CN111378773A - Primer combination and detection method for detecting pathogens of 2 soft rot diseases of orchidaceae plants - Google Patents
Primer combination and detection method for detecting pathogens of 2 soft rot diseases of orchidaceae plants Download PDFInfo
- Publication number
- CN111378773A CN111378773A CN202010412579.8A CN202010412579A CN111378773A CN 111378773 A CN111378773 A CN 111378773A CN 202010412579 A CN202010412579 A CN 202010412579A CN 111378773 A CN111378773 A CN 111378773A
- Authority
- CN
- China
- Prior art keywords
- primers
- pathogens
- primer
- soft rot
- dna
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
- 244000052769 pathogen Species 0.000 title claims abstract description 41
- 241000233855 Orchidaceae Species 0.000 title claims abstract description 27
- 238000001514 detection method Methods 0.000 title abstract description 12
- 201000010099 disease Diseases 0.000 title description 6
- 208000037265 diseases, disorders, signs and symptoms Diseases 0.000 title description 6
- 241000588701 Pectobacterium carotovorum Species 0.000 claims abstract description 30
- 230000001717 pathogenic effect Effects 0.000 claims abstract description 18
- 238000000034 method Methods 0.000 claims abstract description 12
- 239000012634 fragment Substances 0.000 claims abstract description 7
- 241001187099 Dickeya Species 0.000 claims description 31
- 238000006243 chemical reaction Methods 0.000 claims description 21
- 230000003321 amplification Effects 0.000 claims description 20
- 238000003199 nucleic acid amplification method Methods 0.000 claims description 20
- 244000000626 Daucus carota Species 0.000 claims description 18
- 235000002767 Daucus carota Nutrition 0.000 claims description 18
- 238000011144 upstream manufacturing Methods 0.000 claims description 7
- 229920000936 Agarose Polymers 0.000 claims description 5
- 238000000137 annealing Methods 0.000 claims description 5
- 238000004925 denaturation Methods 0.000 claims description 5
- 230000036425 denaturation Effects 0.000 claims description 5
- 238000001962 electrophoresis Methods 0.000 claims description 5
- 238000012257 pre-denaturation Methods 0.000 claims description 5
- 241000588698 Erwinia Species 0.000 claims description 4
- 241000190074 Oncidium Species 0.000 abstract description 14
- 241001523681 Dendrobium Species 0.000 abstract description 10
- 241001505935 Phalaenopsis Species 0.000 abstract description 7
- 241001187100 Dickeya dadantii Species 0.000 abstract description 2
- 241001524109 Dietzia Species 0.000 abstract description 2
- 239000003795 chemical substances by application Substances 0.000 abstract 1
- 230000008030 elimination Effects 0.000 abstract 1
- 238000003379 elimination reaction Methods 0.000 abstract 1
- 230000000694 effects Effects 0.000 description 22
- 244000127818 Phalaenopsis amabilis Species 0.000 description 9
- 239000000047 product Substances 0.000 description 8
- XLYOFNOQVPJJNP-UHFFFAOYSA-N water Substances O XLYOFNOQVPJJNP-UHFFFAOYSA-N 0.000 description 8
- 230000004544 DNA amplification Effects 0.000 description 5
- 241000196324 Embryophyta Species 0.000 description 5
- 239000000243 solution Substances 0.000 description 4
- 239000008223 sterile water Substances 0.000 description 4
- 238000007400 DNA extraction Methods 0.000 description 3
- 238000010790 dilution Methods 0.000 description 3
- 239000012895 dilution Substances 0.000 description 3
- 241000894006 Bacteria Species 0.000 description 2
- 108010059820 Polygalacturonase Proteins 0.000 description 2
- 244000052616 bacterial pathogen Species 0.000 description 2
- 238000007865 diluting Methods 0.000 description 2
- 239000003085 diluting agent Substances 0.000 description 2
- 238000011081 inoculation Methods 0.000 description 2
- 239000000463 material Substances 0.000 description 2
- 108090000623 proteins and genes Proteins 0.000 description 2
- 230000035945 sensitivity Effects 0.000 description 2
- 238000010008 shearing Methods 0.000 description 2
- 239000006228 supernatant Substances 0.000 description 2
- 208000024891 symptom Diseases 0.000 description 2
- VTYYLEPIZMXCLO-UHFFFAOYSA-L Calcium carbonate Chemical compound [Ca+2].[O-]C([O-])=O VTYYLEPIZMXCLO-UHFFFAOYSA-L 0.000 description 1
