen genotyping.

And a kit for detecting K antigen genotyping of Vibrio parahaemolyticus, the kit comprising the primer set.

And a method for detecting the K antigen genotyping of the vibrio parahaemolyticus, which provides the kit for detecting the K antigen genotyping of the vibrio parahaemolyticus and adopts a fluorescent probe melting curve technology based on multiple hybridization connection reaction to detect the K antigen genotyping of the vibrio parahaemolyticus.

The primer group for detecting K antigen genotyping of vibrio parahaemolyticus provided by the invention is based on a fluorescent probe melting curve technology of multiple hybridization connection reaction, biological informatics method analysis is carried out according to the whole genome of 418 vibrio parahaemolyticus and 18 vibrio parahaemolyticus specific gene sequences in a public database, specific genes and specific gene regions of 57K antigens of vibrio parahaemolyticus are obtained and screened, the obtained specific genes of 57K antigens of vibrio parahaemolyticus are designed, the primer group can be ensured to simultaneously detect the K antigen genotyping of 57 vibrio parahaemolyticus based on the fluorescent probe melting curve method, and the detection time and the detection accuracy of the antigen genotyping of vibrio parahaemolyticus are improved.

The kit provided by the invention contains the primer group, and can be used for rapidly, efficiently and simultaneously detecting the K antigen genotyping of 57 vibrio parahaemolyticus by adopting a fluorescent probe melting curve method, so that the detection time and the detection accuracy of the antigen genotyping of the vibrio parahaemolyticus are improved, the higher sensitivity and the lower cost are ensured, and the kit is favorable for wide application.

The method for detecting the K antigen genotyping of the vibrio parahaemolyticus provided by the invention is characterized in that the kit for detecting the K antigen genotyping of the vibrio parahaemolyticus is utilized, and the fluorescent probe melting curve technology based on multiple hybridization connection reaction is adopted to detect the K antigen genotyping of the vibrio parahaemolyticus. Because the kit contains the primer group, the kit can be used for rapidly, efficiently and simultaneously detecting the K antigen genotyping of 57 vibrio parahaemolyticus by adopting a fluorescent probe melting curve method, so that the detection time and the detection accuracy of the antigen genotyping of the vibrio parahaemolyticus are improved, the higher sensitivity and the lower cost are ensured, and the kit is favorable for wide application.

Drawings

FIG. 1 is a sample Tm graph of a first tube ROX fluorescence channel provided in example 2 of the present invention.

FIG. 2 is a graph showing the Tm of a sample in a Cy5 fluorescence channel of a first tube provided in example 2 of the present invention.

FIG. 3 is a sample Tm graph of a first tube FAM fluorescence channel provided in example 2 of the present invention.

FIG. 4 is a sample Tm graph of a second tube ROX fluorescence channel provided in example 2 of the present invention.

FIG. 5 is a graph showing the Tm of a sample in a Cy5 fluorescence channel of a second tube provided in example 2 of the present invention.

FIG. 6 is a sample Tm graph of a second tube FAM fluorescence channel provided in example 2 of the present invention.

FIG. 7 is a sample Tm graph of a third tube ROX fluorescence channel provided in example 2 of the present invention.

FIG. 8 is a graph showing the sample Tm of the Cy5 fluorescence channel in the third tube provided in example 2 of the present invention.

Detailed Description

In order to make the objects, technical solutions and technical effects of the embodiments of the present invention clearer, the technical solutions in the embodiments of the present invention will be clearly and completely described below, and it is obvious that the described embodiments are some embodiments of the present invention, but not all embodiments. All other embodiments obtained by a person of ordinary skill in the art without any inventive step in connection with the embodiments of the present invention shall fall within the scope of protection of the present invention.

In the description of the present invention, it is to be understood that the terms "first", "second" and the like are used for descriptive purposes only and are not to be construed as indicating or implying relative importance or implying any number of technical features indicated. Thus, a feature defined as "first" or "second" may explicitly or implicitly include one or more of that feature. In the description of the present invention, "a plurality" means two or more unless specifically defined otherwise.

The embodiment of the invention provides a primer group for detecting K antigen genotyping of vibrio parahaemolyticus, the primer group is used for detecting 57 types of K antigen genotyping of vibrio parahaemolyticus based on a fluorescent probe melting curve method, and the primer group comprises:

Specifically, according to the bioinformatics method analysis of the 418 strains of vibrio parahaemolyticus whole genome and the 18 strains of vibrio parahaemolyticus specific gene sequence analysis in the public database, the specific names of the specific genes of the 57K antigens of vibrio parahaemolyticus obtained and screened are shown in the following table 1, and the 57K antigens correspond to the 57 specific genes.

Further, the present example was conducted to examine the K antigen genotyping of 57 Vibrio parahaemolyticus. On the basis of the specific genes of 57K antigens of vibrio parahaemolyticus disclosed in Table 1, the primers for hybrid ligation described in SEQ ID Nos. 1-114 are designed, and the total number is 57 pairs of primer pairs for hybrid ligation. The design of the primer sequence of the 57 pairs of hybridization connection primer pairs comprises the following steps: according to 418 strains of vibrio parahaemolyticus whole genome carry out bioinformatics method analysis and search 18 strains of vibrio parahaemolyticus specific genome sequences from NCBI database, finally 57 specific vibrio parahaemolyticus K antigen gene sequences are obtained by analysis, and the 57 specific vibrio parahaemolyticus K antigen gene sequences are compared and analyzed, thereby ensuring that no cross is generated with other bacteria genome. Aiming at the 57 specific vibrio parahaemolyticus K antigen gene sequences, a plurality of pairs of hybridization connecting primers are respectively designed and screened, and the primers with higher Tm peak value and no non-specific peak generated in PCR amplification reaction are obtained by screening. In the invention, because 57 pairs of hybridization connecting primers need to be reasonably distributed into 3 tubes and mixed for testing, interference does not occur in the detection process between the hybridization connecting primers mixed into one tube, and meanwhile, the corresponding antigen genes need to be specifically amplified. The embodiment of the invention is continuously optimized, and the 57 pairs of hybridization connection primer pairs are obtained by screening, so that the 57 types of vibrio parahaemolyticus K antigen genotyping can be simultaneously detected through a three-tube test, and the detection speed and the accuracy are high.

Specifically, the 57 pairs of hybrid ligation primer pairs comprise an upstream hybrid ligation primer and a downstream hybrid ligation primer. Further, the primer sequence structure of the upstream hybridization connecting primer comprises four parts, and the four parts sequentially comprise a universal primer upstream sequence (P1), a spacing sequence (S), a melting point temperature tag sequence (Tm tag) and an upstream hybridization recognition sequence (H1) from the 5' end; wherein the universal upstream primer sequence is used for amplifying the whole primer; the spacer sequence is used for connecting the universal upstream primer sequence and the melting point temperature label sequence; the melting point temperature label sequence is used for hybridizing with the corresponding fluorescent probe and generating a corresponding Tm value; the upstream hybridization recognition sequence is an upstream hybridization recognition sequence that hybridizes to a specific antigen gene to be detected. The primer sequence result of the downstream hybridization connecting primer comprises two parts, namely a downstream hybridization recognition sequence (H2) and a downstream universal primer (P2) from the 5' end; the downstream hybrid recognition sequence is a downstream hybrid recognition sequence hybridized with the specific antigen gene to be detected, the sequence and the upstream hybrid recognition sequence finally form a completely complementary sequence segment with the specific antigen gene to be detected, and the downstream universal primer is used for amplifying the whole primer. Specifically, the specific sequences of the primer sets for detecting the K antigen genotyping of 57 Vibrio parahaemolyticus based on the fluorescent probe melting curve method are shown in Table 2. In the embodiment of the invention, in order to ensure that the 57 vibrio parahaemolyticus K antigen genotypes are detected simultaneously and that the nonspecific amplification does not occur in the test process, the 57 vibrio parahaemolyticus K antigen genotypes are divided into three tubes. Wherein, the 1 st tube comprises a hybridization connecting primer of twenty one antigen genotyping of K70, K68, K17, K56, K29, K25, K8, K6, K18, K42, K44, K5, K60, K11, K41, K12, K28, K13, K9, K36 and K3; the 2 nd tube comprises a hybridization connecting primer of twenty-one antigen genotyping of K1, K4, K19, K20, K55, K63, K34, K65, K49, K48, K30, K21, K67, K69, K71, K38, K37, K33, K32, K31 and K23; the 3 rd tube comprises fifteen hybrid connecting primers for genotyping of K39, K22, K15, K45, K40, K43, K24, K7, K54, K59, K46, K51, K52, K64 and K53 antigens.

