CN111394375B - Gene for coding beta-glucosidasemg163And uses thereof - Google Patents
Gene for coding beta-glucosidasemg163And uses thereof Download PDFInfo
- Publication number
- CN111394375B CN111394375B CN202010343911.XA CN202010343911A CN111394375B CN 111394375 B CN111394375 B CN 111394375B CN 202010343911 A CN202010343911 A CN 202010343911A CN 111394375 B CN111394375 B CN 111394375B
- Authority
- CN
- China
- Prior art keywords
- glucosidase
- beta
- gene
- ala
- gly
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/14—Hydrolases (3)
- C12N9/24—Hydrolases (3) acting on glycosyl compounds (3.2)
- C12N9/2402—Hydrolases (3) acting on glycosyl compounds (3.2) hydrolysing O- and S- glycosyl compounds (3.2.1)
- C12N9/2405—Glucanases
- C12N9/2434—Glucanases acting on beta-1,4-glucosidic bonds
- C12N9/2445—Beta-glucosidase (3.2.1.21)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/70—Vectors or expression systems specially adapted for E. coli
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
- C12P19/00—Preparation of compounds containing saccharide radicals
- C12P19/14—Preparation of compounds containing saccharide radicals produced by the action of a carbohydrase (EC 3.2.x), e.g. by alpha-amylase, e.g. by cellulase, hemicellulase
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
- C12P19/00—Preparation of compounds containing saccharide radicals
- C12P19/18—Preparation of compounds containing saccharide radicals produced by the action of a glycosyl transferase, e.g. alpha-, beta- or gamma-cyclodextrins
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Y—ENZYMES
- C12Y302/00—Hydrolases acting on glycosyl compounds, i.e. glycosylases (3.2)
- C12Y302/01—Glycosidases, i.e. enzymes hydrolysing O- and S-glycosyl compounds (3.2.1)
- C12Y302/01021—Beta-glucosidase (3.2.1.21)
Abstract
The present invention provides a gene cloned from coral microorganism macro genemg163The gene has a nucleotide sequence shown in a sequence table SEQ ID NO.1, and provides an amino acid sequence of the gene coding beta-glucosidase MG163, wherein the sequence is shown in SEQ ID NO. 2. Meanwhile, the invention also provides an expression vector containing the gene and a host cell transformed by the expression vector. Beta-glucosidase gene of the inventionmg163The coded beta-glucosidase has wide application in oligosaccharide preparation.
Description
Technical Field
The invention belongs to the technical field of biology, and discloses a gene for coding beta-glucosidasemg163And applications thereof.
Background
Beta-glucosidase (beta-D-glucosidase, EC 3.2.1.21, BG for short), also known as beta-D-glucoside glucohydrolase, also known as gentiobiase, cellobiase (CB or beta-G) and amygdalase. In 1837, Liebig and Wohler were first found in almonds. Later studies found that β -glucosidase is present in nature in many plants, insects, yeast, aspergillus, trichoderma and bacteria. It is involved in sugar metabolism of living body and plays an important role in maintaining normal physiological functions of living body. In addition, the beta-glucosidase can hydrolyze flavor precursors in fruits, vegetables and tea into aromatic substances with strong natural flavor, so that the food flavor is improved, the food flavor is more rich and coordinated, the content of bitter substances in the food is reduced, and the beta-glucosidase has a wide prospect in food engineering application. Beta-glucosidase belongs to hydrolase, but also has transglycosidic activity, can break the non-reducing terminal glycosidic bond of oligosaccharide, release glucose, and transfer free glucose group to other sugar substrate in the form of beta-1, 6 glycosidic bond to obtain oligosaccharide. Beta-glucosidase widely exists in many plants and microorganisms in the nature, but the enzyme activity is generally low and difficult to purify, so that the construction of engineering bacteria for efficiently expressing the beta-glucosidase by using a genetic engineering means becomes a hotspot for researching the beta-glucosidase at present.