- LZZYPRNAOMGNLH-UHFFFAOYSA-M Cetrimonium bromide Chemical compound [Br-].CCCCCCCCCCCCCCCC[N+](C)(C)C LZZYPRNAOMGNLH-UHFFFAOYSA-M 0.000 description 1
- 240000004638 Dendrobium nobile Species 0.000 description 1
- 108090000790 Enzymes Proteins 0.000 description 1
- 102000004190 Enzymes Human genes 0.000 description 1
- 238000012408 PCR amplification Methods 0.000 description 1
- 241000700605 Viruses Species 0.000 description 1
- 230000005540 biological transmission Effects 0.000 description 1
- 230000015572 biosynthetic process Effects 0.000 description 1
- 210000002421 cell wall Anatomy 0.000 description 1
- 230000007547 defect Effects 0.000 description 1
- 230000001066 destructive effect Effects 0.000 description 1
- 230000007613 environmental effect Effects 0.000 description 1
- 108010093305 exopolygalacturonase Proteins 0.000 description 1
- 238000002474 experimental method Methods 0.000 description 1
- 239000003550 marker Substances 0.000 description 1
- 239000000203 mixture Substances 0.000 description 1
- 238000012986 modification Methods 0.000 description 1
- 230000004048 modification Effects 0.000 description 1
- 230000007918 pathogenicity Effects 0.000 description 1
- 230000005080 plant death Effects 0.000 description 1
- 239000002689 soil Substances 0.000 description 1
- 239000000126 substance Substances 0.000 description 1
- 238000003786 synthesis reaction Methods 0.000 description 1
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/689—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for bacteria
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/166—Oligonucleotides used as internal standards, controls or normalisation probes
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Analytical Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Organic Chemistry (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Microbiology (AREA)
- Immunology (AREA)
- Molecular Biology (AREA)
- Biotechnology (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention provides a primer combination and a detection method for detecting 2 soft rot pathogens of orchidaceae plants. 6 primers are designed through the common specific fragment of two pathogens and can be used for detecting the erwinia carotovora subspecies of the orchidaceae plantErwinia carotovorasubsp.carotovora) And Dietzia dadantii (a)Dickeyadadantii) A pathogenic agent. According to the invention, 6 primers are designed aiming at three common characteristic sites of two pathogens, and a true positive sample can generate two positive fragments for eliminating false positives; the invention also increases the elimination of false negativesDesigning a primer, namely designing a site aiming at two common characteristic sites of the oncidium, the dendrobium and the phalaenopsis, wherein 1 positive fragment can be generated by true negativity. The invention has low requirement on equipment, and the whole process can be finished in only 2 hours at the fastest speed.
Description
Technical Field
The invention relates to the field of plant virus detection, and in particular relates to a primer combination and a detection method for detecting 2 soft rot pathogens of orchidaceae plants.
Background
Soft rot is an important disease of various cultivated crops, orchids are very susceptible to the soft rot, and the Erwinia carotovora subspecies (L.) of carrot soft rotErwinia carotovorasubsp.carotovora) And Dietzia dadantii (a)Dickeya dadantii) The main pathogenic substance causing soft rot of orchid has been in oncidium(Oncidium)Dendrobium nobile (A) and (B)Dendrobium) Butterfly orchidPhaleanopsis) And the like are found on plants with soft rot diseases. The two have close relationship, and both rely on secreted extracellular enzymes such as pectinase and polygalacturonase to degrade the cell wall of a host plant to generate pathogenicity, and have strong transmissibility and large destructive power, and the orchid can cause large-area morbidity in high-temperature rainy seasons to cause mass plant death. At present, germplasm with resistance to soft rot is not found in large-scale planted oncidium, dendrobium and butterfly orchid. Therefore, cutting off the transmission path of the soft rot pathogen from the seed source and the environment is an important means for preventing soft rot of orchids.