Preferably, the primer set further comprises a melting point temperature tag, wherein the melting point temperature tag is a sequence component in the upstream primer design and is used for hybridizing with a corresponding fluorescent probe and generating a corresponding Tm value. Wherein the melting point temperature label is selected from any one of a ROX channel melting point temperature label, a Cy5 channel melting point temperature label and a FAM channel melting point temperature label. Different melting point temperature labels of different channels correspond to different Tm temperature values, so that a plurality of different melting point temperature labels are arranged, and the K antigen genotyping of vibrio parahaemolyticus can be specifically detected.

Further preferably, as shown in Table 3, the ROX channel melting point temperature tags include ROX-1 melting point temperature tag, ROX-2 melting point temperature tag, ROX-3 melting point temperature tag, ROX-4 melting point temperature tag, ROX-5 melting point temperature tag, ROX-6 melting point temperature tag, ROX-7 melting point temperature tag and ROX-8 melting point temperature tag, wherein the sequence of the ROX-1 melting point temperature tag is shown in SEQ ID No.115, the sequence of the ROX-2 melting point temperature tag is shown in SEQ ID No.116, the sequence of the ROX-3 melting point temperature tag is shown in SEQ ID No.117, the sequence of the ROX-4 melting point temperature tag is shown in SEQ ID No.118, the sequence of the ROX-5 melting point temperature tag is shown in SEQ ID No.119, and the sequence of the ROX-6 melting point temperature tag is shown in SEQ ID No.120, The sequence of the ROX-7 melting point temperature label is shown as SEQ ID No.121, and the sequence of the ROX-8 melting point temperature label is shown as SEQ ID No. 122.

More preferably, as shown in Table 3, the Cy5 melting point temperature tags include Cy5-1 melting point temperature tag, Cy5-2 melting point temperature tag, Cy5-3 melting point temperature tag, Cy5-4 melting point temperature tag, Cy5-5 melting point temperature tag, Cy5-6 melting point temperature tag, and Cy5-7 melting point temperature tag, wherein the sequence of the Cy5-1 melting point temperature tag is shown in SEQ ID No.123, the sequence of the Cy5-2 melting point temperature tag is shown in SEQ ID No.124, the sequence of the Cy5-3 melting point temperature tag is shown in SEQ ID No.125, the sequence of the Cy5-4 melting point temperature tag is shown in SEQ ID No.126, the sequence of the Cy5-5 melting point temperature tag is shown in SEQ ID No.127, and the sequence of the Cy5-6 melting point temperature tag is shown in SEQ ID No.128, The sequence of the Cy5-7 melting point temperature label is shown in SEQ ID No. 129.

Further preferably, as shown in table 3, the FAM melting point temperature labels include a FAM-1 melting point temperature label, a FAM-2 melting point temperature label, a FAM-3 melting point temperature label, a FAM-4 melting point temperature label, a FAM-5 melting point temperature label, and a FAM-6 melting point temperature label, wherein the sequence of the FAM-1 melting point temperature label is shown as SEQ ID No.130, the sequence of the FAM-2 melting point temperature label is shown as SEQ ID No.131, the sequence of the FAM-3 melting point temperature label is shown as SEQ ID No.132, the sequence of the FAM-4 melting point temperature label is shown as SEQ ID No.133, the sequence of the FAM-5 melting point temperature label is shown as SEQ ID No.134, and the sequence of the FAM-6 melting point temperature label is shown as SEQ ID No. 135.

In the invention, the technical principle of detecting by adopting the primer group based on a fluorescent probe melting curve method is as follows: firstly, carrying out hybridization reaction, so that each pair of upstream hybridization connecting primer and downstream hybridization connecting primer successfully identifies two continuous specific sequences of the same target gene respectively; secondly, performing ligation reaction to connect each pair of upstream hybrid ligation primers and downstream hybrid ligation primers into a whole under the action of specific ligase, and using the integrated primer as a template in the subsequent step; thirdly, performing a fluorescent probe melting curve method PCR amplification reaction, and performing amplification by using the hybridization connecting product as a template, wherein the universal primer can amplify the hybridization connecting product, and the fluorescent probe can be hybridized with the amplification product of the connecting product; and finally, carrying out fluorescence analysis reaction by a fluorescence probe melting curve method, correspondingly analyzing the collected fluorescence signals to obtain a Tm value, and detecting according to signal peaks of different Tm values to obtain the specific vibrio parahaemolyticus K antigen genotyping.

TABLE 1

TABLE 2

TABLE 3

The invention also provides a kit for detecting the K antigen genotyping of the vibrio parahaemolyticus, and the kit comprises the primer group. The kit provided by the invention contains the primer group, and can be used for rapidly, efficiently and simultaneously detecting the K antigen genotyping of 57 vibrio parahaemolyticus by adopting a fluorescent probe melting curve method, so that the detection time and the detection accuracy of the antigen genotyping of the vibrio parahaemolyticus are improved, the higher sensitivity and the lower cost are ensured, and the kit is favorable for wide application.

Preferably, the kit further comprises ligase and a ligase buffer; wherein the primer set, the ligase, and the ligase buffer are used for a hybridization ligation reaction.

Preferably, the kit further comprises PCR buffer solution and MgCl₂dNTP, rTaq enzyme, upstream and downstream universal primers and a fluorescent probe; wherein, the PCR buffer solution and the MgCl₂The dNTP, the rTaq enzyme, the upstream and downstream universal primers and the fluorescent probe are used for a detection reaction of a fluorescent probe melting curve method.

Preferably, as shown in Table 4, the upstream universal primer (F) is SEQ ID No.136, and the primer sequence thereof is 5'-GTGGCAGGGCGCTACGAACAAT-3'; the downstream universal primer (R) is SEQ ID No.137, and the primer sequence is 5'-GCCCAGCAAGATCCAATCTCA-3'.

Preferably, the fluorescent probe is any one selected from the group consisting of a ROX fluorescent probe, a Cy5 fluorescent probe, and a FAM fluorescent probe. The fluorescent probe is a sequence used for combining with a melting point temperature label sequence in an upstream primer in the process of probe melting curve reaction. Further preferably, as shown in Table 4, the ROX fluorescent probe is SEQ ID No.138, and the sequence (5 '-3') thereof is ROX-ACGACTCTGGCTGCTCGTTCGTGACG-BHQ 2; the FAM fluorescent probe is SEQ ID No.139, and the sequence (5 '-3') of the FAM fluorescent probe is FAM-TCGGTCCTTCATCGCTCAGCCTTCACCGG-BHQ 1; the Cy5 fluorescent probe is SEQ ID No.140, and the sequence (5 '-3') thereof is Cy5-CGGTGAGGCCCTTGGCAGGTTGCTATCACCC-BHQ 2.

TABLE 4

Correspondingly, the invention also provides a method for detecting the K antigen genotyping of the vibrio parahaemolyticus, provides a kit for detecting the K antigen genotyping of the vibrio parahaemolyticus, and detects the K antigen genotyping of the vibrio parahaemolyticus by adopting a fluorescent probe melting curve technology based on multiple hybridization connection reaction.

Preferably, the method for detecting the K antigen genotyping of the vibrio parahaemolyticus sequentially comprises a hybridization connection reaction and a fluorescence probe melting curve method detection reaction, and further preferably, the fluorescence probe melting curve method detection reaction sequentially comprises a fluorescence probe melting curve method PCR amplification reaction and then a fluorescence probe melting curve method fluorescence analysis reaction.