The traditional method for obtaining beta-glucosidase starts from pure culture of microorganisms, high-yield beta-glucosidase strains are screened, and enzyme production is carried out through fermentation, which is an important application in industry, but the requirement for novel industrial enzyme is increasingly vigorous due to severe energy crisis. 99% of microorganisms in the natural environment are not easy to obtain pure culture under the current experimental conditions, and the uncultured microorganisms are the largest undeveloped biological resources on the earth. The metagenome presented in recent years does not depend on microbial culture, takes the total DNA of microorganisms in a specific environment as an object, increases the chance of obtaining new bioactive substances, and is a new way for searching new genes and new enzymes. The coral is located in tropical and subtropical low latitude areas, the water temperature of the growth environment is about 25 ℃, the coral reef ecological system is suitable for growth of microorganisms, and the coral reef ecological system formed by taking the coral as the center has the highest biological diversity in the marine environment and is an important treasure house of marine microorganism resources. Besides the symbiotic zooxanthellae, the coral also lives with a plurality of microorganisms, and plays an important role in resisting the invasion of algae and competing with the algae.
The invention carries out clone expression, activity detection and protein molecule detection in a plurality of genes similar to the coded beta-glucosidase through coral microorganism metagenome sequencing analysis and screening, thereby obtaining a new gene for coding the beta-glucosidase, and the gene can be expressed in a host cell in large quantity to produce the beta-glucosidase and can be used for preparing oligosaccharide.
Disclosure of Invention
The gene provided by the invention for coding beta-glucosidasemg163Has a nucleotide sequence shown as SEQ ID NO. 1.
The gene sequence SEQ ID NO.1 is obtained by sequencing, analyzing and screening in coral microorganism metagenome library and is named asmg163. The initiation codon of the gene is ATG, the termination codon is TAG, and the total number of the initiation codon and the termination codon is 1344 bases. After the analysis, after removing the start codon at the head end and the stop codon at the tail end of the sequence, the 205 th to 1388 th bases from the N end of the maximum open reading frame contained in the gene are found, the maximum open reading frame is converted into an amino acid sequence, and then the GenBank database is searched to know that the maximum open reading frame belongs to a beta-glucosidase family, andCeleribacter halophilusthe highest identity was found to be 88.2%, thus confirming the gene of the present invention mg163Has development value of coding beta-glucosidase.
Due to the specificity of the nucleotide sequence, any functionally equivalent variant of SEQ ID NO.1 is within the scope of the present invention. A variant of said nucleotide refers to a nucleotide sequence with one or more nucleotide changes. The nucleotide variants may be either degenerate variants or non-degenerate variants, including deletion variants, nonsense variants, insertion variants and missense variants. As is known in the art, an allelic variant is a substitution of a polynucleotide, which may be a deletion, a nonsense, an insertion, or a missense of a polynucleotide, without substantially altering the function of the peptide protein encoded thereby.
Meanwhile, the invention also provides the beta-glucosidase genemg163The amino acid sequence of the encoded protein is shown as SEQ ID NO. 2.
The protein is a beta-glucosidase genemg163The coded cellulase is named as MG163, and consists of 447 amino acids, and the amino acids 69-446 from the N end are functional domain proteins of a beta-glucosidase family.
Meanwhile, the invention also provides a beta-glucosidase gene containing the beta-glucosidase genemg163The expression vector of (1).
Meanwhile, the invention also provides a host cell which contains the prokaryotic cell or the eukaryotic cell transformed by the expression vector.
Meanwhile, the invention also provides the beta-glucosidase genemg163Application in preparing beta-glucosidase MG 163. The specific application is as follows: construction of beta-glucosidase-containing Genemg163The recombinant vector is transformed into a host body, the obtained recombinant genetic engineering bacteria are subjected to induction culture, and the culture solution is separated to obtain the enzymolysis solution containing the recombinant beta-glucosidase MG 163.