The traditional method for eliminating soft rot pathogen needs to eliminate plants with existing symptoms. In addition to the need for strong technical experience, this method is strongly influenced by environmental conditions, such as the above pathogens do not develop disease in low temperature environments, but can remain latent in the plant, soil and water for months without causing any symptoms. Therefore, the detection by utilizing the intrinsic characteristics of the soft rot pathogen is an effective technical means for discovering the potential soft rot pathogen. The invention utilizes characteristic segments of different types of Erwinia carotovora subspecies and Dickinra which are separated from Orchidaceae to design primers, can simultaneously detect the Erwinia carotovora subspecies and the Dickinra, and can utilize 3 specific sites to design the primers to generate two target segments so as to avoid the generation of false positive. Meanwhile, in order to avoid the generation of false negative, the invention also designs 1 pair of consensus gene sequence internal reference primers suitable for oncidium, dendrobium and phalaenopsis, which can eliminate false negative due to DNA extraction quality and detection procedures.
Disclosure of Invention
Aiming at the defects in the field, the invention provides a primer combination and a detection method for detecting 2 soft rot pathogens of orchidaceae plants, which can simultaneously detect the pathogens of erwinia carotovora subspecies and dirachtin dadantii.
The invention adopts the following technical scheme:
the primer combination for detecting 2 soft rot pathogens of orchidaceae plants is characterized in that 6 primers are designed aiming at three common characteristic sites of two pathogens, a true positive sample can generate two positive fragments, and the specific primer sequences are as follows:
dirachella dadantii:
an upstream primer:
Dickeya F85：AAGCTTGCTTCCCCGCCG，
a downstream primer:
Dickeya R260:CCTACTAGCTAATCCCATCTGGGTT，
Dickeya R418:GAAACCCTGATGCAGCCATG，
primer for carrot soft rot Erwinia carrot subspecies:
an upstream primer:
PCC F85：GAAGAGCTTGCTCTTTGGGTGAC，
a downstream primer:
Pcc R260:CTACTAGCTAATCCCATCTGGGCA，
PCC R418:GCAAGCCTGATGCAGCCAT。
3 primers of the same pathogen can react together, for example, Dickeya F85 of Dieckea ducrehensis can react together with Dickeya R260 and Dickeya R418, and the carrot soft rot Erwinia carrot subspecies can react together with PCCR260 and PCC R418 for PCC F85; or the upstream primer can react with two downstream primers in different PCR tubes respectively, such as Dickeya Ddantii primers Dickeya F85 and Dickeya R260, Dickeya F85 and Dickeya R418, Erwinia carotovora subspecies are primers PCC F85 and PCC R260, and PCC F85 and PCC R418 respectively.
Designing sites aiming at two common characteristic sites of the oncidium, the dendrobium and the phalaenopsis, and designing 2 pieces of internal reference primers:
ORCH_ACTF850：GTGTGGCTAACACCATCACCAG，
ORCH_ACTR1170：CTGGTTTTGCTGGTGATGATGC。
a method for detecting 2 soft rot pathogens of orchidaceae plants comprises the following steps:
(1) extracting total DNA of a sample to be detected;
(2) carrying out PCR reaction by adopting the primer combination and taking the DNA of a sample to be detected as a template to obtain an amplification product;
(3) detecting 1-6 microliter of amplification product by 1% agarose electrophoresis, if a pathogen primer PCR product is added to generate positive bands with the sizes of 200 bp and 335bp, indicating that the sample contains the pathogens of Erwinia carotovora and Dadadandeli dickinia; if the sample is negative and only the Lanceae reference primer band appears, the sample DNA is available, but the above two pathogens are not detected.
The PCR reaction system is 20 mu L, DNA template is 1 mu L, different pathogeny or internal reference upstream and downstream primers are 1 mu L respectively, 2 × Taq PCR Mix reaction solution is 10 mu L, dd H is added2O to a total volume of 20. mu.L.
The PCR reaction conditions are as follows: pre-denaturation at 94 ℃ for 4 min; denaturation at 94 ℃ for 20 s, annealing at 52-56 ℃ for 20 s, and extension at 72 ℃ for 30 s for 40 cycles; extension at 72 ℃ for 6 min.