Preferably, the hybridization ligation reaction comprises the following steps:

s01, mixing the primer group solution with a vibrio parahaemolyticus DNA template, and performing first denaturation treatment to obtain a primer group mixed solution;

and S02, mixing the primer group mixed solution with the ligase and the ligase buffer solution, and carrying out hybridization and ligation reaction to obtain a hybridization and ligation product.

In the above step S01, the primer set solution is mixed with the Vibrio parahaemolyticus DNA template and subjected to a first denaturation treatment to obtain a primer set mixture, preferably, the primer set synthesized is dissolved to obtain a mother liquor with a concentration of 5. mu. mol/L, and further diluted to obtain a primer set solution with an initial concentration of 10 nmol/L, and the test is performed.

In a preferred embodiment of the present invention, in the step of mixing the primer set solution with the Vibrio parahaemolyticus DNA template, the amount of the primer set solution added is 1.5u L, and the amount of the Vibrio parahaemolyticus DNA template added is 5u L, and after mixing the amounts added, the first denaturation treatment is performed, and further preferably, in the step of performing the first denaturation treatment to obtain the primer set mixture, the conditions of the first denaturation treatment are such that denaturation is performed at 95 ℃ for 5 minutes and suspension is performed at 75 ℃ (taking out and adding 3.5u L hybridization ligation reaction solution).

In the above step S02, the primer set mixture is mixed with the ligase and the ligase buffer solution, and a hybrid ligation reaction is performed to obtain a hybrid ligation product, preferably, the reaction system is 3.5U L hybrid ligation reaction solution comprising 1U/μ L ligase with 1 μ L units, 1 μ L ligase buffer solution, and 1.5 μ L ultrapure water, and more preferably, in the step of performing the hybrid ligation reaction to obtain the hybrid ligation product, the conditions of the hybrid ligation reaction are 60 minutes at 60 ℃, 5 minutes at 95 ℃ for denaturation, and 4 ℃ for storage.

Further, the prepared hybrid ligation product is used as a template to carry out the detection reaction of the fluorescent probe melting curve method.

Preferably, the fluorescence probe melting curve method detection reaction comprises performing fluorescence probe melting curve method PCR amplification reaction, and then performing fluorescence analysis reaction by fluorescence probe melting curve method.

Further preferably, the reaction system of the fluorescence probe melting curve method detection reaction is as follows:

TABLE 5

Further, the fluorescent probe melting curve method detection reaction comprises a fluorescent probe melting curve method PCR amplification reaction, and then a fluorescent probe melting curve method fluorescence analysis reaction. In a preferred embodiment of the present invention, the conditions for performing the fluorescence probe melting curve PCR amplification reaction are as follows: pre-denaturation at 95 ℃ for 3 min, denaturation at 95 ℃ for 10 sec, annealing at 57 ℃ for 20 sec, extension at 72 ℃ for 20 sec, 38 cycles of reaction set up, and fluorescence signals of ROX, Cy5, FAM were collected at 57 ℃. Further, after performing a fluorescence probe melting curve method PCR amplification reaction, performing a fluorescence analysis reaction by a fluorescence probe melting curve method, wherein the conditions for performing the fluorescence analysis reaction by the fluorescence probe melting curve method are as follows: denaturation at 95 ℃ for 1 min, hybridization at 40 ℃ for 2 min, gradual temperature rise from 40 ℃ to 85 ℃, and collection of fluorescence signals of ROX, Cy5, FAM, wherein the fluorescence signals are collected at 0.5 ℃ per rise from 40 ℃ to 85 ℃.

The following will explain the present invention by way of specific examples.

Example 1

Primer set design

Designing primer sequences of SEQ ID No.1 to SEQ ID No.114 in the above Table 2 according to the specific genes of 57K antigens of Vibrio parahaemolyticus provided in the above Table 1, wherein the primer sequences include fluorescent probes of SEQ ID No.115 to SEQ ID No.135 in the above Table 3; obtaining a primer group for detecting K antigen genotyping of vibrio parahaemolyticus.

Example 2

Detection of K antigen genotyping of 57 vibrio parahaemolyticus

Genotyping 57 vibrio parahaemolyticus K antigens into 3 tubes, and simultaneously carrying out detection in the following steps; wherein, the 1 st tube comprises a hybridization connecting primer of twenty one antigen genotyping of K70, K68, K17, K56, K29, K25, K8, K6, K18, K42, K44, K5, K60, K11, K41, K12, K28, K13, K9, K36 and K3; the 2 nd tube comprises a hybridization connecting primer of twenty-one antigen genotyping of K1, K4, K19, K20, K55, K63, K34, K65, K49, K48, K30, K21, K67, K69, K71, K38, K37, K33, K32, K31 and K23; the 3 rd tube comprises fifteen hybrid connecting primers for genotyping of K39, K22, K15, K45, K40, K43, K24, K7, K54, K59, K46, K51, K52, K64 and K53 antigens.

(1) Performing a hybridization ligation reaction

The method comprises the following steps of mixing a primer group solution with a Vibrio parahaemolyticus DNA template, and carrying out first denaturation treatment to obtain a primer group mixed solution, wherein the addition amount of the primer group solution is 1.5U L, the addition amount of the Vibrio parahaemolyticus DNA template is 5U L, the reaction conditions are that denaturation is carried out for 5 minutes at 95 ℃, hybridization reaction liquid is suspended (taken out and 3.5U L is added), the primer group mixed solution is mixed with ligase and ligase buffer solution, and hybridization ligation reaction is carried out to obtain a hybridization ligation product, the reaction system is that 3.5U L hybridization ligation reaction liquid comprises 1 mu L unit of 1U/mu L ligase, 1 mu L ligase buffer solution and 1.5 mu L ultrapure water, and the reaction conditions are that ligation is carried out for 60 minutes at 60 ℃, denaturation is carried out for 5 minutes at 95 ℃, and the reaction is stored at 4 ℃.

(2) Performing PCR amplification reaction by fluorescence probe melting curve method

The reaction system of the fluorescence probe melting curve method detection reaction is as shown in table 5, and the reagents are mixed in sequence for reaction, wherein the reaction conditions are as follows: pre-denaturation at 95 ℃ for 3 min, denaturation at 95 ℃ for 10 sec, annealing at 57 ℃ for 20 sec, extension at 72 ℃ for 20 sec, 38 cycles of reaction set up, and fluorescence signals of ROX, Cy5, FAM were collected at 57 ℃.

TABLE 5

(3) And carrying out fluorescence analysis reaction by a fluorescence probe melting curve method. Wherein the conditions for performing the fluorescence analysis reaction by the fluorescence probe melting curve method are as follows: denaturation at 95 ℃ for 1 min, hybridization at 40 ℃ for 2 min, gradual temperature rise from 40 ℃ to 85 ℃, and collection of fluorescence signals of ROX, Cy5, FAM, wherein the fluorescence signals are collected at 0.5 ℃ per rise from 40 ℃ to 85 ℃.

Example 3

Evaluation of methodology

488 clinical strains were selected and tested by the method for detecting K antigen genotyping of 57 Vibrio parahaemolyticus of example 2, and the sensitivity and specificity of the method for detecting K antigen genotyping of 57 Vibrio parahaemolyticus of example 2 were examined by analyzing the same by conventional serum methods.

Analysis of results

Example 2 analysis of results

Analysis of the data from the first tube, as shown in table 6 below, from fig. 1, the Tm temperature peak for the K70 antigen was 50.5 ℃, the Tm temperature peak for the K68 antigen was 54.0 ℃, the Tm temperature peak for the K17 antigen was 57.5 ℃, the Tm temperature peak for the K56 antigen was 60.0 ℃, the Tm temperature peak for the K29 antigen was 63.5 ℃, the Tm temperature peak for the K25 antigen was 66.5 ℃, the Tm temperature peak for the K8 antigen was 70.0 ℃, and the Tm temperature peak for the K6 antigen was 74.5 ℃ in the first tube ROX fluorescence channel (NTC is negative control); as can be seen from fig. 2, in the Cy5 fluorescence channel of the first tube (NTC is negative control), the Tm temperature peak of K18 antigen was 53.5 ℃, the Tm temperature peak of K42 antigen was 56.0 ℃, the Tm temperature peak of K44 antigen was 58.5 ℃, the Tm temperature peak of K5 antigen was 61.0 ℃, the Tm temperature peak of K60 antigen was 66.0 ℃, the Tm temperature peak of K11 antigen was 70.5 ℃, and the Tm temperature peak of K41 antigen was 74.0 ℃; as can be seen from fig. 3, in the first tube FAM fluorescence channel (NTC is negative control), the Tm temperature peak of K12 antigen is 51.0 ℃, the Tm temperature peak of K28 antigen is 57.0 ℃, the Tm temperature peak of K13 antigen is 61.5 ℃, the Tm temperature peak of K9 antigen is 66.0 ℃, the Tm temperature peak of K36 antigen is 70.0 ℃, and the Tm temperature peak of K3 antigen is 74.5 ℃.

