CN111411130A

CN111411130A - Method for producing β -alanine by mixed fermentation

Info

Publication number: CN111411130A
Application number: CN202010142017.6A
Authority: CN
Inventors: 陈可泉; 许晟; 冯娇; 王昕�
Original assignee: Nanjing Kainuo Biotechnology Co ltd
Current assignee: Nanjing Kainuo Biotechnology Co ltd
Priority date: 2020-03-04
Filing date: 2020-03-04
Publication date: 2020-07-14

Abstract

The invention discloses a method for producing β -alanine by mixed fermentation, which comprises the following steps of constructing a recombinant strain E.coli B L-pET 28a-aspC, constructing an E.coli B L-pET 28a-panD glucose metabolism defective strain, selecting the recombinant strains E.coli B L-pET 28a-aspC and E.coli B L-pET 28a-panD, adding the recombinant strains into a fermentation culture medium, and producing β -alanine by using glucose and glycerol as carbon sources.

Description

Method for producing β -alanine by mixed fermentation

Technical Field

The invention relates to the technical field of β -alanine preparation, and in particular relates to a method for producing β -alanine by mixed fermentation.

Background

β -alanine is only a natural β amino acid, non-toxic, slightly sweet, relatively stable at room temperature, but easily decomposed by heating, β -alanine is moisture-absorbing when exposed to air, and thus needs to be stored in a dry and sealed manner.

β -alanine has a wide application in the fields of medicine, chemical industry, beauty, food, environment and the like, and β -alanine is reported to be one of 12 most potential tricarbonization chemical products in the future, and has the following effects (1) β -alanine is used for synthesizing vitamin B5, vitamin B5 is an important intermediate for synthesizing acetyl coenzyme A and acyl carrier protein, is synthesized by condensation reaction of D-pantothenic acid and β -alanine, the reaction is regulated by pantothenate synthetase, and is also a main component of acetyl coenzyme A. vitamin B5 has the main functions of assisting cell formation, maintaining normal development of central nervous system, participating in antibody synthesis, mainly existing in two forms of D-calcium pantothenate and D-sodium pantothenate due to unstable pantothenic acid, wherein the D-calcium pantothenate has the most wide application, the global requirement for D-calcium pantothenate is 8000-10000 per year, the annual yield is 6000-10000, the annual yield is 6000-histidine-pantothenate is not required as a catalyst, and the synthetic peptide can be used as a synthetic buffering agent for synthesizing a polypeptide, and a biological promoter for synthesizing sarcosine-peptide (e.g. a biological promoter) can be widely used in the fields of synthesizing creatine, a biological promoter for synthesizing creatine, a biological promoter.

The biological catalysis method is more and more widely concerned by people due to the advantages of mild reaction and environmental friendliness, mainly comprises a fermentation method, a pure enzyme method and a whole-cell catalysis method, Chan Woo Song and the like, uses glucose as a substrate, overexpresses genes panD, aspA and ppc, optimizes the expression level of the ppc, and further improves the yield of β -alanine, finally generates β -alanine with the concentration of 32.3 g/L after 39h of fermentation, but does not eliminate the synthesis path of the byproducts, and further reduces the yield of β -alanine due to the accumulation of the byproducts, so that the method is not suitable for industrial production.

So far, no production method has been reported in which the accumulation of intermediate products is reduced and the β -alanine production of the final product is increased by separately expressing aspC and panD in two cells by means of mixed fermentation.

Disclosure of Invention

Aiming at the defects of the prior art, the invention aims to provide a method for producing β -alanine by mixed fermentation, which realizes that β -alanine does not compete with L-aspartic acid synthesis bacteria for glucose, thereby improving the yield of L-aspartic acid and reducing the generation of byproducts, being suitable for large-scale industrial production and having few intermediate products.

A method for producing β -alanine by mixed fermentation comprises the following steps:

step 1, constructing a recombinant strain E.coli B L-pET 28 a-aspC;

constructing an E.coli B L-pET 28a-panD glucose metabolism defective strain;

and 3, selecting recombinant strains E.coli B L-pET 28a-aspC and E.coli B L-pET 28a-panD, adding the recombinant strains into a fermentation culture medium, simultaneously supplying glucose and glycerol as carbon sources, inducing the recombinant strains by IPTG when the culture is carried out until OD is about 0.6, and continuously culturing and fermenting to produce β -alanine.

The improved construction method of the E.coli B L-pET 28a-aspC in the step 1 is that the E.coli B L-pET 28a-aspC in the step 1 is that a first primer is selected, aspartase on Escherichia coli MG1655 is copied through PCR, the aspartase is connected with a vector pET28a, the vector is transferred into a cloning vector Trans1-T1, after being screened by a L B plate, a point is selected for colony PCR verification and sequencing is carried out.

The improvement is that in the step 2, the construction method of the glucose metabolism defective strain E.coli B L-pET 28a-panD comprises the first step of selecting a second primer, copying L-aspartic acid- α -decarboxylase on C.glutamicum ATCC13032 through PCR, connecting with a carrier pET28a, transferring into a cloning carrier Trans1-T1, carrying out colony PCR verification on selected points after L B plate primary screening, and then carrying out sequencing, and the second step of knocking out proteins encoded by phosphotransferase system (PTS) ptsG, ptsH, ptsI, crr and glk genes of escherichia coli B L21 (DE3) by using Crispr-Cas9 editing technology, and transforming the constructed pET28a-panD plasmid into a glucose metabolism defective strain B L21 (DE3), thus obtaining the glucose metabolism defective strain E.coli B L-pET 28-panD 28 a-1.

As an improvement, the recombinant strains E.coli B L-pET 28a-aspC and E.coli B L-pET 28a-panD in step 3 had a cell OD ratio of 2: 1.

As a refinement, the molar ratio of the addition of glucose and glycerol in step 3 is 8: 1.

as a modification, the induction temperature in step 3 is 37 ℃.

Has the advantages that:

compared with the prior art, the method for producing β -alanine by mixed fermentation has the advantages that:

1. protein encoded by ptsG, ptsH, ptsI, crr and glk genes of a phosphotransferase system (PTS) is knocked out by using a Crispr-Cas9 technology, so that β -alanine does not compete with L-aspartic acid synthetase for glucose, the yield of L-aspartic acid is improved, and the generation of byproducts is reduced.

2. The L-aspartic acid-producing strain was mixed with the β -alanine-producing strain to achieve a one-step production of β -alanine from glucose for the first time.

3. Compared with the method of utilizing E.coli B L-pET 28a-panD to singly utilize L-aspartic acid for fermentation production, the mixed fermentation mode has the advantages that the production cost is reduced and the molar yield of β -alanine is improved by 40%.

Drawings

FIG. 1 is a construction map of plasmid pET28 a-aspC;

FIG. 2 is a map of the construction of the plasmid pET28 a-panD;

FIG. 3 shows the OD inoculation ratios optimization at OD600 for E.coli B L-pET 28a-aspC and E.coli B L-pET 28 a-panD;

FIG. 4 shows the optimization of molar concentration ratio of glucose and glycerol at the beginning of mixed culture of E.coli B L-pET 28a-aspC and E.coli B L-pET 28 a-panD;

FIG. 5 shows the temperature optimization of E.coli B L-pET 28a-aspC and E.coli B L-pET 28a-panD mixed culture.

Detailed Description

The present invention is further described in the following description of the specific embodiments, which is not intended to limit the invention, but various modifications and improvements can be made by those skilled in the art according to the basic idea of the invention, within the scope of the invention, as long as they do not depart from the basic idea of the invention.

In this experiment, C.glutamicum ATCC13032, Escherichia coli MG1655, Escherichia coli Trans1-T1, Escherichia coli B L21 (DE3) and plasmid pET28a were all commercial products and were purchased conventionally.

EXAMPLE 1 construction of recombinant Strain E.coli B L-pET 28a-aspC

Selecting a first primer by taking Escherichia coli MG1655 whole genome as a template

aspC-28a-F：CCGGAATTCATGTTTGAGAACATTACCGC，

aspC-28a-R:CCCTCGAGTTACAGCACTGCCACAATCG，

The aspartase on the Escherichia coli MG1655 is copied by PCR, the obtained sequence is subjected to agarose gel electrophoresis with the mass fraction of 1% to recover the corresponding fragment, then the fragment is subjected to double digestion by EcoR I and Xho I, and then the fragment is connected to a pET28a vector which is also subjected to double digestion by T4DNA ligase, and the ligation product is transformed into Escherichia coli Trans 1-T1. Positive strain Trans1-T1-pET28a-aspC is screened by PCR, DNA sequencing is carried out, and the construction correctness of the recombinant plasmid is verified.

The positive strain is inoculated to 5ml of L B/kanR liquid medium, the L B/kanR liquid medium consists of 10 g/L of peptone, 5 g/L of yeast powder and 5 g/L of sodium chloride, and is subjected to shaking culture at 37 ℃ and 200rpm overnight, after 24 hours, the plasmid pET28a-aspC is extracted according to the operation instruction of a root-of-the-day plasmid extraction kit, 2 mul of pET28a-aspC plasmid is taken to be transformed into Escherichia coli B L21 (DE3), and is coated on a plate containing 50 mg/L kanamycin resistance and is subjected to overnight culture at 37 ℃, and the recombinant strain E.coli B L-pET 28a-aspC is obtained, and the map is shown in figure 1 after the construction success.

Example 2 construction of E.coli B L-pET 28a-panD Strain deficient in glucose metabolism

Selecting a second primer by taking the whole genome of C.glutamcum ATCC13032 as a template

panD-28a-F:CATGCCATGGGCATGCTGCGCACCATCCTC，

panD-28a-R：CCGCTCGAGCTAAATGCTTCTCGACGTCAAAAGCC，

The L-aspartic acid- α -decarboxylase on C.glutamcum ATCC13032 is replicated by PCR, the obtained sequence is subjected to agarose gel electrophoresis with the mass fraction of 1 percent, the corresponding fragment is recovered, the fragment is subjected to double digestion by Nco I and Xho I, then T4DNA ligase is used for connecting to a pET28a vector which is also subjected to double digestion, the ligation product is transformed into Escherichia coli Trans 1-T1. PCR is carried out to screen a positive strain Trans1-T1-pET28a-panD and DNA sequencing is carried out, and the construction correctness of the recombinant plasmid is verified.

The positive strain was inoculated into 5ml of L B/kanR broth, L B/kanR broth consisting of peptone 10 g/L, yeast powder 5 g/L, sodium chloride 5 g/L, and cultured overnight at 37 ℃ under shaking at 200rpm, and after 24 hours, plasmid pET28a-panD was extracted according to the protocol of the Tiangen plasmid extraction kit, and the map thereof after successful construction is shown in FIG. 2.

Knocking out proteins encoded by phosphotransferase system (PTS) ptsG, ptsH, ptsI, crr and glk genes of Escherichia coli B L21 (DE3) by using Crispr-Cas9 editing technology to obtain a glucose metabolism defective strain competent cell B L21 (DE3) -1, transforming 2 mu l of constructed pET28a-panD plasmid into Escherichia coli B L21 (DE3) -1, coating the plasmid on a plate containing 50 mg/L kanamycin resistance, and culturing overnight at 37 ℃ to obtain the E.coli B L-pET 28a-panD glucose metabolism defective strain.

EXAMPLE 3 Mixed fermentation to produce β -alanine

Inoculating a single colony of the recombinant strain E.coli B L-pET 28a-aspC into a 5ml L B shaking tube containing 50 mg/L kanamycin resistance, and culturing at 37 ℃ for 6-8h to obtain a seed solution of the recombinant strain E.coli B L-pET 28 a-aspC;

picking a single colony of the recombinant strain E.coli B L-pET 28a-panD, inoculating the single colony into a 5ml L B shaking tube containing 50 mg/L kanamycin resistance, and culturing at 37 ℃ for 6-8h to obtain a seed solution of the recombinant strain E.coli B L-pET 28 a-panD;

the two cell seed liquids are added according to the proportion of 1: 1-10: 1 under the condition of OD600 (the OD proportion optimization is shown in figure 3, when the cell OD proportion relation of E.coli B L-pET 28a-aspC and E.coli B L-pET 28a-panD is 2: 1, L-alanine yield is optimal), glucose and glycerol molar proportion is 1:1 to 10: 1 (the glucose and glycerol molar proportion optimization is shown in figure 4, when the molar ratio of glucose and glycerol added is 8: 1, L-alanine yield is optimal), IPTG is used for induction when the OD is about 0.6, the induction temperature is 25-47 ℃ (the induction temperature optimization is shown in figure 5, when the induction temperature is 37 ℃, β -alanine yield is optimal), β -alanine is generated by fermentation when the initial reaction parameters are E.coli B L-pET L-a-pET 28-75-pET 28-panD production is increased by using the conventional fermentation method, when the induction temperature is 25-25 ℃ and the induction temperature is 37 ℃, the glucose and the cell OD proportion of pEE is 2-pET 28-panD 2-43-panD production is increased by IPT 2, when the cell OD yield is about 0.6, the addition of glucose and the glucose and glycerol is 2-43: 1, the cell production cost optimization is increased by the conventional method, the IPTG fermentation method, the production method is carried out by using IPTG 2-43-panE production method, the conventional fermentation method, the IPTG production method, the method is carried out for fermentation method, the method is carried out, the method is carried out the method, the method is carried out, the method is carried out the method, the method is characterized in the method, the method is.

Sequence listing

<110> Nanjing Kano Biotech Co., Ltd

<120> method for producing β -alanine by mixed fermentation

<160>4

<170>SIPOSequenceListing 1.0

<210>1

<211>29

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>1

ccggaattca tgtttgagaa cattaccgc 29

<210>2

<211>28

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>2

ccctcgagtt acagcactgc cacaatcg 28

<210>3

<211>30

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>3

catgccatgg gcatgctgcg caccatcctc 30

<210>4

<211>35

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>4

ccgctcgagc taaatgcttc tcgacgtcaa aagcc 35

Claims

1. A method for producing β -alanine by mixed fermentation is characterized by comprising the following steps:

step 1, constructing a recombinant strain E.coli B L-pET 28 a-aspC;

constructing an E.coli B L-pET 28a-panD glucose metabolism defective strain;

and 3, selecting recombinant strains E.coli B L-pET 28a-aspC and E.coli B L-pET 28a-panD, adding the recombinant strains into a fermentation culture medium, using glucose and glycerol as carbon sources, culturing until OD is about 0.6, inducing by IPTG, and continuously culturing to produce β -alanine.

2. The method for producing β -alanine by mixed fermentation as claimed in claim 1, wherein the E.coli B L-pET 28a-aspC in step 1 is constructed by selecting a first primer, replicating aspartase on Escherichia coli MG1655 by PCR, connecting with vector pET28a, transferring into cloning vector Trans1-T1, primarily screening by L B plate, selecting a spot, performing colony PCR verification, and sequencing.

3. The method for producing β -alanine by mixed fermentation according to claim 1, wherein the E.coli B L-pET 28a-panD glucose metabolism deficient strain in step 2 is constructed by selecting the second primer and replicating it by PCRC. glutamicumL-aspartic acid- α -decarboxylase on ATCC13032, then connected with a vector pET28a, transferred into a cloning vector Trans1-T1, preliminarily screened by a L B plate, selected, subjected to colony PCR verification and sequenced, and secondly, a phosphotransferase system of escherichia coli B L21 (DE3) is knocked out by utilizing a Crispr-Cas9 editing technologyptsG、ptsH、ptsI、crrAndglkthe protein encoded by the gene is transformed into the competence of B L21 (DE3) with glucose metabolism deficiency by using the constructed pET28a-panD plasmid, and then the E.coli B L-pET 28a-panD glucose metabolism deficiency strain is obtained.

4. The method for producing β -alanine by mixed fermentation according to claim 1, wherein the recombinant strains E.coli B L-pET 28a-aspC and E.coli B L-pET 28a-panD in step 3 have a cell OD ratio of 2: 1.

5. The method for producing β -alanine by mixed fermentation of claim 1, wherein the molar ratio of glucose and glycerol added in step 3 is 8: 1.

6. The method for producing β -alanine by mixed fermentation as claimed in claim 1, wherein the induction temperature in step 3 is 37 ℃.