The invention has the advantages that:
according to the invention, 6 primers are designed aiming at three common characteristic sites of two pathogens, and a true positive sample can generate two positive fragments for eliminating false positives;
the invention also adds an internal reference primer design for eliminating false negative, and by designing loci aiming at two common characteristic loci of oncidium, dendrobe and phalaenopsis, the true negative can generate 1 positive fragment;
the invention has low equipment requirement, and the whole process can be finished in 2 hours at the fastest speed;
the detection method of the invention can detect the leaf of orchidaceae with the sensitivity equivalent to 10-5g diseased leaf tissue amount (50 ng diseased leaf), namely, a pathogen specific strip can still be amplified after sample DNA is diluted by 10000 times.
Drawings
FIG. 1 leaves inoculated with pathogenic bacteria, wherein A is leaves of Phalaenopsis amabilis 24 h inoculated with Erwinia carotovora subspecies; b is inoculated with 24 h aragonite leaf of the diekeramia dadanensis; c is healthy dendrobium leaves.
FIG. 2 shows PCR amplification effect of different primers in inoculated and non-inoculated leaves of Orchidaceae. Lane 1: the internal reference primer has the DNA amplification effect on phalaenopsis leaves; lane 2: the leaf DNA amplification effect of the oncidium primers; lane 3: 3 pieces of the carrot soft-rot Erwinia carotovora subspecies primer has 24 h butterfly orchid leaf DNA amplification effect after inoculating the carrot soft-rot Erwinia carotovora subspecies; lane 4: 3 Dieckea dabdanensis primers have DNA amplification effect on 24 h oncidium leaves inoculated with Dieckea dabdanensis; lane 5: the amplification effect of the internal reference primer on dendrobii herba, lanes 6, 7: the amplification effect of the pathogenic bacteria primer on the healthy dendrobium.
FIG. 33 shows the DNA amplification effect of the Dieckia dadantii specific primers on inoculation of Dieckia dadantii in 24 h Wenhuan. Lanes 1-6 show the amplification effect of Dieckia dadantii infecting oncidium DNA from 1, 10, 100, 1000, 10000, 100000 dilutions, and M is DNA Marker 2000.
FIG. 4 shows the inoculation of both Dieckia dadantii and Erwinia carotovora of the subfamily Phalaenopsis for 24 h leaves.
FIG. 5 shows the amplification effect of different primers simultaneously inoculating Dieckia dadantii and Erwinia carotovora subspecies onto the butterfly orchid leaf. Lane 1 shows the amplification effect of Dickeya F85 and Dickeya R480 in the Dickeya dadana primer, lane 2 shows the amplification effect of Dickeya F85 and Dickeya R260 in the Dickeya, lane 3 shows the amplification effect of the reference primer, lane 4 shows the amplification effect of PCC F85 and PCC R480 in the erwinia carotovora subspecies primer, lane 5 shows the amplification effect of PCC F85 and PCC R260 in the erwinia carotovora subspecies primer, and lane 6 shows the amplification effect of the reference primer.
Detailed Description
The present invention is explained below by means of specific experiments, it should be construed that the following examples are only illustrative and do not constitute any limitation of the present invention.
Example 1:
as shown in figure 1, the leaf of Phalaenopsis amabilis 24 h of Erwinia carotovora subspecies carrot of Erwinia carotovora is inoculated by the institute of agricultural science, Mingming, Ming; inoculating dicke bacteria 24 h leaves of oncidium; simultaneously inoculating the carrot soft-rot Erwinia carotovora subspecies and the dicke bacteria Venheart blue leaves; healthy dendrobium leaves are used as materials.
DNA extraction:
0.5 g of the healthy leaves and 0.5 g of the diseased and healthy combining part leaves are cut off respectively, and DNA is extracted by a CTAB method.
Primer synthesis:
pathogen-specific primers and orchidaceae internal control primers were synthesized according to table 1. The primers were synthesized by Beijing Liuhe Huada Gene science and technology, Inc.
The PCR reaction system is 20 mul, DNA template is 1 mul, different upstream and downstream primers are 1 mul respectively at 10 mul mol/L, 2 × TaqPCR Mix reaction solution is 10 mul, add dd H2O to a total volume of 20. mu.L.