TABLE 6

Analysis of the data of the second tube, as shown in table 7 below, from fig. 4, it can be seen that, in the second tube ROX fluorescence channel (NTC is negative control), the Tm temperature peak of K1 antigen was 51.0 ℃, the Tm temperature peak of K4 antigen was 54.0 ℃, the Tm temperature peak of K19 antigen was 57.0 ℃, the Tm temperature peak of K20 antigen was 59.0 ℃, the Tm temperature peak of K55 antigen was 62.5 ℃, the Tm temperature peak of K63 antigen was 66.5 ℃, the Tm temperature peak of K34 antigen was 70.0 ℃, and the Tm temperature peak of K65 antigen was 73.5 ℃; as can be seen from fig. 5, in the Cy5 fluorescence channel of the second tube (NTC is negative control), the Tm temperature peak of K49 antigen was 50.5 ℃, the Tm temperature peak of K48 antigen was 55.5 ℃, the Tm temperature peak of K30 antigen was 58.5 ℃, the Tm temperature peak of K21 antigen was 61.5 ℃, the Tm temperature peak of K67 antigen was 66.0 ℃, the Tm temperature peak of K69 antigen was 70.5 ℃, and the Tm temperature peak of K71 antigen was 74.5 ℃; as can be seen from fig. 6, in the second tube FAM fluorescence channel (NTC as negative control), the Tm temperature peak of the K38 antigen was 52.0 ℃, the Tm temperature peak of the K37 antigen was 57.0 ℃, the Tm temperature peak of the K33 antigen was 61.0 ℃, the Tm temperature peak of the K32 antigen was 65.5 ℃, the Tm temperature peak of the K31 antigen was 69.5 ℃, and the Tm temperature peak of the K23 antigen was 74.0 ℃.

TABLE 7

Analysis of the data of the third tube, as shown in table 8 below, from fig. 7, it can be seen that, in the ROX fluorescence channel of the third tube (NTC is negative control), the Tm temperature peak of the K39 antigen is 50.5 ℃, the Tm temperature peak of the K22 antigen is 54.0 ℃, the Tm temperature peak of the K15 antigen is 57.0 ℃, the Tm temperature peak of the K45 antigen is 59.0 ℃, the Tm temperature peak of the K40 antigen is 62.5 ℃, the Tm temperature peak of the K43 antigen is 66.5 ℃, the Tm temperature peak of the K24 antigen is 70.0 ℃, and the Tm temperature peak of the K7 antigen is 74.0 ℃; as can be seen from fig. 8, in the third tube Cy5 fluorescence channel (NTC is negative control), the Tm temperature peak value of K54 antigen was 53.0 ℃, the Tm temperature peak value of K59 antigen was 56.0 ℃, the Tm temperature peak value of K46 antigen was 58.5 ℃, the Tm temperature peak value of K51 antigen was 61.5 ℃, the Tm temperature peak value of K52 antigen was 66.0 ℃, the Tm temperature peak value of K64 antigen was 70.5 ℃, and the Tm temperature peak value of K53 antigen was 74.0 ℃.

TABLE 8

Further, the minimum detection limits of the first tube, the second tube and the third tube were analyzed, specifically, as shown in table 9, the minimum detection limit of the first tube was 0.1 to 1.0ng/μ L, as shown in table 10, the minimum detection limit of the second tube was 0.1 to 1.0ng/μ L, as shown in table 11, the minimum detection limit of the third tube was 0.1ng/μ L, that is, the detection capability level of the method shown in example 2 was 0.1 to 1.0ng/μ L.

TABLE 9

Watch 10

TABLE 11

Example 3 analysis of results

By comparing the detection method of 57 Vibrio parahaemolyticus K antigen genotypes of example 2 with the conventional serological method, with reference to the serological method, the fluorescence probe melting curve method as described in example 2 of Table 12 below has a sensitivity of 100%, a specificity of 100% and a Kappa value of more than 0.75 of 1.0. This indicates that the fluorescent probe melting curve method has excellent consistency with the conventional serum method, i.e., the "fluorescent probe melting curve method" described in example 2 can be used as a rapid typing molecular identification method for the K antigen of Vibrio parahaemolyticus.

TABLE 12

Note that the sensitivity of the fluorescence probe melting curve method is 100% for A/(A + C) × 100%

The specificity of the fluorescence probe melting curve method is that D/(B + D) × 100 is 100%

Coincidence rate of fluorescent probe melting curve method (A + D)/(A + B + C + D) × 100 (100%: 100%

Kappa-Pe)/(1-Pe-1 of the fluorescence probe melting curve method

Therefore, the primer group for detecting K antigen genotyping of Vibrio parahaemolyticus provided by the invention is based on a fluorescent probe melting curve technology of multiple hybridization connection reaction, biological informatics method analysis is carried out according to the whole genome of 418 strains of Vibrio parahaemolyticus, 18 strains of Vibrio parahaemolyticus specific gene sequences in a public database are analyzed, specific genes and specific gene regions of 57 types of K antigens of Vibrio parahaemolyticus are obtained and screened, the obtained specific genes of 57 types of K antigens of Vibrio parahaemolyticus are designed, the primer group can be ensured to simultaneously detect the K antigen genotyping of 57 types of Vibrio parahaemolyticus based on the fluorescent probe melting curve method, the detection time and the detection accuracy of the antigen genotyping of Vibrio parahaemolyticus are improved, and meanwhile, higher sensitivity and specificity can be ensured.

The above description is only for the purpose of illustrating the preferred embodiments of the present invention and is not to be construed as limiting the invention, and any modifications, equivalents and improvements made within the spirit and principle of the present invention are intended to be included within the scope of the present invention.

SEQUENCE LISTING

<110> Shenzhen disease prevention and control center

<120> primer group and kit for detecting K antigen genotyping of vibrio parahaemolyticus