Meanwhile, the invention also provides application of the beta-glucosidase MG163 in preparation of oligosaccharide. The application specifically comprises the following steps: culturing the recombinant genetic engineering bacteria to prepare beta-glucosidase MG163 enzymatic hydrolysate, and treating glucose and cellobiose mixed solution with the beta-glucosidase MG163 enzymatic hydrolysate to obtain oligosaccharide through reaction.
The invention has the beneficial effects that:
the present invention provides a novel beta-glucosidase genemg163The gene codes and expresses a product beta-glucosidase in an escherichia coli host cell, and the beta-glucosidase has wide application in cellulose hydrolysis.
Drawings
FIG. 1 shows a beta-glucosidase gene obtained from coral microorganism metagenome sequencing analysis mg163The gel image of the fragment electrophoresis, wherein 1 is Marker2000 (the fragments are 2kb, 1kb, 0.75kb, 0.5kb, 0.25kb and 0.1kb from big to small in sequence); 2 is beta-glucosidase genemg163。
FIG. 2 shows the detection of beta-glucosidase gene by SDS polyacrylamide gel electrophoresismg163Expressed protein wherein 1 isBlue Plus ® Protein Marker (fragments of 100kDa, 70kDa, 50kDa, 40kDa, 30kDa, 25kDa and 14kDa in sequence from large to small); 2 is crude enzyme liquid of beta-glucosidase MG 163; 3, crude enzyme liquid of a transformant after the empty vector is used for transforming the escherichia coli; 4 is pure enzyme liquid of beta-glucosidase MG 163.
FIG. 3 shows crude enzyme solution and no-load conversion of beta-glucosidase MG163A contrast graph of p-nitrophenyl-beta-D-glucopyranoside degradation by crude enzyme liquid obtained after seed crushing; wherein: 1, a crude enzyme solution obtained by inducing and crushing a transformant which is used as an empty vector and is used for transforming escherichia coli cannot degrade p-nitrophenyl-beta-D-glucopyranoside, and the solution does not change color; 2 is a recombinant plasmid E1-mg163And (3) transforming the transformant into escherichia coli DE3, inducing the transformant by IPTG, performing ultrasonic disruption and high-speed centrifugation to obtain a crude enzyme solution of beta-glucosidase MG163, and degrading p-nitrophenyl-beta-D-glucopyranoside in a PBS buffer solution (PH = 7.0) to release p-nitrophenol so as to yellow the reaction solution.
Detailed Description
The present invention will be further described with reference to the following examples.
Materials used in embodiments of the invention include:
1. coral live samples (collected from west sand islands);
2、FastDNA ® spin Kit for Soil genomic DNA extraction Kit, purchased from MP bio corporation;
3、Trans1-T1 Phage Resistant Chemically Competent Cell、pEASY ®blunt E1 Expression Kit, available from King Kogyo.
Example 1: genes encoding beta-glucosidasemg163And (4) obtaining.
Washing coral tissues with running water to obtain a sample stock solution, purifying the sample stock solution by sucrose gradient centrifugation, and finally diluting the stock solution for plate coating;
use ofFastDNA ® Extracting DNA by using a Spin Kit for Soil Kit, mixing all the extracted DNA in a centrifugal tube of 1.5mL, and then sending the centrifugal tube to a biological engineering company for high-throughput sequencing analysis and establishing a metagenomic library;
screening out a gene fragment with the coding region length of about 2000bp and similar to beta-glucosidase and related enzyme genes in sequence comparison from a coral microorganism metagenome library, randomly selecting a gene fragment from the screened qualified genes, and naming the gene fragment as the gene fragmentmg163From 1344The deoxynucleotide comprises a sequence shown as SEQ ID NO.01, wherein the initiation codon is ATG, and the termination codon is TGA; the electrophoresis gel-running structure is shown in figure 1.