The PCR reaction system is 20 mu L; the PCR reaction conditions are as follows: pre-denaturation at 94 ℃ for 4 min; denaturation at 94 ℃ for 20 s, annealing at 52-56 ℃ for 20 s, and extension at 72 ℃ for 30 s for 40 cycles; extension at 72 ℃ for 6 min.
In FIG. 2, the primers and DNA templates in the reaction tubes of different lanes are as follows:
lane 1: the DNA template is inoculated with 24 h butterfly orchid leaf DNA of carrot soft rot Erwinia carotovora subspecies, and primers are ORCH _ ACTF850 and ORCH _ ACT 1170;
lane 2: inoculating DNA template with leaf DNA of dickinsonia dadantii 24 h, wherein primers are ORCH _ ACTF850 and ORCH _ ACT 1170;
lane 3: the DNA template is inoculated with carrot soft rot Erwinia carotovora subspecies 24 h butterfly orchid leaf DNA, and the primer is 3 carrot soft rot Erwinia carotovora subspecies primers;
lane 4: the DNA template is inoculated with Diels dadandeli 24 h oncidium leaf DNA, and the primers are 3 Diels dadandeli primers;
lane 5: the DNA template is the DNA of healthy dendrobium, and the primers are ORCH _ ACTF850 and ORCH _ ACT 1170;
lane 6: the DNA template is the DNA of healthy dendrobium, and the primers are 3 carrot soft rot Erwinia carrot subspecies primers;
lane 7: the DNA template is the DNA of healthy dendrobii orchid, and the primers are 3 dachia dadantii primers.
Detecting 1-6 μ L of the amplified product by 1% agarose electrophoresis, as shown in FIG. 2, adding pathogen primer PCR product lanes 3 and 4, and showing positive bands of 200 bp and 335bp, which indicates that the sample contains Erwinia carotovora subspecies and Dieckia ureae pathogen; the PCR product of the primers for the internal reference of the family Orchidaceae detects characteristic positive bands of phalaenopsis, oncidium and dendrobe in lanes 1, 2 and 5, but does not detect the specific bands of the two pathogens in lanes 6 and 7 of healthy dendrobe. The primer can normally amplify and inoculate the characteristic sequence of the pathogen and the internal reference sequence of the orchid, and does not amplify the characteristic sequence of the pathogen in the healthy orchid.
TABLE 1 primer List
Example 2
Inoculating dickeria 24 h oncidium leaves as a material
DNA extraction:
shearing 0.5 g of the leaf of the diseased and healthy combining part of the leaf, homogenizing with 1mL of sterile water, centrifuging to obtain supernatant, and diluting with sterile water to obtain 1, 10, 100, 1000, 10000 and 100000 times of diluent for later use.
The PCR reaction system is 20 μ L, 1 μ L of each of the above dilution template, 10 μmol/L3 Dickinsonia dadantii primers, 10 μ L of 2 × Taq PCR Mix reaction solution, and dd H2O to a total volume of 20. mu.L.
The PCR reaction system is 20 mu L; the PCR reaction conditions are as follows: pre-denaturation at 94 ℃ for 4 min; denaturation at 94 ℃ for 20 s, annealing at 52-56 ℃ for 20 s, and extension at 72 ℃ for 30 s for 40 cycles; extension at 72 ℃ for 6 min.
1-6 μ L of the amplified product was detected by 1% agarose electrophoresis, as shown in FIG. 3, it can be seen that the detection method can detect leaves of Orchidaceae with a sensitivity equivalent to 10-5g diseased leaf tissue amount (50 ng diseased leaf), namely, a pathogen specific strip can still be amplified after sample DNA is diluted by 10000 times.
Example 3
Shearing and inoculating 0.5 g (figure 4) of leaf blade of 24 h leaf blade disease-healthy combining part of phalaenopsis amabilis of the Dickinsonia and the Erwinia carotovora subspecies simultaneously, homogenizing with 1mL of sterile water, centrifuging to obtain supernatant, and diluting with sterile water into 1, 10, 100, 1000, 10000 and 100000 times of diluent for later use.