<130>2020-3-6

<160>140

<170>PatentIn version 3.3

<210>1

<211>82

<212>DNA

<213> Artificial Synthesis

<400>1

gtggcagggc gctacgaaca atcctaacga ctctatctgc ttgttagtga cgatgggatt 60

agctatacct aggctagccg gt 82

<210>2

<211>50

<212>DNA

<213> Artificial Synthesis

<400>2

gctcatggag accctaacta taactcagtt gagattggat cttgctgggc 50

<210>3

<211>85

<212>DNA

<213> Artificial Synthesis

<400>3

gtggcagggc gctacgaaca atcctatcgg tccttcatcg ctcagccttc accggttctt 60

gctgacgatc tatgtgttaa cgtag 85

<210>4

<211>51

<212>DNA

<213> Artificial Synthesis

<400>4

atggtgatgg cgttcttcag cagatggtga tgagattgga tcttgctggg c 51

<210>5

<211>81

<212>DNA

<213> Artificial Synthesis

<400>5

gtggcagggc gctacgaaca atcctaacga ctatggcttc tcgttggtga cgttggtatt 60

ggtgttgact acggatatgg t 81

<210>6

<211>52

<212>DNA

<213> Artificial Synthesis

<400>6

gctccaagaa tgcaaggttt tctgagtgaa ctgagattgg atcttgctgg gc 52

<210>7

<211>86

<212>DNA

<213> Artificial Synthesis

<400>7

gtggcagggc gctacgaaca atcctacggt gaggaccttt gcagattggc atcaccccgg 60

aaggctgtcg ctctacttct atatcg 86

<210>8

<211>50

<212>DNA

<213> Artificial Synthesis

<400>8

agatgagcca acatttatta gttcgggttt gagattggat cttgctgggc 50

<210>9

<211>83

<212>DNA

<213> Artificial Synthesis

<400>9

gtggcagggc gctacgaaca atcctaacga ctctggctgc tcgttcgtga cgccgttaga 60

acctaagtct aattatgcag tca 83

<210>10

<211>54

<212>DNA

<213> Artificial Synthesis

<400>10

ctgggctata tttctatgac agtcgcgtaa tagtgagatt ggatcttgct gggc 54

<210>11

<211>82

<212>DNA

<213> Artificial Synthesis

<400>11

gtggcagggc gctacgaaca atcctaacga ctctggctgc tcgttcgtga cgatcttatc 60

gagtcaacag ctatgtatgc ga 82

<210>12

<211>56

<212>DNA

<213> Artificial Synthesis

<400>12

gacttagtta cttctactat ggcgatggtt tggagtgaga ttggatcttg ctgggc 56

<210>13

<211>82

<212>DNA

<213> Artificial Synthesis

<400>13

gtggcagggc gctacgaaca atcctaacga ctctagctgc tcgttcgtga cggaacttga 60

ttgaagcaag ggaacattct tt 82

<210>14

<211>52

<212>DNA

<213> Artificial Synthesis

<400>14

cggtgagtat gatttaatac attgtcactt ctgagattgg atcttgctgg gc 52

<210>15

<211>86

<212>DNA

<213> Artificial Synthesis

<400>15

gtggcagggc gctacgaaca atcctatcgg tcctttatcg ctcacccttc accggcggag 60

tgattataag gaggagtgct ataatg 86

<210>16

<211>49

<212>DNA

<213> Artificial Synthesis

<400>16

tgggttcggg aatcggtgtc agtgttaatg agattggatc ttgctgggc 49

<210>17

<211>88

<212>DNA

<213> Artificial Synthesis

<400>17

gtggcagggc gctacgaaca atcctacggt gaagcccttg gcaggtcggt atcacccggt 60

tcggttaaga taagtacttt gggtagat 88

<210>18

<211>50

<212>DNA

<213> Artificial Synthesis

<400>18

gtttcattgc actcgctctg cttattacgt gagattggat cttgctgggc 50

<210>19

<211>86

<212>DNA

<213> Artificial Synthesis

<400>19

gtggcagggc gctacgaaca atcctatcgc tccttcatag ctcagacttc atcgggaact 60

agtaagttta tataacccgg cattgc 86

<210>20

<211>56

<212>DNA

<213> Artificial Synthesis

<400>20

attgtattga agagcaacgt gattttcctc aatcgtgaga ttggatcttg ctgggc 56

<210>21

<211>85

<212>DNA

<213> Artificial Synthesis

<400>21

gtggcagggc gctacgaaca atcctatcgc tccttcatag ctcagacttc atcgggacct 60

cttggatggg attctaatat acacg 85

<210>22

<211>54

<212>DNA

<213> Artificial Synthesis

<400>22

ataagtttga taaagtattc acttggagca ctctgagatt ggatcttgct gggc 54

<210>23

<211>79

<212>DNA

<213> Artificial Synthesis

<400>23

gtggcagggc gctacgaaca atcctaacga ctctagcttc tcgttagtga cgacaggaca 60

tacccaaaag acattggca 79

<210>24

<211>50

<212>DNA

<213> Artificial Synthesis

<400>24

ctggctggac tggaacccag ttcttcatgt gagattggat cttgctgggc 50

<210>25

<211>81

<212>DNA

<213> Artificial Synthesis

<400>25

gtggcagggc gctacgaaca atcctaacga ctctagcttc tcgttagtga cggcttcttg 60

accacacgtt attgtaccaa t 81

<210>26

<211>51

<212>DNA

<213> Artificial Synthesis

<400>26

ctttgctagg tacaaagcca aaagcagcca tgagattgga tcttgctggg c 51

<210>27

<211>82

<212>DNA

<213> Artificial Synthesis

<400>27

gtggcagggc gctacgaaca atcctacggt gaagccattg ccaggtggta tacccgagtt 60

ggcattgatg ctcatctctc ct 82

<210>28

<211>56

<212>DNA

<213> Artificial Synthesis

<400>28

atctattctg ttataaaatt gagtgtctac ggacgtgaga ttggatcttg ctgggc 56

<210>29

<211>83

<212>DNA

<213> Artificial Synthesis

<400>29

gtggcagggc gctacgaaca atcctaacga ctctagcttc tcgttagtga cggatatgca 60

agacttgcaa aagctcatca caa 83

<210>30

<211>50

<212>DNA

<213> Artificial Synthesis

<400>30

aatcatctag gttgatgtgg gctctttgtt gagattggat cttgctgggc 50

<210>31

<211>83

<212>DNA

<213> Artificial Synthesis

<400>31

gtggcagggc gctacgaaca atcctaacga cactggctgc tggtccgtga cggcactgaa 60

tacgccttaa aaactctaat agc 83

<210>32

<211>51

<212>DNA

<213> Artificial Synthesis

<400>32

ttgggcttca gttgttgcaa ctattggtgt tgagattgga tcttgctggg c 51

<210>33

<211>87

<212>DNA

<213> Artificial Synthesis

<400>33

gtggcagggc gctacgaaca atcctacggt gaggaccttt gcagattggc atcacccgtt 60

agctgtggaa gacgtgtatt gtttgaa 87

<210>34

<211>55

<212>DNA

<213> Artificial Synthesis

<400>34

aactgtaaca acgacataat gatactattc gatgtgagat tggatcttgc tgggc 55

<210>35

<211>84

<212>DNA

<213> Artificial Synthesis

<400>35

gtggcagggc gctacgaaca atcctaacga ctatggcttc tcgttggtga cgtttcgaca 60

atccaatttc tgagcgagtc ttta 84

<210>36

<211>52

<212>DNA

<213> Artificial Synthesis

<400>36

ccttcattta tgcgtttaca aatccatcta ctgagattgg atcttgctgg gc 52

<210>37

<211>85

<212>DNA

<213> Artificial Synthesis

<400>37

gtggcagggc gctacgaaca atcctatcgg tccttcatcg ctcagccttc accggcgaaa 60

ttcatagcga tcttgagact ttcaa 85

<210>38

<211>52

<212>DNA

<213> Artificial Synthesis

<400>38

tcttggttgt aggaatttat gccatatacc atgagattgg atcttgctgg gc 52

<210>39

<211>83

<212>DNA

<213> Artificial Synthesis

<400>39

gtggcagggc gctacgaaca atcctaacga ctctagctgc tcgttcgtga cgcttacacg 60

caattttaga ggcgttacaa tat 83

<210>40

<211>55

<212>DNA

<213> Artificial Synthesis

<400>40

ctgctattgg tattgggatt gcactatctc tagctgagat tggatcttgc tgggc 55

<210>41

<211>85

<212>DNA

<213> Artificial Synthesis

<400>41

gtggcagggc gctacgaaca atcctaacga ctctgtcttc tcgttcgtga cggcttatct 60

agtcgttctt catttggtga gaaag 85

<210>42

<211>51

<212>DNA

<213> Artificial Synthesis

<400>42

ctttcaactc caaaagtatc gtgattagaa tgagattgga tcttgctggg c 51

<210>43

<211>84

<212>DNA

<213> Artificial Synthesis

<400>43

gtggcagggc gctacgaaca atcctatccg ttctttatcg ctcagccttc atcggccata 60

ttttgaccct tcagttaggt atcg 84

<210>44

<211>55

<212>DNA

<213> Artificial Synthesis

<400>44