Example 2: beta-glucosidase genemg163And (3) obtaining the encoded protein.
The DNA sequence was analyzed using software such as ORF finder on NCBI (National Center for Biotechnology Information, http:// www.ncbi.nlm.nih.gov /), looking for cellulose genes after removal of the start codon at the head and the stop codon at the end of the DNA sequencemg163The contained maximum open reading frame is the 205 th to 1338 th bases from the N end, and is converted into an amino acid sequence, and a GenBank database is searched by using Blast (http:// Blast. ncbi. nlm. nih. gov /), which belongs to a beta-glucosidase family, andCeleribacter halophilusthe highest agreement was found to be 88.2%, thus determiningmg163Has the development value of beta-glucosidase. Cellulase genemg163Encodes a protein containing 447 amino acids and is named MG 163. The amino acid sequence is shown as SEQ ID NO. 2.
Example 3: beta-glucosidase genemg163Cloning of (2)
(1) Using upstream primersmg163ACATCCCGCCCCACCCT, downstream primermg163GCTCCGTGCGATCATGTCTTTCAAC, high fidelity DNA polymerase PCR amplification of cellulase genes using total DNA extracted as templatemg163Obtaining PCR Product;
(2) using restriction endonucleasesEcoRI, connecting the product of enzyme digestion amplification of the hind enzyme with a pET-22b expression vector digested by the same endonuclease; the connection reaction system is as follows: 1 mu L pEASY-Blunt E1 Expression Vector, 0.5-4 mu L PCR Product, supplement ddH 2O until the reaction system is 3-5 mu L, lightly mixing, and placing in a water bath at 25 ℃ for 5-10 min to obtain a connecting product;
(3) thawing 1 tube of clonotype E.coli T1 on ice and taking out 50 μ l of it in a 1.5mL EP tube just after thawing for transformation;
(4) injecting 50 mul of the ligation product into an EP (ethylene propylene glycol) tube, lightly and uniformly mixing the ligation product with Escherichia coli T1, sequentially placing the mixture in an ice bath for 30min, a water bath at 42 ℃ for 1min, an ice bath for 2-3 min, then adding 250-300 mul of fresh LB culture medium, culturing for 1h at 37 ℃ and 200r/min, finally coating the mixture on an LB culture medium plate containing 50 mul/mL ampicillin, and culturing for 12-16 h at 37 ℃;
(5) by using a PCR method, an upstream Primer T7 promoter Primer and a downstream Primer of an E1 carrier are usedmg163-A, or downstream Primer T7 terminator Primer and upstream Primer using E1 vectormg163S identification of the Positive clones with the correct expression orientation, further extraction of the plasmid DNA and naming the recombinant plasmid as E1-mg163；
Example 4: carrying beta-glucosidase genemg163Preparation of transformants.
Plasmid E1-mg163Transformed into expression type Escherichia coli DE3, spread on LB medium plate containing 50. mu.g/mL ampicillin, and screened positive clone to obtain E1-mg163The transformant of the expression type Escherichia coli DE 3.
Example 5: beta-glucosidase gene mg163Preparation of
Will carry E1-mg163The transformant of the expression type Escherichia coli DE3 of (1) was inoculated into LB liquid medium and cultured to OD600At 0.5, IPTG was added to a final concentration of 0.25mM, induction was carried out at 22 ℃ for 12 hours, the induction solution was disrupted by an ultrasonicator at 40% full power to full power and at a frequency of 2.5s (working) to 3s (intermittent) on an ice bath, and then centrifuged at 12000r/min at a high speed for 10 minutes, and the supernatant was taken to obtain a crude enzyme solution of β -glucosidase MG 163.