The PCR reaction system is 20 μ L, the dilution template is 1 μ L, the upstream and downstream primers are 1 μ L each at 10 μmol/L, the 2 × Taq PCR Mix reaction solution is 10 μ L, add dd H2O to a total volume of 20. mu.L.
The PCR reaction system is 20 mu L; the PCR reaction conditions are as follows: pre-denaturation at 94 ℃ for 4 min; denaturation at 94 ℃ for 20 s, annealing at 52-56 ℃ for 20 s, and extension at 72 ℃ for 30 s for 40 cycles; extension at 72 ℃ for 6 min.
In FIG. 5, the combinations of primers in different lanes are as follows
Lane 1: dicke's primer Dickeya F85 and Dickeya R480;
lane 2: dickeya primers Dickeya F85 and Dickeya R260;
lane 3: internal reference primers ORCH _ ACTF850 and ORCH _ ACT 1170;
lane 4: erwinia carotovora carrot subspecies primers PCC F85 and PCC R480;
lane 5: erwinia carotovora carrot subspecies primer PCC F85 and PCC R260,
lane 6: internal reference primers ORCH _ ACTF850 and ORCH _ ACT 1170.
1-6 μ L of the amplification product was detected by 1% agarose electrophoresis, as shown in FIG. 5, the butterfly orchid leaf with different primers can be inoculated with Dieckea and Erwinia carotovora at the same time to amplify specific bands. Lane 1 shows the amplification effect of the Dickeya primers Dickeya F85 and Dickeya R480, lane 2 shows the amplification effect of the Dickeya primers Dickeya F85 and Dickeya R260, and lane 3 shows the amplification effect of the internal reference primers; lane 4 shows the amplification effect of the E.carotovora subspecies carotovora primers PCC F85 and PCC R480, Lane 5 shows the amplification effect of the E.carotovora subspecies PCC F85 and PCC R260, and Lane 6 shows the amplification effect of the reference primers. The detection method can detect the specificity bands of pathogenic leaf pathogens of the orchidaceae of the Dickinsonia and Erwinia carotovora subspecies.
The above description is only a preferred embodiment of the present invention, and all equivalent changes and modifications made in accordance with the claims of the present invention should be covered by the present invention.
SEQUENCE LISTING
<110> university of ningde college
<120> primer combination and detection method for detecting 2 soft rot pathogens of orchidaceae plants
<130>6
<160>6
<170>PatentIn version 3.3
<210>1
<211>18
<212>DNA
<213> Artificial sequence
<400>1
aagcttgctt ccccgccg 18
<210>2
<211>25
<212>DNA
<213> Artificial sequence
<400>2
cctactagct aatcccatct gggtt 25
<210>3
<211>20
<212>DNA
<213> Artificial sequence
<400>3
gaaaccctga tgcagccatg 20
<210>4
<211>23
<212>DNA
<213> Artificial sequence
<400>4
gaagagcttg ctctttgggt gac 23
<210>5
<211>24
<212>DNA
<213> Artificial sequence
<400>5
ctactagcta atcccatctg ggca 24
<210>6
<211>19
<212>DNA
<213> Artificial sequence
<400>6
gcaagcctga tgcagccat 19
Claims (6)
1. A primer combination for detecting 2 soft rot pathogens of orchidaceae plants is characterized in that: the method comprises 6 primers, wherein a true positive sample can generate two positive fragments, and the specific sequences of the primers are as follows:
the Dieckia dadantii primer:
Dickeya F85：AAGCTTGCTTCCCCGCCG，
Dickeya R260: CCTACTAGCTAATCCCATCTGGGTT，
Dickeya R418: GAAACCCTGATGCAGCCATG；
primer for carrot soft rot Erwinia carrot subspecies:
PCC F85：GAAGAGCTTGCTCTTTGGGTGAC，
Pcc R260: CTACTAGCTAATCCCATCTGGGCA，
PCC R418: GCAAGCCTGATGCAGCCAT。
2. the primer combination for detecting 2 soft rot pathogens of orchidaceae plants according to claim 1, further comprising 2 internal reference primers:
ORCH_ACTF850：GTGTGGCTAACACCATCACCAG，
ORCH_ACTR1170：CTGGTTTTGCTGGTGATGATGC。
3. the primer combination for detecting 2 soft rot pathogens of orchid plants according to claim 1, wherein the pathogens are erwinia carotovora subspecies carotovora and diekeria dadantii.