ttgtttcaat cttgctgatg agctaaatga gcgatgagat tggatcttgc tgggc 55

<210>45

<211>84

<212>DNA

<213> Artificial Synthesis

<400>45

gtggcagggc gctacgaaca atcctaacga ctctagctgcttgttcgtga cgtgataagt 60

attctttgat atcgaaagtg gcga 84

<210>46

<211>52

<212>DNA

<213> Artificial Synthesis

<400>46

gtgtttacaa taagaagatt aaaattgaga gtgagattgg atcttgctgg gc 52

<210>47

<211>88

<212>DNA

<213> Artificial Synthesis

<400>47

gtggcagggc gctacgaaca atcctacggt gaggaccttt gccgattggc atcacccatt 60

caagtcatgg attactggtc cttgtatt 88

<210>48

<211>50

<212>DNA

<213> Artificial Synthesis

<400>48

ttgatcggtg ctggttggtg gcagtatggt gagattggat cttgctgggc 50

<210>49

<211>85

<212>DNA

<213> Artificial Synthesis

<400>49

gtggcagggc gctacgaaca atcctatcgg tccttcatcg ctcggccttc accggttggg 60

tatgcttccg tcatttagaa ctatt 85

<210>50

<211>51

<212>DNA

<213> Artificial Synthesis

<400>50

cactacggag atacagccaa ctactatgac tgagattgga tcttgctggg c 51

<210>51

<211>85

<212>DNA

<213> Artificial Synthesis

<400>51

gtggcagggc gctacgaaca atcctatcgg tcctttatcg ctcacccttc accggccaat 60

cgatgaacca aattaggcaa tttgc 85

<210>52

<211>51

<212>DNA

<213> Artificial Synthesis

<400>52

tgcaatcgct gtgtcacttt ttgccttgct tgagattgga tcttgctggg c 51

<210>53

<211>85

<212>DNA

<213> Artificial Synthesis

<400>53

gtggcagggc gctacgaaca atcctatcgg tccttcatgg ctcagtcttc accggggtat 60

tggattgcag ttagatgcgg agtaa 85

<210>54

<211>50

<212>DNA

<213> Artificial Synthesis

<400>54

cgaagcttca tatcaccggg atgcaaagat gagattggat cttgctgggc 50

<210>55

<211>83

<212>DNA

<213> Artificial Synthesis

<400>55

gtggcagggc gctacgaaca atcctaacga ctctagctgc tcgttcgtga cgctcacaat 60

tgtaagacga ttactttaca gca 83

<210>56

<211>53

<212>DNA

<213> Artificial Synthesis

<400>56

cggattgtat gttgattact cattaagtga aatgagattg gatcttgctg ggc 53

<210>57

<211>85

<212>DNA

<213> Artificial Synthesis

<400>57

gtggcagggc gctacgaaca atcctatcgg tccttcatcg ctcggccttc accggattgg 60

caaaaaaggt ttgtttcaat cgaat 85

<210>58

<211>55

<212>DNA

<213> Artificial Synthesis

<400>58

ctagcaatkt ggctctaagt rgtttgaatg taggtgagat tggatcttgc tgggc 55

<210>59

<211>83

<212>DNA

<213> Artificial Synthesis

<400>59

gtggcagggc gctacgaaca atcctatccg ttctttatcg ctcagccttc atcggagatt 60

ctgacctcta tgggaaaggg tat 83

<210>60

<211>50

<212>DNA

<213> Artificial Synthesis

<400>60

gggttagggt ggtccttatt tagtgatttt gagattggat cttgctgggc 50

<210>61

<211>83

<212>DNA

<213> Artificial Synthesis

<400>61

gtggcagggc gctacgaaca atcctatcgc tccttcatag ctcagacttc atcggggtat 60

cgccgttact ggcacatacc atg 83

<210>62

<211>52

<212>DNA

<213> Artificial Synthesis

<400>62

attattgtcc gctatctgtt gactttggga ttgagattgg atcttgctgg gc 52

<210>63

<211>84

<212>DNA

<213> Artificial Synthesis

<400>63

gtggcagggc gctacgaaca atcctaacga ctctatctgc ttgttagtga cggtggtagg 60

ttctttgcat acatactgct cctg 84

<210>64

<211>56

<212>DNA

<213> Artificial Synthesis

<400>64

aacgattctg tgtttcgtac aacttatatg gtgtatgaga ttggatcttg ctgggc 56

<210>65

<211>83

<212>DNA

<213> Artificial Synthesis

<400>65

gtggcagggc gctacgaaca atcctaacga ctctagctgc ttgttcgtga cgatgatagc 60

aaagatgtcg ctcatataac gag 83

<210>66

<211>55

<212>DNA

<213> Artificial Synthesis

<400>66

ttgggagatg gggtttcaag cattatttag agtttgagat tggatcttgc tgggc 55

<210>67

<211>85

<212>DNA

<213> Artificial Synthesis

<400>67

gtggcagggc gctacgaaca atcctacggt gaggcccttg gcaggttgct atcacccaaa 60

caaagctctc aaggatgcta agctt 85

<210>68

<211>54

<212>DNA

<213> Artificial Synthesis

<400>68

gatggtgcga gtatttttat tatatcgggt ggatgagatt ggatcttgct gggc 54

<210>69

<211>88

<212>DNA

<213> Artificial Synthesis

<400>69

gtggcagggc gctacgaaca atcctacggt gcggaccttt gccgattggc atcaccctgt 60

aactctaaac ctaagtcttc atggctga 88

<210>70

<211>54

<212>DNA

<213> Artificial Synthesis

<400>70

tgttttgttt tgcggtattg tcacaaaact cagtgagatt ggatcttgct gggc 54

<210>71

<211>82

<212>DNA

<213> Artificial Synthesis

<400>71

gtggcagggc gctacgaaca atcctaacga ctctgtcttc tcgttcgtga cgtttgcgtt 60

gtctctattg tattactttg cg 82

<210>72

<211>56

<212>DNA

<213> Artificial Synthesis

<400>72

ctatatttcc tagctaagga aatggggcag ataagtgaga ttggatcttg ctgggc 56

<210>73

<211>88

<212>DNA

<213> Artificial Synthesis

<400>73

gtggcagggc gctacgaacaatcctacggt gaggaccttt gccgattggc atcacccgct 60

tttgcaatga taagtaatgc tcaggtaa 88

<210>74

<211>56

<212>DNA

<213> Artificial Synthesis

<400>74

tgtatctttc tctacaagaa aatcccttgc ttggatgaga ttggatcttg ctgggc 56

<210>75

<211>83

<212>DNA

<213> Artificial Synthesis

<400>75

gtggcagggc gctacgaaca atcctaacga cactggctgc tggtccgtga cgaatactct 60

atgggtggcg atatattgcg ata 83

<210>76

<211>54

<212>DNA

<213> Artificial Synthesis

<400>76

ggctatggcg ggattgatgc aagtgcttat aagtgagatt ggatcttgct gggc 54

<210>77

<211>88

<212>DNA

<213> Artificial Synthesis

<400>77

gtggcagggc gctacgaaca atcctacggt gaggaccttt gccgattggc atcaccctgc 60

agcactctct tgattacagt gatgatta 88

<210>78

<211>54

<212>DNA

<213> Artificial Synthesis

<400>78

cggtctcgca tcaattctgg ctacttttgc tgctgagatt ggatcttgct gggc 54

<210>79

<211>87

<212>DNA

<213> Artificial Synthesis

<400>79

gtggcagggc gctacgaaca atcctacggt gcggaccttt gccgattggc atcaccccca 60

gttcgtcttt gaaacgtatt tgccaaa 87

<210>80

<211>50

<212>DNA

<213> Artificial Synthesis

<400>80

cgctcttgtt aggcttcctc tcattaattt gagattggat cttgctgggc 50

<210>81

<211>85

<212>DNA

<213> Artificial Synthesis

<400>81

gtggcagggc gctacgaaca atcctacggt gaagccattg ccaggtggta tacctgtttg 60

attataaccc ttatggtgcg attct 85

<210>82

<211>49

<212>DNA

<213> Artificial Synthesis

<400>82

ggggttaggt tcaatggggt tgtatgaatg agattggatc ttgctgggc 49

<210>83

<211>86

<212>DNA

<213> Artificial Synthesis

<400>83

gtggcagggc gctacgaaca atcctacggt gaggaccttt gcagattggc atcacccatg 60

catttaaagg agttacaacc actcca 86

<210>84

<211>50

<212>DNA

<213> Artificial Synthesis

<400>84

caggctctgg cctcgcttat tattttaggt gagattggat cttgctgggc 50

<210>85

<211>86

<212>DNA

<213> Artificial Synthesis

<400>85

gtggcagggc gctacgaaca atcctacggt gaagcccttc gcaggtcggt atcacccagc 60

tatctgatga ccttgtggca tttaaa 86

<210>86

<211>56

<212>DNA

<213> Artificial Synthesis

<400>86

gaaatggttt ctaaagtagt tcctattgtc gcctttgaga ttggatcttg ctgggc 56

<210>87

<211>85

<212>DNA

<213> Artificial Synthesis

<400>87

gtggcagggc gctacgaaca atcctacggt gaggcccttg gcaggttgct atcacccatg 60

gtgaattctg ggtaagaaac aaccg 85

<210>88

<211>56

<212>DNA

<213> Artificial Synthesis

<400>88

tacgagtctt tgggggcaat atgtattttc agctctgaga ttggatcttg ctgggc 56

<210>89

<211>85

<212>DNA

<213> Artificial Synthesis

<400>89

gtggcagggc gctacgaaca atcctacggt gaagccattg ccaggtggta taccctgtca 60

gactccggaa ttcccgcttt atcat 85

<210>90

<211>56

<212>DNA

<213> Artificial Synthesis

<400>90

ctataaagac tttgctctac gattcaagta attcgtgaga ttggatcttg ctgggc 56

<210>91

<211>82

<212>DNA

<213> Artificial Synthesis

<400>91

gtggcagggc gctacgaaca atcctaacga ctctagctgc ttgttcgtga cggctaattc 60

tcaatcaaat ggatgggact gg 82

<210>92

<211>54

<212>DNA

<213> Artificial Synthesis

<400>92

tattcataca aagattcgtt cgagcaaatt tcttgagatt ggatcttgct gggc 54

<210>93

<211>82

<212>DNA

<213> Artificial Synthesis

<400>93

gtggcagggc gctacgaaca atcctaacga cactggctgc tggtccgtga cgtagaacac 60

tcaaaccgga agttcatcgc aa 82

<210>94

<211>50

<212>DNA

<213> Artificial Synthesis

<400>94

gaatggatgc tgatgatatt tcagagccat gagattggat cttgctgggc 50

<210>95

<211>89

<212>DNA

<213> Artificial Synthesis

<400>95

gtggcagggc gctacgaaca atcctacggt gcggaccttt gccgattggc atcacccacg 60

acgagtgttc aattggatga cgatagttc 89

<210>96

<211>57

<212>DNA

<213> Artificial Synthesis

<400>96

aatgtttatc tctctactaa acggagagtt taggagtgag attggatctt gctgggc 57

<210>97

<211>85

<212>DNA

<213> Artificial Synthesis

<400>97

gtggcagggc gctacgaaca atcctacggt gaagcccttc gcaggtcggt atcacccctt 60

cttgttacag cctttaagag cggga 85

<210>98

<211>49

<212>DNA

<213> Artificial Synthesis

<400>98

ttggtgccat tttcatccgg atttggtgtg agattggatc ttgctgggc 49

<210>99

<211>80

<212>DNA

<213> Artificial Synthesis

<400>99

gtggcagggc gctacgaaca atcctaacga ctctgtcttc tcgttcgtga cgcgctaaag 60

ggtggggaga taacgggata 80

<210>100

<211>53

<212>DNA

<213> Artificial Synthesis

<400>100

ggaatacatc aaactggtgg gctagataat cgtgagattg gatcttgctg ggc 53

<210>101

<211>85

<212>DNA

<213> Artificial Synthesis

<400>101

gtggcagggc gctacgaaca atcctacggt gaagcccttg gcaggtcggt atcacccaag 60

cctttcagcc atccccaaga atcca 85

<210>102

<211>53

<212>DNA

<213> Artificial Synthesis

<400>102

cctgttcttg gagagttaag accatcaata cttgagattg gatcttgctg ggc 53

<210>103

<211>83

<212>DNA

<213> Artificial Synthesis

<400>103

gtggcagggc gctacgaaca atcctaacga ctctggctgc tcgttcgtga cgaacaaaga 60

ttccttccgg agataaatat tcc 83

<210>104

<211>51

<212>DNA

<213> Artificial Synthesis

<400>104

attcctggta tatctggcgt ttcggctgta tgagattgga tcttgctggg c 51

<210>105

<211>88

<212>DNA

<213> Artificial Synthesis

<400>105

gtggcagggc gctacgaaca atcctacggt gaagcccttc gcaggtcggt atcaccctat 60

ggacgcagtc gcgcaatgat gttttgca 88

<210>106

<211>56

<212>DNA

<213> Artificial Synthesis

<400>106

ctgcaattat attatttatg acagcttccg ttctctgaga ttggatcttg ctgggc 56

<210>107

<211>85

<212>DNA

<213> Artificial Synthesis

<400>107

gtggcagggc gctacgaaca atcctaacga ctatggcttc tcgttggtga cgcgatacta 60

atgactcaga tgtatgccca ggatt 85

<210>108

<211>50

<212>DNA

<213> Artificial Synthesis

<400>108

tttacagaaa tgtggggcca agaaagttat gagattggat cttgctgggc 50

<210>109

<211>85

<212>DNA

<213> Artificial Synthesis

<400>109

gtggcagggc gctacgaaca atcctacggt gaagcccttg gcaggtcggt atcacccgta 60

gtccttgcat accccgtgtt aatag 85

<210>110

<211>50

<212>DNA

<213> Artificial Synthesis

<400>110

tatctgccgg attgctcagg aatggacaat gagattggat cttgctgggc 50

<210>111

<211>83

<212>DNA

<213> Artificial Synthesis

<400>111

gtggcagggc gctacgaaca atcctaacga ctctatctgc ttgttagtga cgatacacaa 60

tcgttcaaca taataaggca agc 83

<210>112

<211>55

<212>DNA

<213> Artificial Synthesis

<400>112

actagggatg gcaatttgtc tttattcgct ggactgagat tggatcttgc tgggc 55

<210>113

<211>87

<212>DNA

<213> Artificial Synthesis

<400>113

gtggcagggc gctacgaaca atcctacggt gaggcccttg gcaggttgct atcacccgga 60

attgaagtat gtttctttga agaggga 87

<210>114

<211>51

<212>DNA

<213> Artificial Synthesis

<400>114

ccatgctttt atcgtgcagg acaaactaag tgagattgga tcttgctggg c 51

<210>115

<211>26

<212>DNA

<213> Artificial Synthesis

<400>115

acgactctgg ctgctcgttc gtgacg 26

<210>116

<211>26

<212>DNA

<213> Artificial Synthesis

<400>116

acgactctag ctgctcgttc gtgacg 26

<210>117

<211>26

<212>DNA

<213> Artificial Synthesis

<400>117

acgactctgt cttctcgttc gtgacg 26

<210>118

<211>26

<212>DNA

<213> Artificial Synthesis

<400>118

acgactctag ctgcttgttc gtgacg 26

<210>119

<211>26

<212>DNA

<213> Artificial Synthesis

<400>119

acgacactgg ctgctggtcc gtgacg 26

<210>120

<211>26

<212>DNA

<213> Artificial Synthesis

<400>120

acgactctag cttctcgtta gtgacg 26

<210>121

<211>26

<212>DNA

<213> Artificial Synthesis

<400>121

acgactatgg cttctcgttg gtgacg 26

<210>122

<211>26

<212>DNA

<213> Artificial Synthesis

<400>122

acgactctat ctgcttgtta gtgacg 26

<210>123

<211>31

<212>DNA

<213> Artificial Synthesis

<400>123

cggtgaggcc cttggcaggt tgctatcacc c 31

<210>124

<211>31

<212>DNA

<213> Artificial Synthesis

<400>124

cggtgaagcc cttggcaggt cggtatcacc c 31

<210>125

<211>31

<212>DNA

<213> Artificial Synthesis

<400>125

cggtgaagcc cttcgcaggt cggtatcacc c 31

<210>126

<211>31

<212>DNA

<213> Artificial Synthesis

<400>126

cggtgaggac ctttgcagat tggcatcacc c 31

<210>127

<211>31

<212>DNA

<213> Artificial Synthesis

<400>127

cggtgaggac ctttgccgat tggcatcacc c 31

<210>128

<211>31

<212>DNA

<213> Artificial Synthesis

<400>128

cggtgcggac ctttgccgat tggcatcacc c 31

<210>129

<211>28

<212>DNA

<213> Artificial Synthesis

<400>129

cggtgaagcc attgccaggt ggtatacc 28

<210>130

<211>29

<212>DNA

<213> Artificial Synthesis

<400>130

tcggtccttc atcgctcagc cttcaccgg 29

<210>131

<211>29

<212>DNA

<213> Artificial Synthesis

<400>131

tcggtccttc atcgctcggc cttcaccgg 29

<210>132

<211>29

<212>DNA

<213> Artificial Synthesis

<400>132

tcggtccttt atcgctcacc cttcaccgg 29

<210>133

<211>29

<212>DNA

<213> Artificial Synthesis

<400>133

tcggtccttc atggctcagt cttcaccgg 29

<210>134

<211>29

<212>DNA

<213> Artificial Synthesis

<400>134

tccgttcttt atcgctcagc cttcatcgg 29

<210>135

<211>29

<212>DNA

<213> Artificial Synthesis

<400>135

tcgctccttc atagctcaga cttcatcgg 29

<210>136

<211>22

<212>DNA

<213> Artificial Synthesis

<400>136

gtggcagggc gctacgaaca at 22

<210>137

<211>21

<212>DNA

<213> Artificial Synthesis

<400>137

gcccagcaag atccaatctc a 21

<210>138

<211>26

<212>DNA

<213> Artificial Synthesis

<400>138

acgactctgg ctgctcgttc gtgacg 26

<210>139

<211>29

<212>DNA

<213> Artificial Synthesis

<400>139

tcggtccttc atcgctcagc cttcaccgg 29

<210>140

<211>31

<212>DNA

<213> Artificial Synthesis

<400>140

cggtgaggcc cttggcaggt tgctatcacc c 31

Claims

1. A primer set for detecting K antigen genotyping of Vibrio parahaemolyticus, the primer set comprising:

2. The primer set for detecting K antigen genotyping of Vibrio parahaemolyticus of claim 1, further comprising a melting point temperature tag, wherein the melting point temperature tag is selected from any one of ROX channel melting point temperature tag, Cy5 channel melting point temperature tag and FAM channel melting point temperature tag.

3. The primer set for detecting K antigen genotyping of Vibrio parahaemolyticus of claim 2,

the ROX channel melting point temperature label comprises a ROX-1 melting point temperature label, a ROX-2 melting point temperature label, a ROX-3 melting point temperature label, a ROX-4 melting point temperature label, a ROX-5 melting point temperature label, a ROX-6 melting point temperature label, a ROX-7 melting point temperature label and a ROX-8 melting point temperature label, wherein the sequence of the ROX-1 melting point temperature label is shown as SEQ ID No.115, the sequence of the ROX-2 melting point temperature label is shown as SEQ ID No.116, the sequence of the ROX-3 melting point temperature label is shown as SEQ ID No.117, the sequence of the ROX-4 melting point temperature label is shown as SEQ ID No.118, the sequence of the ROX-5 melting point temperature label is shown as SEQ ID No.119, and the sequence of the ROX-6 melting point temperature label is shown as SEQ ID No.120, The sequence of the ROX-7 melting point temperature label is shown as SEQ ID No.121, and the sequence of the ROX-8 melting point temperature label is shown as SEQ ID No. 122; and/or the presence of a gas in the gas,

the Cy5 melting point temperature labels comprise Cy5-1 melting point temperature label, Cy5-2 melting point temperature label, Cy5-3 melting point temperature label, Cy5-4 melting point temperature label, Cy5-5 melting point temperature label, Cy5-6 melting point temperature label and Cy5-7 melting point temperature label, wherein the sequence of the Cy5-1 melting point temperature tag is shown as SEQ ID No.123, the sequence of the Cy5-2 melting point temperature tag is shown as SEQ ID No.124, the sequence of the Cy5-3 melting point temperature tag is shown as SEQ ID No.125, the sequence of the Cy5-4 melting point temperature tag is shown as SEQ ID No.126, the sequence of the Cy5-5 melting point temperature tag is shown as SEQ ID No.127, the sequence of the Cy5-6 melting point temperature tag is shown as SEQ ID No.128, and the sequence of the Cy5-7 melting point temperature tag is shown as SEQ ID No. 129; and/or the presence of a gas in the gas,

the FAM melting point temperature label comprises a FAM-1 melting point temperature label, a FAM-2 melting point temperature label, a FAM-3 melting point temperature label, a FAM-4 melting point temperature label, a FAM-5 melting point temperature label and a FAM-6 melting point temperature label, wherein the sequence of the FAM-1 melting point temperature label is shown as SEQ ID No.130, the sequence of the FAM-2 melting point temperature label is shown as SEQ ID No.131, the sequence of the FAM-3 melting point temperature label is shown as SEQ ID No.132, the sequence of the FAM-4 melting point temperature label is shown as SEQ ID No.133, the sequence of the FAM-5 melting point temperature label is shown as SEQ ID No.134, and the sequence of the FAM-6 melting point temperature label is shown as SEQ ID No. 135.

4. A kit for detecting K antigen genotyping of Vibrio parahaemolyticus, wherein the kit comprises the primer set of any one of claims 1 to 3.

5. The kit for detecting K antigen genotyping of Vibrio parahaemolyticus of claim 4, wherein the kit further comprises ligase, ligase buffer.

6. The kit for detecting K antigen genotyping of Vibrio parahaemolyticus according to claim 4 or 5, wherein the kit further comprises PCR buffer, MgCl₂dNTP, rTaq enzyme, upstream and downstream universal primers and a fluorescent probe; wherein the fluorescent probe is any one selected from a ROX fluorescent probe, a Cy5 fluorescent probe and a FAM fluorescent probe.

7. A method for detecting K antigen genotyping of Vibrio parahaemolyticus, characterized in that, the kit for detecting K antigen genotyping of Vibrio parahaemolyticus of any one of claims 4 to 6 is provided, and the K antigen genotyping of Vibrio parahaemolyticus is detected by using a fluorescent probe melting curve technology based on multiple hybridization ligation reaction.

8. The method for detecting K antigen genotyping of Vibrio parahaemolyticus of claim 7, wherein the hybridization ligation reaction comprises the steps of:

mixing a primer group solution of a kit for detecting K antigen genotyping of vibrio parahaemolyticus with a vibrio parahaemolyticus DNA template, and performing first denaturation treatment to obtain a primer group mixed solution;

and mixing the primer group mixed solution with the ligase and the ligase buffer solution, and carrying out hybridization ligation reaction to obtain a hybridization ligation product.

9. The kit for detecting K antigen genotyping of Vibrio parahaemolyticus of claim 4, wherein the fluorescence probe melting curve detection reaction comprises performing a fluorescence probe melting curve PCR amplification reaction followed by a fluorescence probe melting curve fluorescence analysis reaction.

10. The kit for detecting K antigen genotyping of Vibrio parahaemolyticus of claim 9, wherein the conditions for performing the fluorescence probe melting curve PCR amplification reaction are as follows: pre-denaturation at 95 ℃ for 3 minutes, denaturation at 95 ℃ for 10 seconds, annealing at 57 ℃ for 20 seconds, extension at 72 ℃ for 20 seconds, setting 38 cyclic reactions, and simultaneously collecting fluorescence signals of ROX, Cy5 and FAM at 57 ℃; and/or the presence of a gas in the gas,

the conditions for performing the fluorescence analysis reaction by the fluorescence probe melting curve method are as follows: denaturation at 95 ℃ for 1 min, hybridization at 40 ℃ for 2 min, gradual temperature rise from 40 ℃ to 85 ℃, and collection of fluorescence signals of ROX, Cy5, FAM, wherein the fluorescence signals are collected at 0.5 ℃ per rise from 40 ℃ to 85 ℃.