The activity detection of the crude enzyme liquid of the beta-glucosidase MG163 comprises the following steps:
adding 70 muL of PBS buffer solution (PH = 7.0), 10 muL of nitrophenyl-beta-D-glucopyranoside (PNPG) and 20 muL of crude enzyme solution of beta-glucosidase MG163 into a 1.5mL EP tube, gently mixing, quickly changing color of reaction solution at normal temperature, adding 100 muL of Na after 30min2CO3(0.2M) the reaction was terminated. Beta-glucosidase MG163 acts on PNPG to release p-nitrophenol so as to lead the reaction liquid to turn yellow, the crude enzyme liquid obtained after the transformant obtained after the empty carrier transforms the escherichia coli is induced and crushed can not degrade the PNPG, the reaction liquid does not change the color,as shown in fig. 3.
Purifying and detecting the molecular weight of the crude enzyme liquid of the beta-glucosidase MG163, comprising the following steps:
(1) Purifying the beta-glucosidase MG163 with the HIS label by using a nickel column to obtain a pure enzyme solution of MG 163;
(2) and performing SDS polyacrylamide gel electrophoresis on the MG163 by taking the reserved crude enzyme liquid of the beta-glucosidase MG163 and the crude enzyme liquid of a transformant of the escherichia coli transformed by the empty vector as a reference, performing 200V electrophoresis for 50 minutes, dyeing the gel for 30-60 min by using Coomassie brilliant blue dyeing liquid, and decoloring for 0.5-1 d, wherein the decoloring liquid is replaced for multiple times during decoloring until the gel becomes transparent. The gel-running result is shown in fig. 2, wherein the crude enzyme solution of MG163 has a large protein expression amount near 50KDa, the overall expression amount is high, the protein in the pure enzyme solution of MG163 has a molecular weight near 50KDa and an obvious expression amount, which is similar to the phenomenon of the crude enzyme solution, and matches with the molecular weight of the original target protein, the enzyme activity of the pure enzyme solution is 73U/MG, and the crude enzyme solution of the transformant of escherichia coli transformed by the empty vector has no protein with the same molecular weight, and the overall expression amount is low, thus confirming that MG163 is the obtained cellulase gene.
Example 6: preparation of oligosaccharide from pure beta-glucosidase MG163
1. Preparation of a reagent: preparing a cellulose reagent disaccharide with the concentration of 20% and a glucose reagent with the concentration of 40% by using PBS as a solvent; the volume ratio of the prepared organic reagent is n-butane, isopropane, ethanol and water = 6: 3: 1, and the total volume ratio is 40 mL.
2. Pure enzyme preparation of oligosaccharides: glucose and cellobiose are mixed according to the volume ratio: mixing the mixture according to the total volume of 200 muL at the ratio of 1: 1, 1: 2 and 1: 4, respectively adding 2 muL of beta-glucosidase MG163 pure enzyme solution into the mixed solution with different volume ratios, uniformly mixing, and incubating at 37 ℃ for 30 min to obtain oligosaccharide solution.
3. And (3) oligosaccharide detection: centrifuging the experimental group after incubation for 30 min at 12000 r/min for 2 min, taking 5 mu L of supernatant, and detecting by HPLC and LC-MS, wherein oligosaccharide is generated.
HPLC conditions: differential refractometer, chromatographic column: hypersil NH2, 250 mm. times.4.6 mm; column temperature: 30 ℃; cell temperature (detector): 30 ℃; mobile phase: 76% acetonitrile; flow rate: 1 mL/min; sample introduction amount: 5 μ L.
Mass spectrum conditions: ion mode: ESI-, ESI +, ion source temperature: 100 ℃, desolventizing gas temperature: 250 ℃, mass range: 100-800m/z, selected ions: ESI +: 365.5 Da; ESI-: 341.4Da, photomultiplier voltage: 650Volts, analyst vacuum: 2.6e-5mBar，GasFlow：4.2lit/hr。
The above embodiments are only exemplary embodiments of the present invention, and are not intended to limit the present invention, and the scope of the present invention is defined by the claims. Various modifications and equivalents may be made thereto by those skilled in the art within the spirit and scope of the present invention, and such modifications and equivalents should be considered as falling within the scope of the present invention.