4. A method for detecting 2 soft rot pathogens of orchidaceae plants is characterized in that:
the method comprises the following steps:
(1) extracting total DNA of a sample to be detected;
(2) carrying out PCR reaction by using the primers of claims 1 and 2 and a sample DNA to be detected as a template to obtain an amplification product;
(3) 1% agarose electrophoresis detects 1-6. mu.L of amplified product, when PCR product with added pathogen primer shows positive bands of 200 bp and 335bp, it indicates that the sample DNA is usable and contains Erwinia carotovora subspecies and Ddaniella diculus pathogen, and when only amplified band with Lanceae reference primer, it indicates that the sample DNA is usable, but the above two pathogens are not detected.
5. The method of claim 4, wherein the PCR reaction system comprises 20 μ L of 1 μ L of DNA template, 1 μ L of each of the upstream and downstream primers of 10 μmol/L different pathogens or internal references, 10 μ L of 2 × Taq PCR Mix reaction solution, and ddh2O to the total volume of 20 mu L; in order to avoid false positive, primers for amplifying different pathogens and internal reference primers are respectively reacted in a single PCR tube.
6. The method of claim 4, wherein the PCR reaction conditions are: pre-denaturation at 94 ℃ for 4 min; denaturation at 94 ℃ for 20 s, annealing at 52-56 ℃ for 20 s, and extension at 72 ℃ for 30 s for 40 cycles; extension at 72 ℃ for 6 min.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202010412579.8A CN111378773A (en) | 2020-05-15 | 2020-05-15 | Primer combination and detection method for detecting pathogens of 2 soft rot diseases of orchidaceae plants |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202010412579.8A CN111378773A (en) | 2020-05-15 | 2020-05-15 | Primer combination and detection method for detecting pathogens of 2 soft rot diseases of orchidaceae plants |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN111378773A true CN111378773A (en) | 2020-07-07 |
Family
ID=71217646
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202010412579.8A Pending CN111378773A (en) | 2020-05-15 | 2020-05-15 | Primer combination and detection method for detecting pathogens of 2 soft rot diseases of orchidaceae plants |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN111378773A (en) |
Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO1993025708A1 (en) * | 1992-06-05 | 1993-12-23 | Institut National De La Recherche Agronomique (Inra) | NUCLEOTIDIQUE SEQUENCES OBTAINED FROM GENES CODING PECTATE-LYASES, AND UTILIZATIONS THEREOF PARTICULARLY FOR THE DETECTION OF BACTERIA OF THE GENUS $i(ERWINIA) |
| KR20020064386A (en) * | 2001-02-01 | 2002-08-09 | 주식회사 제노바이오텍 | The new Bacillus sp. having an antibacterial effect against the bacterial soft rot disease and the prevention method of bacterial soft rot disease utilizing thereof |
| CN108588249A (en) * | 2018-06-26 | 2018-09-28 | 浙江大学 | A kind of primer pair and its detection method for detecting sweet potato Pathogen |
| CN108866219A (en) * | 2018-08-13 | 2018-11-23 | 华中农业大学 | Soft rot bacteria of Elephant taro specific sequence and its detection primer and application |
-
2020
- 2020-05-15 CN CN202010412579.8A patent/CN111378773A/en active Pending
Patent Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO1993025708A1 (en) * | 1992-06-05 | 1993-12-23 | Institut National De La Recherche Agronomique (Inra) | NUCLEOTIDIQUE SEQUENCES OBTAINED FROM GENES CODING PECTATE-LYASES, AND UTILIZATIONS THEREOF PARTICULARLY FOR THE DETECTION OF BACTERIA OF THE GENUS $i(ERWINIA) |
| KR20020064386A (en) * | 2001-02-01 | 2002-08-09 | 주식회사 제노바이오텍 | The new Bacillus sp. having an antibacterial effect against the bacterial soft rot disease and the prevention method of bacterial soft rot disease utilizing thereof |
| CN108588249A (en) * | 2018-06-26 | 2018-09-28 | 浙江大学 | A kind of primer pair and its detection method for detecting sweet potato Pathogen |