Sequence listing
<110> Guangxi university
<120> gene mg163 encoding beta-glucosidase and application thereof
<160> 2
<170> SIPOSequenceListing 1.0
<210> 1
<211> 1344
<212> DNA
<213> mg163
<400> 1
atgacatccc gccccaccct gacccgcaaa gatttcccga acggctttct ctttggcgcc 60
gccacagccg cctatcaggt tgagggccat aaattcgggg gtgccggccc gacgcattgg 120
gacaccttcg ccgccacgcc gggcaatgtg ttgcgtgccg aggacggagc cctggcctgc 180
gaccagtatc accgctacgg cgaggatatg gatctgttga agcaaggcgg tttcgacgca 240
taccgctttt ccacaagctg ggcacgggtc atccccgaag gccgggggac cgtaaaccgc 300
gaaggcctcg actattacga ccgactcaca gacgccattc tggaacgcgg gctggagccg 360
catcttacac tttatcactg ggaaatgcct gcggctctct ctgatctggg cggctggacc 420
aaccccgacg tgcatctctg gttcggcgat ttcgtcgagg tgatcgacga taagattggc 480
gaccgcatgg cgacggtagc gacgatcaac gagccctggt gcgtctccta tctctcgcat 540
tttctgggcc atcacgcgcc gggccgtcgc gacatccgag ccgcagcccg agccatgcat 600
catgtgctca aagcacacgg cgaggcgatg acccgcctgc gcgaccgggg ccgcaagaac 660
ctcggcatcg tgatcaattt cgaacacacc cagcccgcca gcgacgatcc gaaagacatc 720
aaggccgccg ccacgcagga cgccaccaac aaccgctggt tcatcgaagc cattgcaaaa 780
gggaaatacc cgcatgaggc gctcgaaggt ctggagccgc atctaccgaa tggctggcaa 840
gacgatctgg ccggtgcgat ttcccaaccc atcgactggc tcggcgtgaa ctactatttc 900
cgccagctcg tcgcccatga cgccagttcg ccctggccct acacgcagcc cgcgcagggt 960
catttggcca ccacccaaat gggatgggaa atctgccccg agggcctgcg cgccctgttg 1020
gtcaacctca aggaccgcta tgtcggcgac ctgcccatcg tggtgacgga aaacggcatg 1080
gcctgggacg atcaggtgag aaacggtgtc gtgcacgacc cggagcgctg cgcctatatc 1140
aacgatcacc tggccgcgat gcatcaggcg attgccgcgg gcgtgaacct gaaaggtttt 1200
ttctactggt cgcttttgga caactatgag tgggctttcg gctatgaacg ccgcttcggc 1260
atcgtgcatg tggattttga aacattgcag cgcaccccca aagcctcgta tcacatgttg 1320
aaagacatga tcgcacggag ctga 1344
<210> 2
<211> 447
<212> PRT
<213> MG163
<400> 2
Met Thr Ser Arg Pro Thr Leu Thr Arg Lys Asp Phe Pro Asn Gly Phe
1 5 10 15
Leu Phe Gly Ala Ala Thr Ala Ala Tyr Gln Val Glu Gly His Lys Phe
20 25 30
Gly Gly Ala Gly Pro Thr His Trp Asp Thr Phe Ala Ala Thr Pro Gly
35 40 45
Asn Val Leu Arg Ala Glu Asp Gly Ala Leu Ala Cys Asp Gln Tyr His
50 55 60
Arg Tyr Gly Glu Asp Met Asp Leu Leu Lys Gln Gly Gly Phe Asp Ala
65 70 75 80
Tyr Arg Phe Ser Thr Ser Trp Ala Arg Val Ile Pro Glu Gly Arg Gly
85 90 95
Thr Val Asn Arg Glu Gly Leu Asp Tyr Tyr Asp Arg Leu Thr Asp Ala
100 105 110
Ile Leu Glu Arg Gly Leu Glu Pro His Leu Thr Leu Tyr His Trp Glu
115 120 125
Met Pro Ala Ala Leu Ser Asp Leu Gly Gly Trp Thr Asn Pro Asp Val
130 135 140
His Leu Trp Phe Gly Asp Phe Val Glu Val Ile Asp Asp Lys Ile Gly
145 150 155 160
Asp Arg Met Ala Thr Val Ala Thr Ile Asn Glu Pro Trp Cys Val Ser
165 170 175
Tyr Leu Ser His Phe Leu Gly His His Ala Pro Gly Arg Arg Asp Ile
180 185 190
Arg Ala Ala Ala Arg Ala Met His His Val Leu Lys Ala His Gly Glu
195 200 205
Ala Met Thr Arg Leu Arg Asp Arg Gly Arg Lys Asn Leu Gly Ile Val
210 215 220
Ile Asn Phe Glu His Thr Gln Pro Ala Ser Asp Asp Pro Lys Asp Ile
225 230 235 240
Lys Ala Ala Ala Thr Gln Asp Ala Thr Asn Asn Arg Trp Phe Ile Glu
245 250 255
Ala Ile Ala Lys Gly Lys Tyr Pro His Glu Ala Leu Glu Gly Leu Glu
260 265 270
Pro His Leu Pro Asn Gly Trp Gln Asp Asp Leu Ala Gly Ala Ile Ser
275 280 285
Gln Pro Ile Asp Trp Leu Gly Val Asn Tyr Tyr Phe Arg Gln Leu Val
290 295 300
Ala His Asp Ala Ser Ser Pro Trp Pro Tyr Thr Gln Pro Ala Gln Gly
305 310 315 320
His Leu Ala Thr Thr Gln Met Gly Trp Glu Ile Cys Pro Glu Gly Leu
325 330 335
Arg Ala Leu Leu Val Asn Leu Lys Asp Arg Tyr Val Gly Asp Leu Pro
340 345 350
Ile Val Val Thr Glu Asn Gly Met Ala Trp Asp Asp Gln Val Arg Asn
355 360 365
Gly Val Val His Asp Pro Glu Arg Cys Ala Tyr Ile Asn Asp His Leu
370 375 380
Ala Ala Met His Gln Ala Ile Ala Ala Gly Val Asn Leu Lys Gly Phe
385 390 395 400
Phe Tyr Trp Ser Leu Leu Asp Asn Tyr Glu Trp Ala Phe Gly Tyr Glu
405 410 415
Arg Arg Phe Gly Ile Val His Val Asp Phe Glu Thr Leu Gln Arg Thr
420 425 430
Pro Lys Ala Ser Tyr His Met Leu Lys Asp Met Ile Ala Arg Ser
435 440 445
Claims (6)
1. Gene for coding beta-glucosidasemg163The method is characterized in that: the genemg163The nucleotide sequence of (A) is shown in SEQ ID NO. 1.
2. The gene encoding β -glucosidase of claim 1mg163An encoded protein characterized in that: the amino acid sequence of the protein is shown as SEQ ID NO. 2.
3. An expression vector, characterized in that: which comprises the gene encoding β -glucosidase of claim 1mg163。
4. A host cell, characterized in that: which is a prokaryotic cell or a eukaryotic cell transformed with the expression vector of claim 3.