| CN108866219A (en) * | 2018-08-13 | 2018-11-23 | 华中农业大学 | Soft rot bacteria of Elephant taro specific sequence and its detection primer and application |
Non-Patent Citations (2)
| Title |
|---|
| 刘鹏等: "菊欧文氏菌分子检测技术的研究", 《植物病理学报》 * |
| 马改转等: "胡萝卜软腐欧文氏菌分子检测技术的研究", 《华南农业大学学报》 * |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Hirota et al. | Yellowing disease of tomato caused by Tomato chlorosis virus newly recognized in Japan | |
| Yang et al. | Anastomosis group and pathogenicity of Rhizoctonia solani associated with stem canker and black scurf of potato in China | |
| Meena et al. | Development of multiplex polymerase chain reaction assay for simultaneous detection of clostero-, badna-and mandari-viruses along with huanglongbing bacterium in citrus trees | |
| Salehi et al. | Occurrence, molecular characterization and vector transmission of a phytoplasma associated with rapeseed phyllody in Iran | |
| Stulberg et al. | A multiplex PCR assay to detect and differentiate select agent strains of Ralstonia solanacearum | |
| Chai et al. | Quantification of viable cells of Pseudomonas syringae pv. tomato in tomato seed using propidium monoazide and a real-time PCR assay | |
| Snehi et al. | Complete nucleotide sequence of Croton yellow vein mosaic virus and DNA-β associated with yellow vein mosaic disease of Jatropha gossypifolia in India | |
| Hafez et al. | Specific detection and identification of Fusarium graminearum sensu stricto using a PCR-RFLP tool and specific primers targeting the translational elongation factor 1α gene | |
| Joseph et al. | First report of Meloidogyne haplanaria infecting Mi-resistant tomato plants in Florida and its molecular diagnosis based on mitochondrial haplotype | |
| Marwal et al. | First report of airborne begomovirus infection in Melia azedarach (Pride of India), an ornamental tree in India | |
| Singh et al. | Quick and accurate detection of Fusarium oxysporum f. sp. carthami in host tissue and soil using conventional and real-time PCR assay | |
| Snehi et al. | Molecular identification of a new begomovirus associated with yellow mosaic disease of Jatropha gossypifolia in India | |
| Shu et al. | Detection and control of Pantoea agglomerans causing plum bacterial shot-hole disease by loop-mediated isothermal amplification technique | |
| CN108004346B (en) | Wheat gene Yr10 molecular marker and application thereof in screening wheat with wheat stripe rust resistance | |
| Arinaitwe et al. | Molecular characteristics of tomato mosaic virus infecting tomato in Uganda | |
| Baranwal et al. | A novel approach for simultaneous detection of Citrus yellow mosaic virus and Citrus greening bacterium by multiplex polymerase chain reaction | |
| CN111378773A (en) | Primer combination and detection method for detecting pathogens of 2 soft rot diseases of orchidaceae plants | |
| Meena et al. | Development of RT-PCR degenerate primers for the detection of two mandariviruses infecting citrus cultivars in India | |
| Zhang et al. | First report of pea as a natural host of Tomato mottle mosaic virus in China | |
| Hosseini et al. | Incidence and molecular characterization of a 16SrI-B phytoplasma strain associated with Eruca sativa phyllody in Iran | |
| Daliyamol et al. | Complete genome sequence and phylogenetic relationships of tobacco streak virus causing groundnut stem necrosis disease in India | |
| CN106947837A (en) | RT PCR detection primers group, kit and its application of 2 kinds of melon quarantine diseases of synchronous detection | |
| Puia et al. | Occurrence of Curtobacterium flaccumfaciens pv. flaccumfaciens in the state of Paraná and its pathogenicity in beans | |
| WO2020009012A1 (en) | Cucumber mosaic virus attenuated strain | |
| Nurenik et al. | Double Infection of Onion yellow dwarf virus and Shallot latent virus in Garlic from Several Regions in Indonesia |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| RJ01 | Rejection of invention patent application after publication | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20200707 |