5. The gene encoding β -glucosidase of claim 1mg163Application in preparing beta-glucosidase MG 163.
6. Use of the β -glucosidase MG163 as defined in claim 5 for the preparation of oligosaccharides.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202010343911.XA CN111394375B (en) | 2020-04-27 | 2020-04-27 | Gene for coding beta-glucosidasemg163And uses thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202010343911.XA CN111394375B (en) | 2020-04-27 | 2020-04-27 | Gene for coding beta-glucosidasemg163And uses thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN111394375A CN111394375A (en) | 2020-07-10 |
| CN111394375B true CN111394375B (en) | 2021-08-27 |
Family
ID=71433587
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202010343911.XA Active CN111394375B (en) | 2020-04-27 | 2020-04-27 | Gene for coding beta-glucosidasemg163And uses thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN111394375B (en) |
Family Cites Families (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20100189706A1 (en) * | 2007-01-30 | 2010-07-29 | Cathy Chang | Enzymes for the treatment of lignocellulosics, nucleic acids encoding them and methods for making and using them |
| CN100575484C (en) * | 2007-07-06 | 2009-12-30 | 广西大学 | A kind of beta-glucosidase and encoding gene thereof and application |
| WO2018127486A1 (en) * | 2017-01-03 | 2018-07-12 | Novozymes A/S | Enzymatic dehusking of pulses |
| CN107384895B (en) * | 2017-07-17 | 2018-06-26 | 吉林农业大学 | A kind of beta-glucosidase and its preparation method and application |
-
2020
- 2020-04-27 CN CN202010343911.XA patent/CN111394375B/en active Active
Also Published As
| Publication number | Publication date |
|---|---|
| CN111394375A (en) | 2020-07-10 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US9297000B2 (en) | Alpha-neoagarobiose hydrolase and method for obtaining a monosaccharide using same | |
| CN110982807B (en) | High-efficiency stable cellulase mutant | |
| CN112430615A (en) | Chitosanase gene csnbaa, chitosanase, preparation method and application thereof | |
| EP3031926A1 (en) | Thermostable ss-glucosidase | |
| CN111893125A (en) | Chitosan enzyme gene, chitosanase, preparation method and application thereof | |
| CN107828806A (en) | A kind of β alpha-glucosidase genes of new resistance to glucose and its application | |
| CN107254458A (en) | A kind of trichoderma reesei chitinase and its preparation method and application | |
| CN110951803B (en) | Method for preparing neoagarobiose by combined utilization of agarase, recombinant host cell and application of recombinant host cell and expression vector | |
| KR101062978B1 (en) | Production Optimization and Gene Cloning of Endoglucanases Derived from the New Bacterium Penicillium Pinophilum ＫＭＪ601 | |
| CN110643622A (en) | Alginate lyase gene and application thereof | |
| CN106459942B (en) | Exoglucanase variants with enhanced activity and uses thereof | |
| CN112111472B (en) | Novel beta-xylosidase and preparation thereof | |
| WO2010101158A1 (en) | Novel gene derived from clostridium cellulovorans and use thereof | |
| CN111394375B (en) | Gene for coding beta-glucosidasemg163And uses thereof | |
| CN111394374A (en) | Cellulase gene gk2691 for encoding cellulase family GH30 and application thereof | |
| CN107236719B (en) | Thermostable cellobiohydrolase | |
| CN112646797B (en) | Method for heterogeneously expressing stropharia rugoso-annulata beta-glucosidase gene | |
| CN111733169B (en) | Element for regulating and controlling fungal lignocellulose degradation enzyme system expression and application thereof | |
| CN114736881A (en) | Glucose oxidase GoxM10 mutant A4D with improved acid stability and derivative mutant and application thereof | |
| JP2015012852A (en) | Method of producing biofuel comprising microalgae biomass as raw material | |
| CN103290039B (en) | Alpha-amylase derived from animal feces metagenome and gene of the alpha-amylase | |
| CN108823188B (en) | Endoglucanase, and coding gene and application thereof | |
| CN114015673B (en) | Lipase Sv-lip5 and application thereof in hydrolysis of astaxanthin ester | |
| CN113151224B (en) | Exo-glucanase gene CEL1 and application thereof in preparation of kelp hydrolysate | |
| CN111757939A (en) | Mutant beta-glucosidase |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |